ID: 1029243066

View in Genome Browser
Species Human (GRCh38)
Location 7:99178167-99178189
Sequence CAAAGGCTACCATTCCAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 263}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029243064_1029243066 -7 Left 1029243064 7:99178151-99178173 CCGAGTGGAAGCAGACCAAAGGC 0: 1
1: 0
2: 1
3: 17
4: 167
Right 1029243066 7:99178167-99178189 CAAAGGCTACCATTCCAGAATGG 0: 1
1: 0
2: 1
3: 18
4: 263
1029243062_1029243066 -6 Left 1029243062 7:99178150-99178172 CCCGAGTGGAAGCAGACCAAAGG 0: 1
1: 0
2: 0
3: 9
4: 179
Right 1029243066 7:99178167-99178189 CAAAGGCTACCATTCCAGAATGG 0: 1
1: 0
2: 1
3: 18
4: 263
1029243061_1029243066 -5 Left 1029243061 7:99178149-99178171 CCCCGAGTGGAAGCAGACCAAAG 0: 1
1: 0
2: 1
3: 35
4: 234
Right 1029243066 7:99178167-99178189 CAAAGGCTACCATTCCAGAATGG 0: 1
1: 0
2: 1
3: 18
4: 263
1029243058_1029243066 10 Left 1029243058 7:99178134-99178156 CCCTCAAGGGAGCTGCCCCGAGT 0: 1
1: 0
2: 0
3: 8
4: 73
Right 1029243066 7:99178167-99178189 CAAAGGCTACCATTCCAGAATGG 0: 1
1: 0
2: 1
3: 18
4: 263
1029243059_1029243066 9 Left 1029243059 7:99178135-99178157 CCTCAAGGGAGCTGCCCCGAGTG 0: 1
1: 0
2: 1
3: 8
4: 133
Right 1029243066 7:99178167-99178189 CAAAGGCTACCATTCCAGAATGG 0: 1
1: 0
2: 1
3: 18
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029243066 Original CRISPR CAAAGGCTACCATTCCAGAA TGG Intronic