ID: 1029253347

View in Genome Browser
Species Human (GRCh38)
Location 7:99252342-99252364
Sequence CCCGCCAGCCCTGTTTTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029253347_1029253355 -10 Left 1029253347 7:99252342-99252364 CCTGGGAAAACAGGGCTGGCGGG No data
Right 1029253355 7:99252355-99252377 GGCTGGCGGGGGGTGAGGGGAGG No data
1029253347_1029253357 12 Left 1029253347 7:99252342-99252364 CCTGGGAAAACAGGGCTGGCGGG No data
Right 1029253357 7:99252377-99252399 GAGCAGAGGTGAGTACAGACAGG No data
1029253347_1029253359 29 Left 1029253347 7:99252342-99252364 CCTGGGAAAACAGGGCTGGCGGG No data
Right 1029253359 7:99252394-99252416 GACAGGCCCAGGAGCAGCCGAGG No data
1029253347_1029253358 18 Left 1029253347 7:99252342-99252364 CCTGGGAAAACAGGGCTGGCGGG No data
Right 1029253358 7:99252383-99252405 AGGTGAGTACAGACAGGCCCAGG No data
1029253347_1029253356 -2 Left 1029253347 7:99252342-99252364 CCTGGGAAAACAGGGCTGGCGGG No data
Right 1029253356 7:99252363-99252385 GGGGGTGAGGGGAGGAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029253347 Original CRISPR CCCGCCAGCCCTGTTTTCCC AGG (reversed) Intergenic
No off target data available for this crispr