ID: 1029252567

View in Genome Browser
Species Human (GRCh38)
Location 7:99247571-99247593
Sequence CTGGTGGGAGGGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029252567_1029252578 5 Left 1029252567 7:99247571-99247593 CCATCTTCCCTCCCTCCCACCAG No data
Right 1029252578 7:99247599-99247621 CTCGGGCTTGTTCTGCGTGACGG 0: 1
1: 0
2: 0
3: 3
4: 61
1029252567_1029252579 22 Left 1029252567 7:99247571-99247593 CCATCTTCCCTCCCTCCCACCAG No data
Right 1029252579 7:99247616-99247638 TGACGGTCAACCCCTACAAGTGG 0: 1
1: 0
2: 7
3: 3
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029252567 Original CRISPR CTGGTGGGAGGGAGGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr