ID: 1029243064

View in Genome Browser
Species Human (GRCh38)
Location 7:99178151-99178173
Sequence GCCTTTGGTCTGCTTCCACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029243064_1029243069 23 Left 1029243064 7:99178151-99178173 CCGAGTGGAAGCAGACCAAAGGC 0: 1
1: 0
2: 1
3: 17
4: 167
Right 1029243069 7:99178197-99178219 CAATTTCACTTTTCCCAAATTGG 0: 1
1: 0
2: 1
3: 40
4: 313
1029243064_1029243066 -7 Left 1029243064 7:99178151-99178173 CCGAGTGGAAGCAGACCAAAGGC 0: 1
1: 0
2: 1
3: 17
4: 167
Right 1029243066 7:99178167-99178189 CAAAGGCTACCATTCCAGAATGG 0: 1
1: 0
2: 1
3: 18
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029243064 Original CRISPR GCCTTTGGTCTGCTTCCACT CGG (reversed) Intronic