ID: 1029243063

View in Genome Browser
Species Human (GRCh38)
Location 7:99178150-99178172
Sequence CCCGAGTGGAAGCAGACCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029243052_1029243063 29 Left 1029243052 7:99178098-99178120 CCGGCAGGAGCCTTTGGGGGATA 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1029243063 7:99178150-99178172 CCCGAGTGGAAGCAGACCAAAGG 0: 1
1: 0
2: 0
3: 4
4: 69
1029243058_1029243063 -7 Left 1029243058 7:99178134-99178156 CCCTCAAGGGAGCTGCCCCGAGT 0: 1
1: 0
2: 0
3: 8
4: 73
Right 1029243063 7:99178150-99178172 CCCGAGTGGAAGCAGACCAAAGG 0: 1
1: 0
2: 0
3: 4
4: 69
1029243051_1029243063 30 Left 1029243051 7:99178097-99178119 CCCGGCAGGAGCCTTTGGGGGAT 0: 1
1: 0
2: 1
3: 37
4: 170
Right 1029243063 7:99178150-99178172 CCCGAGTGGAAGCAGACCAAAGG 0: 1
1: 0
2: 0
3: 4
4: 69
1029243059_1029243063 -8 Left 1029243059 7:99178135-99178157 CCTCAAGGGAGCTGCCCCGAGTG 0: 1
1: 0
2: 1
3: 8
4: 133
Right 1029243063 7:99178150-99178172 CCCGAGTGGAAGCAGACCAAAGG 0: 1
1: 0
2: 0
3: 4
4: 69
1029243055_1029243063 19 Left 1029243055 7:99178108-99178130 CCTTTGGGGGATAGGGACTCTGT 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1029243063 7:99178150-99178172 CCCGAGTGGAAGCAGACCAAAGG 0: 1
1: 0
2: 0
3: 4
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029243063 Original CRISPR CCCGAGTGGAAGCAGACCAA AGG Intronic