ID: 1029245494

View in Genome Browser
Species Human (GRCh38)
Location 7:99196667-99196689
Sequence CAGGGTTACCATGGAGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029245494 Original CRISPR CAGGGTTACCATGGAGCTGA GGG (reversed) Intronic
901060710 1:6470726-6470748 CAGGGTTACCATGGCGACGACGG + Exonic
902208490 1:14887453-14887475 TAGGGGTACCACTGAGCTGATGG + Intronic
905281661 1:36853265-36853287 CAGGGCTGTCATGGAGCAGAAGG - Intronic
905842689 1:41197518-41197540 AAGGGTTACCAGGGAACTGGTGG + Intronic
907261293 1:53220563-53220585 GAGGGCTACCATGGGGGTGAGGG - Exonic
908150070 1:61291197-61291219 AAGGGGTACAATGGAGATGACGG - Intronic
908671829 1:66556530-66556552 CAGGCTTGCAATGGAGCTGGAGG + Intronic
908909779 1:69059851-69059873 AATGGTTCCCATGGAGCTCAAGG - Intergenic
910310362 1:85816840-85816862 CAAGGATACCATGGAGCAGATGG - Exonic
911340081 1:96625224-96625246 TATGGTTACCATGGAGCCCATGG + Intergenic
917401820 1:174658074-174658096 CAAGGTTATCATGGAGCTGGAGG + Intronic
917414756 1:174797424-174797446 CAAGGTAAAAATGGAGCTGAGGG + Intronic
918407084 1:184222211-184222233 CAGGGCGACCATGGAACTGTTGG + Intergenic
922288434 1:224189888-224189910 CATCGGTACCTTGGAGCTGATGG + Exonic
922572409 1:226641945-226641967 CAGGGTGGCCGTGGAGCTGATGG + Exonic
924593272 1:245423273-245423295 CAGGGTTACTGTGAAGATGAAGG - Intronic
1064605723 10:17036593-17036615 CAGGGCTGCCAGGGGGCTGAAGG + Intronic
1065530119 10:26661104-26661126 CAGGGTTCCCTAGGAGCTGTAGG + Intergenic
1067469921 10:46528629-46528651 CAGGGTCACCCTGCAGCTGCAGG - Intergenic
1067717274 10:48699193-48699215 CAGGGTGACCATGGAGAAGAGGG + Intronic
1068957177 10:62828517-62828539 CAGGGTGACCAAGGAACAGAGGG - Intronic
1069333257 10:67318579-67318601 CAGAGTGAACATGGAGATGAAGG - Intronic
1070641937 10:78176686-78176708 CAGGTCTGCAATGGAGCTGATGG - Intergenic
1072093337 10:92151266-92151288 CAGAGGTACCCTGGAGCTGCTGG - Intronic
1073443763 10:103568725-103568747 CAGGATTACCAAGGAGCACAAGG - Intronic
1076811731 10:132889738-132889760 CGGAGGCACCATGGAGCTGACGG - Intronic
1078000822 11:7494033-7494055 CAGGGTTGCCATGTAGATGGGGG + Intronic
1079201855 11:18383479-18383501 CATGGTTACCATGGAGATGCTGG + Intergenic
1080051893 11:27866507-27866529 CAGGGTTTCTGTGGAGCTCATGG + Intergenic
1080319680 11:30992284-30992306 AATGGTGACCATGTAGCTGAGGG + Intronic
1082916010 11:58438213-58438235 CAAGGTTACCACAGAGCTGATGG - Intergenic
1083655059 11:64225602-64225624 CAGGGTCACCATGGAGACTAGGG - Intronic
1085250013 11:75136914-75136936 CTGTGCTACCATAGAGCTGAAGG + Intronic
1087910671 11:103750086-103750108 CAGGTTCACCATAAAGCTGATGG - Intergenic
1092441752 12:8510723-8510745 CAGGATTGCCATGGAGCCAAGGG - Intronic
1095983904 12:47987294-47987316 CAGGGTAACCCTGGAACAGATGG - Exonic
1096193785 12:49635980-49636002 CAGGCTTACTCTGCAGCTGATGG - Exonic
1096551892 12:52378424-52378446 CAGGGGTAGCATGGAGGTGGAGG - Intronic
1099967013 12:89458483-89458505 GAGGGTAACCAATGAGCTGATGG - Intronic
1100006559 12:89901761-89901783 CAGTGTTGGTATGGAGCTGATGG + Intergenic
1101819173 12:108169961-108169983 CAGGGTGGCCAAGAAGCTGAAGG + Intronic
1102401506 12:112633545-112633567 CTGGGCTACCTTGGAACTGATGG + Intronic
1106351462 13:28934937-28934959 CAGGGGTACCAGGGAGCTGCTGG - Intronic
1106618751 13:31354162-31354184 CAGGGTTCCCATGGGGGTTATGG + Intergenic
1107665400 13:42683920-42683942 CAGTGTGATCATGGAGCTGAAGG + Intergenic
1108182773 13:47857304-47857326 CAGGGATACCATGGAGAAGTTGG + Intergenic
1115627227 14:35205868-35205890 CAGGGGTAGCATGGAGATTAGGG - Intronic
1119800668 14:77442210-77442232 CAGGGTTATTATGAAGATGAAGG - Intronic
1119897423 14:78232006-78232028 AAGGGTTACAATGGGGGTGAAGG - Intergenic
1123948855 15:25251880-25251902 CAGGGCAACCAAGCAGCTGATGG - Intergenic
1124258479 15:28165162-28165184 CTGGGTCAACATGGAGGTGAGGG + Intronic
1125166701 15:36714668-36714690 CAGGTGTAGGATGGAGCTGAGGG - Intronic
1125204584 15:37138807-37138829 CAGGTTCACCATGAAGCTAATGG + Intergenic
1129689625 15:77705848-77705870 CACGGTCACAATGGAGGTGAGGG + Intronic
1129709623 15:77813934-77813956 CAGGGTTGCCTGGGAGGTGAAGG + Intronic
1129743695 15:78003186-78003208 GAGGGTTACCATGGTGCCCAAGG - Intronic
1129780582 15:78267870-78267892 CAGGATTACTATACAGCTGAGGG - Intronic
1130518623 15:84645374-84645396 CAGGTTTATCATGGTGCTGGAGG + Intronic
1134135312 16:11673320-11673342 CAGGGCCACCGTGGAGCTCATGG + Intronic
1135922931 16:26667517-26667539 CAGGGTTCCCACAGAGCAGAAGG + Intergenic
1136995408 16:35185600-35185622 CAGGAACACCATGGAACTGATGG + Intergenic
1138561047 16:57801393-57801415 CAGGGGCACCAGGGAGCAGAGGG - Intronic
1139561360 16:67744416-67744438 TATGGTTACCATGGTGATGATGG - Exonic
1140422024 16:74827421-74827443 CAAGGTTACCATGGAGTTGGAGG - Intergenic
1143107413 17:4536585-4536607 CAGGGTCAGCCTGGAGCTGTGGG + Intronic
1143166518 17:4899773-4899795 CAGGGTGTCCAGGGAGCTGGGGG - Exonic
1143167185 17:4902639-4902661 CAGGGTGACCTTGAGGCTGATGG + Exonic
1144348124 17:14368296-14368318 CAGGGTTTACATGGGGCTAAGGG + Intergenic
1146414884 17:32622531-32622553 GAGGGATAAGATGGAGCTGAGGG + Intronic
1146640796 17:34539844-34539866 CAGGGTTAAGTTGGAGCTGGAGG - Intergenic
1146737471 17:35251195-35251217 CATGGTTTCCATGAAGTTGAAGG - Intronic
1147868020 17:43566581-43566603 CAGGTTTACCAGGGAGTTCACGG + Intronic
1148245068 17:46025076-46025098 CAGGGTTTCTGTGGAGCAGAGGG - Exonic
1148581212 17:48745249-48745271 CAGGGTCTGCAGGGAGCTGAGGG - Intergenic
1148795650 17:50195459-50195481 CAGGGAAACCCTGGTGCTGATGG - Exonic
1150274105 17:63884823-63884845 CATGGTAACCATGGACCAGAGGG + Intergenic
1150527859 17:65942308-65942330 CAGCTTTTCCATGGACCTGAAGG - Intronic
1151728946 17:75899730-75899752 TAGGGTGTGCATGGAGCTGAGGG - Intronic
1152446227 17:80345970-80345992 CAGGGTTAGTATGGAGGAGACGG + Exonic
1152537170 17:80957516-80957538 CAGGGGTACCTTGTAGCTGCTGG + Intronic
1152828695 17:82483965-82483987 CAGGGCTGCCAGGGAGTTGAAGG + Intronic
1158306336 18:56110097-56110119 CAGGGTTCTCATGGAGCTTGGGG + Intergenic
1159517276 18:69473688-69473710 CAGTGTTACAATGTTGCTGAGGG + Intronic
1159703935 18:71663532-71663554 CAGTGTGGCCATGGAGGTGATGG + Intergenic
1160136284 18:76274340-76274362 CAGGGCAACCAGGGGGCTGAGGG + Intergenic
1160546811 18:79663075-79663097 GTTGGTTACCATGGAGCTGTCGG - Intergenic
1162321607 19:9973953-9973975 CAGGGTCCCCATGGAGCTCCAGG - Exonic
1162894914 19:13759395-13759417 CATGGTCACCATGTAGCAGATGG - Intronic
1163790777 19:19305034-19305056 CAGGGTACCCTTGGAGCTGCTGG + Intronic
1164414819 19:28038240-28038262 AAAGGTTACCATGGACCTCAAGG - Intergenic
928181903 2:29073885-29073907 CAGGGTTCCCATGGATCACAAGG - Exonic
931925007 2:67062855-67062877 CAGGGTCACCATGGAGCAGCTGG + Intergenic
932888018 2:75564465-75564487 CAGGGCTCCCATGGCGCTGGTGG + Intronic
933502572 2:83133776-83133798 CAGAGTGACCATGGTGATGATGG + Intergenic
933691483 2:85182366-85182388 CTGGGGTGCCAGGGAGCTGAGGG + Intronic
934522321 2:95026996-95027018 CAGGGCTACCATTGAACTTAGGG + Intronic
934951410 2:98578258-98578280 CAGTGTGACCCTGGTGCTGAGGG + Intronic
937107697 2:119333709-119333731 CAGGATTACCATGTAGGTCAGGG - Intronic
937250504 2:120520767-120520789 CATGGTTGCCATGGAGGTGGTGG + Intergenic
938314406 2:130316021-130316043 CAGGGTGTGCTTGGAGCTGAGGG + Intergenic
940322819 2:152395234-152395256 CTGGGTTGCCATGGTGCTGTGGG + Intronic
943717906 2:191172656-191172678 TGAGGTTACCATGGAGCTGTGGG + Intergenic
945127280 2:206526548-206526570 CAGGGTTGCCATGGAAGAGAGGG + Intronic
948403740 2:237702512-237702534 CGGGGTTAGGATGGAGCAGAGGG - Intronic
948867524 2:240783311-240783333 CAGGGTTTGCATGGGGCTGAGGG - Intronic
949042258 2:241854761-241854783 CAGGGCTGCCATGCAGCTGTCGG + Intronic
1169234945 20:3923241-3923263 CAGGGTTATTTTGGAGCTGTTGG + Exonic
1170547727 20:17449311-17449333 GAGGGTGGCCCTGGAGCTGAAGG - Intronic
1170644253 20:18182656-18182678 CAGGGTGATCATGGAGCTGCAGG - Intronic
1174846443 20:53947934-53947956 CAGGGTTAGCATGAAGATGAAGG - Intronic
1177130100 21:17245321-17245343 CAGGGTTATCAAAGATCTGATGG - Intergenic
1177690914 21:24506161-24506183 CAGAAATACCATGGAACTGAAGG - Intergenic
1180159301 21:45992007-45992029 CAGGGCGAGCCTGGAGCTGACGG + Exonic
1181181346 22:21070644-21070666 CCAGGTTACCATGGAGCAGTGGG - Intergenic
1181746990 22:24962386-24962408 GAGGATTGGCATGGAGCTGAGGG + Intronic
1183478929 22:38052380-38052402 CAGGGCTGCCGTGGAGCTCAGGG - Intergenic
1183861464 22:40673413-40673435 CAGGGTTCCCCAGCAGCTGAGGG + Intergenic
953584788 3:44189778-44189800 TAAGGTTACCATGGGGATGAGGG + Intergenic
954136675 3:48585097-48585119 CAGGGCTTCCCTGGAGCAGATGG - Exonic
954220940 3:49153569-49153591 AGAGGTCACCATGGAGCTGAAGG + Intergenic
954700472 3:52448112-52448134 GAGGGTTTCCGTGGAGCAGAGGG - Intergenic
955457394 3:59139019-59139041 AAGGGGTACCAAGGATCTGAAGG - Intergenic
959111198 3:102124509-102124531 CAGGGTTCCTAGGGAGGTGAGGG - Intronic
959410003 3:106009394-106009416 CATGGTTGCCATGGTGTTGAGGG - Intergenic
960377486 3:116921444-116921466 CAAGGTTACCAAGAAGCAGATGG + Intronic
960698259 3:120416458-120416480 CAGGATCACCAGGGAGCTGGAGG + Intronic
961324971 3:126104481-126104503 TAGGGTTAGGAGGGAGCTGAGGG + Intronic
962886384 3:139631818-139631840 CAGAGTTAGCATGGTGGTGAGGG - Intronic
964441617 3:156717256-156717278 CAGGATAACCAAGGACCTGAGGG + Intergenic
966242087 3:177766031-177766053 CAGGGATGCCATGGAGTTGAAGG + Intergenic
966927596 3:184655587-184655609 CAGGGTTGCCATGGAGCACTAGG + Intronic
967499244 3:190177677-190177699 CAGATTTACCATGGAGCTGATGG + Intergenic
968799691 4:2733787-2733809 CAGGGTTGCCATGGAGGTGATGG - Intergenic
976119907 4:81768577-81768599 CTGGTTTCTCATGGAGCTGAAGG - Intronic
978496021 4:109359885-109359907 CAGTGTTAACAACGAGCTGATGG - Intergenic
987970313 5:24934674-24934696 CATGGGTAGCATGCAGCTGAGGG + Intergenic
995753806 5:115480352-115480374 CAGGGTTACCAAGGTACTGCTGG - Intergenic
998006480 5:138660553-138660575 CAGGGTTAGCAAGGAGTTAAAGG - Intronic
999649481 5:153751184-153751206 CAGGGTTCAGATGAAGCTGAAGG - Intronic
1000854710 5:166383794-166383816 AAGGGGTTCCATGGGGCTGAAGG + Intergenic
1001068204 5:168557602-168557624 CAGGGTTACTTTGGAGCAGTTGG - Exonic
1001319413 5:170668168-170668190 GAGGTTAAGCATGGAGCTGATGG + Intronic
1004211980 6:13657237-13657259 TATGGTTACCATGGGGATGATGG - Exonic
1004484055 6:16048942-16048964 CCGGGTTGCTATGGAACTGATGG + Intergenic
1007582204 6:42966303-42966325 CAGGGGGCCCATGGAGCAGAAGG + Exonic
1007991658 6:46262331-46262353 CAGGGTGAACAGGGGGCTGATGG - Intronic
1012235511 6:96809617-96809639 CTGGGTTACTATGGATTTGAAGG - Intronic
1014609506 6:123523541-123523563 CTGGATTAGCATGGACCTGAGGG + Intronic
1015392487 6:132698587-132698609 CAGGGTCAGCTTGGAGCTGAAGG - Intronic
1016550725 6:145276900-145276922 CAGGGTTCTCATGGACCAGAGGG - Intergenic
1016818515 6:148325753-148325775 CAGGGTTTCCTTGCAACTGAGGG - Intronic
1018180325 6:161217506-161217528 CTGGATTACCATGCACCTGATGG - Intronic
1020146915 7:5651572-5651594 TAGCCTTACCATGCAGCTGAGGG - Intronic
1023704947 7:42931876-42931898 CGGGGTTAACATGGGGCTGCGGG - Intronic
1029245494 7:99196667-99196689 CAGGGTTACCATGGAGCTGAGGG - Intronic
1029932374 7:104386088-104386110 CAAGGCTACCACGGAGCTGGGGG - Intronic
1033445538 7:141418552-141418574 AAGGGTCACCATGGAAGTGAAGG - Intronic
1033884277 7:145926595-145926617 AAGGGTAAACGTGGAGCTGAAGG - Intergenic
1034140029 7:148806777-148806799 CAGGGTTCCCATGATGCTGCTGG + Intergenic
1034502876 7:151462325-151462347 CAAGGCTACCAGGGAGCTCAGGG - Intergenic
1035136084 7:156704053-156704075 CTGGGTTACAAGGGGGCTGAGGG + Intronic
1035449226 7:158964943-158964965 CAGGGTGACCCAGGAGCTGGAGG - Intergenic
1037813891 8:22102025-22102047 CATGGATTCCATGGGGCTGAGGG - Intronic
1037995719 8:23351013-23351035 CTGTGTTACCATGGTGATGATGG - Intronic
1041076282 8:54173041-54173063 AAGGATGACCATGGGGCTGACGG - Intergenic
1041454844 8:58047489-58047511 CAGGGATGCCATTGAGGTGATGG - Intronic
1042063780 8:64850462-64850484 CAGGGGTATCATGGAGATTAAGG + Intergenic
1048961232 8:139580147-139580169 CAAGGTTACCACGAAGCTGAGGG + Intergenic
1049341198 8:142113543-142113565 CAGGGCTGCCCTGGGGCTGAAGG - Intergenic
1053139136 9:35671483-35671505 CAGGGGTACCCTGGAGCTAGGGG + Intronic
1057806486 9:98223333-98223355 AAGAGCTACCATGGAGCTGTGGG + Intronic
1060985759 9:127818147-127818169 CAGGGCTACCGTGCAGCTGAGGG + Exonic
1062044842 9:134420205-134420227 CAGGGATACCCTGCAGCCGATGG + Intronic
1062074100 9:134575125-134575147 CAGGGAAACCATGGAGGTGCTGG + Intergenic
1062361702 9:136191358-136191380 CAGGGTTACCATGGGGCTTGAGG - Intergenic
1189415483 X:40809140-40809162 GAAGGTTAGTATGGAGCTGAAGG + Intergenic
1196297222 X:114012052-114012074 CAAGGCTACCATGGAGCTTGGGG + Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200216121 X:154368953-154368975 CAGGGTTGCCATGGTGATGGGGG - Intronic
1200707078 Y:6452224-6452246 CAGGGATATCATGGAGCACAAGG - Intergenic
1201027034 Y:9712484-9712506 CAGGGATATCATGGAGCACAAGG + Intergenic