ID: 1029243291

View in Genome Browser
Species Human (GRCh38)
Location 7:99179967-99179989
Sequence ATGTGGGTGGGGAACTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029243291_1029243300 7 Left 1029243291 7:99179967-99179989 CCTGTGTAGTTCCCCACCCACAT 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1029243300 7:99179997-99180019 GGATGACCTGTGTAACCAATAGG 0: 1
1: 3
2: 17
3: 57
4: 123
1029243291_1029243302 16 Left 1029243291 7:99179967-99179989 CCTGTGTAGTTCCCCACCCACAT 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1029243302 7:99180006-99180028 GTGTAACCAATAGGATGTTGTGG 0: 1
1: 2
2: 11
3: 36
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029243291 Original CRISPR ATGTGGGTGGGGAACTACAC AGG (reversed) Intronic
902111254 1:14080352-14080374 ATGTGGGAAGGGAAATACACGGG + Intergenic
903792993 1:25906874-25906896 ATGTGGGTGGCGCACTAGAAGGG - Intronic
906167115 1:43694634-43694656 ATTTGGGAGGGGAACAACAGAGG + Intronic
906277255 1:44525721-44525743 ATGTGGGTGCTGAAATTCACAGG - Intronic
910674798 1:89806062-89806084 AAGTGGGGTGGGAGCTACACAGG - Intronic
916057656 1:161079243-161079265 ATTTGGGTGGGGCACGACAAAGG + Intronic
916454809 1:164959838-164959860 GTGTATGTGGGGAACTACAAGGG - Intergenic
917525781 1:175787313-175787335 ATGAGGATAGGCAACTACACAGG + Intergenic
917590278 1:176469419-176469441 ATGTTGGTGGGGTACTAGAGGGG - Intronic
918796002 1:188897599-188897621 ATGTGGGTGGGGCAATATAAGGG - Intergenic
919240901 1:194914664-194914686 TTGTGGGAGGGGAAACACACAGG - Intergenic
920389371 1:205589369-205589391 ATGAGGATGGGGAAGTAAACAGG + Intronic
920723952 1:208416242-208416264 CTGTGGCTTGGGGACTACACAGG - Intergenic
921372470 1:214438387-214438409 ATGAGGGTGGGGAACCTCCCTGG + Intronic
923467932 1:234265745-234265767 ATGTGGTGGGGGCACTACAGGGG - Intronic
1065313400 10:24438125-24438147 TTATGGGTGGGGAACTATACTGG + Intronic
1065757578 10:28947591-28947613 TTGTGGGAGGGGAGATACACTGG + Intergenic
1071154619 10:82674741-82674763 GTGGGGGTGGGGAACAAAACGGG - Intronic
1071438302 10:85667160-85667182 ATGTGGGTGCAGATTTACACTGG - Intronic
1071670668 10:87606562-87606584 GAGTGAGTGGGGAACTACATAGG + Intergenic
1072946801 10:99817544-99817566 ATGGTGGTGAAGAACTACACAGG + Intronic
1075572129 10:123553745-123553767 AAGTGGGTGGGTAAGTTCACAGG - Intergenic
1078073519 11:8135810-8135832 GTCTGGGTGGAGAACTACCCAGG - Intronic
1089337416 11:117734702-117734724 ATATGGCTGGGGAACAAAACAGG - Intronic
1091976521 12:4830335-4830357 ATGGGGGTGTGGAACTTTACTGG - Intronic
1093436797 12:19144544-19144566 ATGTGGGAGGAGAGCTACATAGG + Intronic
1095898868 12:47306930-47306952 ATGTGGGTGGGGCCATACAAGGG + Intergenic
1095933917 12:47656586-47656608 ATGTAGGTGGGAAAATCCACAGG - Intergenic
1099106394 12:78501982-78502004 ATGTGTGTGTGGAAATACAGAGG - Intergenic
1101760280 12:107652605-107652627 TCGGGGGTGGGGGACTACACTGG - Intronic
1103211220 12:119167946-119167968 ATCAGGGTGGGGATCTACATAGG - Intergenic
1104104314 12:125644723-125644745 ATGGTGGTGGGGAACAACTCAGG - Intronic
1104532939 12:129589558-129589580 ATATGTGTGGGGGTCTACACGGG - Intronic
1105639059 13:22243903-22243925 ATGTGAGTGGAGAACTAGAGTGG + Intergenic
1107125259 13:36839503-36839525 ATGTGGGTGGCCATCAACACTGG + Intergenic
1115962084 14:38846276-38846298 ATGTGGATGGGGAACTGAGCTGG - Intergenic
1117206542 14:53449628-53449650 ATGTGGGTGAGGGACTGCTCCGG + Intergenic
1118402607 14:65393714-65393736 ATGTGGGAGGGGGACTAGTCAGG + Intergenic
1120945720 14:89994859-89994881 ATGGAGGTGGGAAAATACACAGG + Intronic
1121586573 14:95067113-95067135 GTGAGGGTGGGGATCTACAATGG - Intergenic
1122239053 14:100349756-100349778 ATGTGCAGGGGGAACTGCACTGG + Intronic
1122802882 14:104240497-104240519 ATGAGGCTGGGGAACTCTACCGG - Intergenic
1124368974 15:29092590-29092612 ATGGGTGTGAGGAGCTACACGGG + Intronic
1126062718 15:44799388-44799410 ATGTAGGTTGGGAACTAGGCTGG + Intergenic
1126387960 15:48113267-48113289 AGGAGGGTGGGGAACTACTGGGG - Intergenic
1128408516 15:67368771-67368793 ATGTGGGTGTGGCATTAAACTGG - Intronic
1131383399 15:91982799-91982821 TGGTGGGTGGGGAGCTGCACGGG + Intronic
1132576936 16:668533-668555 ATGTGGGTGGGCACCTTCTCCGG - Exonic
1132718359 16:1303528-1303550 ATGTGGGTGGGGCACTGCTCAGG + Intergenic
1132796800 16:1728498-1728520 ATGGGGGTGGGGAAACCCACAGG - Intronic
1135480647 16:22818133-22818155 ATGTGGGTGGGGGAGAACCCAGG - Intronic
1138161126 16:54755909-54755931 ATGTGTGTGGGATACTAGACAGG - Intergenic
1139806029 16:69566100-69566122 AGGTGGAGGGGGAACTCCACGGG - Exonic
1141954497 16:87361377-87361399 ATGTGGCAGGGGCACAACACAGG + Intronic
1145389572 17:22445128-22445150 AGGTGGGAGGGGAACCACAGGGG - Intergenic
1146375130 17:32288728-32288750 AAGTGGGTGGGGAGCTCCGCTGG + Intronic
1147352853 17:39865439-39865461 AAGTGGGTGAAAAACTACACTGG + Intergenic
1155259337 18:24026099-24026121 ATGTGGATGGAGAACTACTGAGG + Intronic
1162172768 19:8804473-8804495 GTGTGTGTGGGGTGCTACACAGG + Intergenic
1163125664 19:15243046-15243068 ATGTGGGTGGAAAACTGCATGGG + Exonic
1165004474 19:32793565-32793587 ATGTGGGTGGAGAACTCTATTGG + Intronic
925561757 2:5203683-5203705 AAGAGGGTGGGGAAATACAGGGG - Intergenic
926003936 2:9356964-9356986 GTGGGGGTCGGGGACTACACAGG + Intronic
927204940 2:20602055-20602077 ATGTGGGTTTGGAAATACAAAGG + Intronic
927236873 2:20882647-20882669 CTGTGGGTGGCAAACCACACAGG + Intergenic
927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG + Exonic
928081868 2:28319157-28319179 ATGGGCATGGGGAACTTCACTGG - Intronic
929016556 2:37503228-37503250 ATGTGGGTGGGTAAAGAGACAGG + Intergenic
929993509 2:46810294-46810316 TTGCTGGTGGGGAACTTCACAGG + Intergenic
931470597 2:62534951-62534973 ATGGGAGTGAGGAACTTCACAGG - Intergenic
931934801 2:67185434-67185456 ATGTGGGTGGGGAACTGGGAAGG - Intergenic
932068864 2:68595797-68595819 GGGTGGGTGGGGAACGACACAGG - Intronic
935981766 2:108635040-108635062 ATGAGGATGGGGGTCTACACTGG + Intronic
938403159 2:131010995-131011017 GTGTGTGTTGGAAACTACACAGG + Intronic
938654111 2:133413110-133413132 ATGTGGGTGGGGAGGCACAGTGG + Intronic
939557873 2:143698688-143698710 ATATGGGTGGAGAACTAAAATGG + Intronic
941372548 2:164684019-164684041 CTGTTGGTGGGAAAATACACTGG - Intronic
943663595 2:190585541-190585563 ATGGGGGTGGGGGACTAGACTGG - Intergenic
1171940303 20:31322646-31322668 ATGTGGGAGGGGACATACAGGGG - Intergenic
1172486663 20:35302451-35302473 CTGTGGCTGGGGAGCTACCCTGG + Intergenic
1173598194 20:44273638-44273660 ATGTGGCTGGAGAAACACACAGG + Intronic
1173649895 20:44656495-44656517 ATGTGGGTGCGAAACAAGACAGG + Intergenic
1177327414 21:19609537-19609559 GTGGGGGTGGGGATCAACACTGG + Intergenic
1177497378 21:21907416-21907438 ATGTGGGTGGGGAAAGACTTGGG + Intergenic
1178408952 21:32348074-32348096 ATGTGGGTGGGGCACCAGCCAGG - Intronic
1180197910 21:46208474-46208496 CTGTGGGTGGTGAGCTAAACAGG - Intronic
1181639039 22:24187312-24187334 GTGTGGGTGAGGAACTTCTCAGG - Exonic
1182535961 22:31003080-31003102 ATGTGAGTGGGGCACTTCAAGGG + Intergenic
951238627 3:20264738-20264760 ATGTGGGTGGGGCAGGACATAGG - Intergenic
953737928 3:45512198-45512220 ATGTTTGTGGGGAACATCACTGG + Intronic
955026196 3:55169941-55169963 CTGTGGCTGGGGAAATACTCTGG + Intergenic
963882545 3:150545594-150545616 AGGTGGGTTGAGAACTACGCAGG + Intronic
964084572 3:152800477-152800499 GTGTGGGTGTGGATTTACACTGG - Intergenic
968816315 4:2823594-2823616 ATGTGGGTGGGGGAGTGCACTGG + Intronic
969448209 4:7257376-7257398 GTGGGGGTGGGGAACTCCCCGGG + Intronic
972824180 4:42737196-42737218 ATGAGGGTGGGGAGCAACATGGG - Intergenic
976369085 4:84266427-84266449 ATGGTTGTGGGGAACAACACAGG + Intergenic
977632072 4:99254062-99254084 AGGTGGGTGGGGAAAGTCACAGG + Intergenic
981749582 4:148081285-148081307 TTCTGGGTGTGGAACAACACAGG + Exonic
983840736 4:172454801-172454823 ATGGGGCTGGAGAGCTACACTGG - Intronic
985923567 5:2998474-2998496 ATGAGGGCGGGGAACATCACAGG - Intergenic
993509640 5:88755553-88755575 ATGTGGGTGAGTATCTACACTGG + Intronic
993964529 5:94345169-94345191 GTGAGGGTGGGGAACTTCAAGGG + Intronic
997287582 5:132692496-132692518 TTCTGGGTGTGAAACTACACAGG + Intergenic
999394028 5:151215130-151215152 ATGGGGGTGGGGAAAGAGACAGG + Intronic
1000888078 5:166770939-166770961 ATCTGGATGGGGAACTAAAAAGG - Intergenic
1003307816 6:4945443-4945465 ATGGGTGAGGGGAACTACCCTGG - Intronic
1006289825 6:33126158-33126180 ATTTGGGTGGGCATCCACACTGG - Intergenic
1009907685 6:69889807-69889829 ATGTGGGTGGGGAAAAATAAGGG + Intronic
1015244267 6:131060285-131060307 CTGTGGCTGGTGAACTACAAAGG - Intronic
1015464293 6:133531162-133531184 ATGTGTGTGAGAAACTGCACGGG - Exonic
1019507376 7:1399101-1399123 ATCTGGGTGGTGACCAACACTGG - Intergenic
1021848274 7:24783720-24783742 CTGAGGGAGGGGAACTTCACAGG + Intergenic
1022951691 7:35345031-35345053 ATGGGGATGGGGATATACACGGG + Intergenic
1023042788 7:36186723-36186745 ACGTGGGTGGAGGAGTACACAGG + Intronic
1023820999 7:43980460-43980482 ATGTGGGTAGGGGGCTACCCAGG + Intergenic
1028689166 7:93631881-93631903 AAGTGTGTGGGGAGCTAGACTGG - Intronic
1029243291 7:99179967-99179989 ATGTGGGTGGGGAACTACACAGG - Intronic
1029416527 7:100446570-100446592 ATCTGTGTGGGGAACTAGATGGG + Intergenic
1029749272 7:102533899-102533921 ATGTGGGTAGGGGGCTACCCAGG + Intergenic
1029767215 7:102633003-102633025 ATGTGGGTAGGGGGCTACCCAGG + Intronic
1029981580 7:104884405-104884427 AGGTGGCTGGTGAACCACACTGG - Intronic
1037253069 8:16919789-16919811 ATGTGGCTGGAGAAAGACACTGG - Intergenic
1038185719 8:25273022-25273044 ATCTCTGTGGGGAACTAAACTGG - Intronic
1041713379 8:60912770-60912792 ATGGGGGTGGGGAGCAACACTGG + Intergenic
1045356194 8:101391141-101391163 ATGTGTATGAGGAACTTCACTGG + Intergenic
1049791761 8:144475527-144475549 AAGTGGGTGGGGAACGAGTCTGG + Intronic
1051834319 9:21318033-21318055 ATGTAGGTGTAGAACTACAAGGG - Intergenic
1056548234 9:87630548-87630570 GTGTGGGTGGGGGATTACATCGG + Intronic
1195887822 X:109658598-109658620 ATGTGTGCAGGGAACTACAAGGG - Intronic
1196943139 X:120797521-120797543 ATGTGGGTGGGAAGGTACACGGG - Intergenic
1199928850 X:152497336-152497358 ATGGAGGTGGGGAACTAGAGTGG - Intergenic