ID: 1029256161

View in Genome Browser
Species Human (GRCh38)
Location 7:99271046-99271068
Sequence TCGGGGCTTCCTCATGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029256154_1029256161 8 Left 1029256154 7:99271015-99271037 CCAAGATCATGACGATGCTGCAG 0: 1
1: 0
2: 0
3: 15
4: 254
Right 1029256161 7:99271046-99271068 TCGGGGCTTCCTCATGAGGGTGG 0: 1
1: 0
2: 1
3: 6
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029256161 Original CRISPR TCGGGGCTTCCTCATGAGGG TGG Intergenic
900366453 1:2313787-2313809 TGGGGGCATCTCCATGAGGGAGG - Intergenic
901312007 1:8276539-8276561 TCAGGCCTTCCTCATGGGGTGGG + Intergenic
901422464 1:9160391-9160413 CCGGGGTCTCCTCATGAGTGAGG - Intergenic
902576581 1:17381753-17381775 TCAGGGCCTCCTTTTGAGGGAGG - Intronic
906511726 1:46413865-46413887 TCTGGGCGTCATCGTGAGGGTGG + Intergenic
909340358 1:74524787-74524809 AAGGGGCTGCCTCATGAAGGGGG + Intronic
913714280 1:121518857-121518879 TTTGGGCTTTCTTATGAGGGAGG - Intergenic
916123457 1:161549489-161549511 TTGGGGCATACTCATGAGTGAGG - Intronic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
922902261 1:229146384-229146406 TCGGGGCTCCTTCAAGATGGTGG - Intergenic
1069486651 10:68827908-68827930 GCGCGGCTTCCGCATCAGGGCGG + Exonic
1069486738 10:68828244-68828266 GCGCGGCTTCCGCATCAGGGCGG + Intronic
1073075709 10:100824923-100824945 CCCCGGCTTGCTCATGAGGGAGG - Exonic
1076535985 10:131178053-131178075 CCGGGGCTTTCTCAGGAGTGGGG + Intronic
1078420325 11:11206545-11206567 TCAGGGCTTCCTAGGGAGGGAGG - Intergenic
1081675632 11:44967423-44967445 TCGTGGGTTCCTGGTGAGGGCGG - Intergenic
1090807257 11:130210225-130210247 CCTGGGCTTCCTCAAGAGCGTGG - Exonic
1094616398 12:32040112-32040134 GGCGGGCTTCCTCCTGAGGGAGG + Intergenic
1098859392 12:75690281-75690303 TTGGGGGTTCCTCATCAGGCAGG - Intergenic
1103077988 12:118000307-118000329 GCTGGACTTCCTCATGAGTGTGG + Intergenic
1108075418 13:46674358-46674380 TTGTGGCTTCCTCATGGGAGGGG - Intronic
1113459025 13:110468828-110468850 TCGTGGCGTCCTCATGAGGCAGG + Intronic
1122244019 14:100388620-100388642 TCGCGGCTTTCACATGGGGGAGG - Intronic
1122937785 14:104967892-104967914 GCGGGGCTTCCTCAGGAGCTCGG - Intronic
1125726384 15:41870341-41870363 TCGTGGCTTTCTCCTGAGGAAGG + Exonic
1130996640 15:88907868-88907890 CCCTGGCTTCCTCAGGAGGGTGG + Intronic
1132244202 15:100281541-100281563 TCGGGGCACCCACATGACGGTGG - Intronic
1132333350 15:101027487-101027509 TCGGTGGTTCCTGGTGAGGGAGG + Intronic
1137594777 16:49716301-49716323 TTGGTGCTGCCTCATGATGGGGG - Intronic
1138563553 16:57816355-57816377 TCCTGGCTTCCTCTTGAGGAAGG + Intronic
1142304559 16:89278263-89278285 ACAGGGATTCCTCATGGGGGAGG - Intronic
1142995019 17:3755069-3755091 GCGGGGCCACCTGATGAGGGCGG - Intronic
1142995026 17:3755088-3755110 GCGGGGCCACCTGATGAGGGCGG - Intronic
1145274122 17:21419975-21419997 CTGGGGCTTCCTCATGGGTGAGG + Intergenic
1145311984 17:21705874-21705896 CTGGGGCTTCCTCATGGGTGAGG + Intergenic
1146162836 17:30569312-30569334 CCTGGCCTCCCTCATGAGGGCGG - Intergenic
1146972776 17:37086142-37086164 GCTGGCCTTCCTGATGAGGGAGG - Exonic
1147034912 17:37672634-37672656 TCGTTCCTTCCTCCTGAGGGTGG - Intergenic
1150287404 17:63961947-63961969 GCGGGGCTTCCTCAGGAGTTGGG - Intronic
1151662447 17:75525866-75525888 TCGGGGCTTCCACCTGGGGCGGG + Intronic
1152550628 17:81028213-81028235 GAGGGGCTTCCTTCTGAGGGTGG - Intergenic
1152634961 17:81427125-81427147 CCGGGGCTTCCTCGGCAGGGAGG - Intronic
1158076954 18:53542039-53542061 GCAAGACTTCCTCATGAGGGTGG + Intergenic
1161170989 19:2812490-2812512 TGGAGGCTGCCTCAGGAGGGGGG - Intronic
1161569428 19:5022405-5022427 TCGTGGCTTCATCTTGAGGCTGG + Intronic
1162570181 19:11466924-11466946 TAGGGGCTTCGTCATGGGGAGGG + Intronic
1165105462 19:33467217-33467239 TAGGAGCCTCCTCTTGAGGGAGG + Intronic
1166672939 19:44722436-44722458 TCGGGGCTTCCCGAGGTGGGAGG - Intergenic
933810763 2:86031456-86031478 CCGGGGCTGCGTCAGGAGGGCGG + Exonic
934026499 2:88005761-88005783 TCTGGGCTTCCTTCTGAGGGAGG - Intergenic
947142638 2:227033604-227033626 TCTGGACTTCATCATCAGGGTGG + Intronic
947642823 2:231716452-231716474 TGGGAGCTGCTTCATGAGGGTGG + Intergenic
948407780 2:237735428-237735450 TCGGCGCTTCCTCCTGAGAATGG - Intronic
1168899020 20:1344109-1344131 TCAGGTCTTCCTCTTGAGGCAGG - Intronic
1170738138 20:19028167-19028189 TCACGACATCCTCATGAGGGAGG + Intergenic
1174343845 20:49915323-49915345 TCGGGGCTTCCCCAGGCGGAGGG - Intronic
1175332806 20:58176566-58176588 TCGGGGCTTCCCCAAGAGTTTGG - Intergenic
1175774723 20:61645915-61645937 TAGCGCCTTCCTCCTGAGGGTGG + Intronic
1176411659 21:6452437-6452459 TCGGGGCTTCATAATGAGCTGGG + Intergenic
1179687153 21:43060759-43060781 TCGGGGCTTCATAATGAGCTGGG + Intronic
1183952019 22:41357528-41357550 TGGGGGCTGCCTGATGAGGGCGG - Exonic
1184761380 22:46546751-46546773 TCAGGGGAACCTCATGAGGGAGG - Intergenic
1185132414 22:49046705-49046727 TCCGGGCTTCCTCCAGAGGGCGG + Intergenic
950219764 3:11185704-11185726 TCGGAGCTCCCCCAGGAGGGAGG - Intronic
954648260 3:52144402-52144424 TCAGGGCTTCCTATGGAGGGGGG + Intronic
960088431 3:113614764-113614786 TCAGGGATTTCTCATGAGAGAGG + Intronic
961380463 3:126493273-126493295 TGGGGGCTTCTTCATCACGGGGG - Intronic
966794215 3:183698217-183698239 TGGGGGCTTCCTCTTCAGCGGGG + Intronic
968161692 3:196432187-196432209 TCGCCTCTTCCTCAGGAGGGAGG + Intronic
969993723 4:11290711-11290733 TCTGGGCTTCCTAAGGAGTGAGG + Intergenic
970043182 4:11819967-11819989 CAGGGACTTCCTCAGGAGGGAGG + Intergenic
971440989 4:26685262-26685284 CTGGGGCTTCCTCTTGAGAGAGG - Intronic
980022846 4:127730239-127730261 CCTGGGCTTTCTGATGAGGGAGG - Intergenic
980958676 4:139453802-139453824 GCGCGGCTTCCTCCAGAGGGCGG + Exonic
986754898 5:10826443-10826465 TAGGGGGCTCCACATGAGGGTGG + Intergenic
987697824 5:21355052-21355074 TGGTGGCTTCCACATGAGGTTGG - Intergenic
988754412 5:34231642-34231664 TGGTGGCTTCCACATGAGGCTGG + Intergenic
991742621 5:69697335-69697357 TGGTGGCTTCCACATGAGGCTGG + Intergenic
991755073 5:69857869-69857891 TGGTGGCTTCCACATGAGGCTGG - Intergenic
991794194 5:70277073-70277095 TGGTGGCTTCCACATGAGGCTGG + Intergenic
991822011 5:70572648-70572670 TGGTGGCTTCCACATGAGGCTGG + Intergenic
991834400 5:70733017-70733039 TGGTGGCTTCCACATGAGGCTGG - Intergenic
991886572 5:71276615-71276637 TGGTGGCTTCCACATGAGGCTGG + Intergenic
997698493 5:135880000-135880022 GCGGGGCTTCCCCATGAGTGCGG + Intronic
1001874202 5:175185296-175185318 TCGAGGCTTCCTCCTGAGACTGG + Intergenic
1002428092 5:179187556-179187578 TGGGGGCCTCCCCATGAGAGGGG - Intronic
1002508717 5:179698862-179698884 TCGGGGCTTGCGCGGGAGGGCGG + Intronic
1005020318 6:21411680-21411702 ACGGGGCTTACTCATAAGGTGGG + Intergenic
1005553027 6:26943352-26943374 TGGTGGCTTCCACATGAGGCTGG + Intergenic
1010214736 6:73391573-73391595 ACGAGGCTTCCTCATGAAGCAGG - Intronic
1013421665 6:109972695-109972717 TCAGGGCTTCCCCATGTGGTAGG - Intergenic
1019427226 7:983440-983462 GCTGGGCTTCCCCAGGAGGGGGG - Intronic
1024626250 7:51210456-51210478 GCGGGGCTTCCACATGAAAGTGG + Intronic
1028464815 7:91139123-91139145 TCAGTGCTCCCTCAAGAGGGAGG + Intronic
1029256161 7:99271046-99271068 TCGGGGCTTCCTCATGAGGGTGG + Intergenic
1033283074 7:140019327-140019349 TCGGGGCTTCCACGTGTGCGGGG + Intronic
1033475336 7:141686889-141686911 ACGCAGCATCCTCATGAGGGAGG - Intronic
1035323855 7:158052485-158052507 TCAGGGCTTCCCCAGGAGGCTGG - Intronic
1036216453 8:6883714-6883736 TGGGGGCTTCCTCTTCAGGGAGG + Intergenic
1036775897 8:11613115-11613137 TCTGGCCTTCCTCATTAGCGGGG - Intergenic
1039723347 8:40188483-40188505 TGAGTGCTTCCTGATGAGGGAGG - Intergenic
1041438004 8:57863129-57863151 TCGCGGCTTCCACATGATGTTGG + Intergenic
1045931948 8:107637605-107637627 AAAGGGCTTCCACATGAGGGAGG - Intergenic
1053505587 9:38640864-38640886 TCTGGGCTTCCCCATCAGTGGGG - Intergenic
1054787451 9:69222547-69222569 TCAGAACTACCTCATGAGGGAGG + Intronic
1059356372 9:113702446-113702468 TCTGGGCTTCCTTATGAAGCAGG + Intergenic
1060033004 9:120231804-120231826 GCGTGGATTCCACATGAGGGGGG - Intergenic
1060416172 9:123432354-123432376 TCAGGTCTCCCTGATGAGGGTGG - Intronic
1062381605 9:136289604-136289626 GAGGGGCTGCCTCCTGAGGGTGG + Intronic
1187388899 X:18873045-18873067 TGGGGGCATCCGCAGGAGGGAGG + Intergenic
1199853887 X:151744225-151744247 TCGGGAGATCCTCATGAAGGAGG + Exonic
1200082015 X:153581927-153581949 TAGGGGCTTCCTCAGGAGGGTGG - Exonic