ID: 1029258241

View in Genome Browser
Species Human (GRCh38)
Location 7:99283947-99283969
Sequence GGTTGTCGATGGTCATCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 63}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029258241_1029258249 19 Left 1029258241 7:99283947-99283969 CCTGAAGATGACCATCGACAACC 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1029258249 7:99283989-99284011 CAAGCTGGATCTCGAGGAGGTGG 0: 1
1: 0
2: 1
3: 10
4: 140
1029258241_1029258246 13 Left 1029258241 7:99283947-99283969 CCTGAAGATGACCATCGACAACC 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1029258246 7:99283983-99284005 GCGTTCCAAGCTGGATCTCGAGG 0: 1
1: 0
2: 0
3: 2
4: 40
1029258241_1029258245 4 Left 1029258241 7:99283947-99283969 CCTGAAGATGACCATCGACAACC 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1029258245 7:99283974-99283996 TGAGATGGAGCGTTCCAAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 116
1029258241_1029258247 16 Left 1029258241 7:99283947-99283969 CCTGAAGATGACCATCGACAACC 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1029258247 7:99283986-99284008 TTCCAAGCTGGATCTCGAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029258241 Original CRISPR GGTTGTCGATGGTCATCTTC AGG (reversed) Intergenic
904896308 1:33820858-33820880 GGCTGTGGATGGTCCACTTCTGG - Intronic
910662657 1:89690094-89690116 GGTTAGTGATGGTCATTTTCAGG + Intronic
911198623 1:95021168-95021190 GGCTGTAAATGGTCATCATCAGG + Intronic
912247627 1:107977171-107977193 GGTTGTCTAAATTCATCTTCAGG + Intergenic
916004419 1:160646534-160646556 GGTTTTACATGGGCATCTTCTGG - Intronic
919423108 1:197395850-197395872 TTTTGTAGATGGTCATTTTCAGG - Intronic
1064030797 10:11881460-11881482 GGTCGTCGGTGGTCATGCTCAGG - Intergenic
1064994787 10:21287078-21287100 GGTTGTGGATTTTCAGCTTCTGG - Intergenic
1072464057 10:95646832-95646854 GGTTGTCCATGTTCTTCTTAAGG + Intronic
1079247410 11:18762817-18762839 GCTTGTCCATGATCATCTACTGG + Intronic
1082924071 11:58527511-58527533 AGTTGTCGAAGGGCATTTTCAGG - Exonic
1086774349 11:90811505-90811527 AGTTTTAGATGATCATCTTCTGG - Intergenic
1089399899 11:118158267-118158289 TGTTGTCCATGGTCATTTTAGGG + Intergenic
1104244900 12:127029609-127029631 GGTTGTCTATGGAACTCTTCAGG + Intergenic
1113073799 13:106448519-106448541 GGCTGTTGAGGGTCATTTTCTGG - Intergenic
1116770210 14:49118710-49118732 GGTTGTCTCTGTTCATCTTTGGG - Intergenic
1118620596 14:67610922-67610944 GGTTCTCGATGGTTTTTTTCAGG + Intergenic
1118636383 14:67752126-67752148 GGATGTTGAGGGTCACCTTCTGG + Intronic
1134048986 16:11123780-11123802 GCTTGTGGATGGTGATGTTCAGG - Exonic
1140752703 16:78040333-78040355 GCTTATAGATGGCCATCTTCTGG + Intronic
1143598972 17:7931814-7931836 GGTTGTGGACAGTCATCTGCAGG + Exonic
1144725615 17:17500579-17500601 GGTTGTCACTGATCATTTTCTGG + Intergenic
1147371019 17:39993144-39993166 GCTTGTCGATGGCCGTCTCCTGG + Intronic
1151758787 17:76089183-76089205 GGGAGTCGAAGGTCTTCTTCTGG + Exonic
1159651120 18:70980722-70980744 GTTTGCTGATGGTCACCTTCTGG + Intergenic
1162247325 19:9412722-9412744 GCTTGTAGATGGCCATCTTCTGG + Exonic
1162636411 19:11971231-11971253 GTTTGCAGATGGTCATCTTGTGG + Intronic
1168525903 19:57088609-57088631 AGGTGTCCATGGTCATCCTCGGG + Intergenic
926809466 2:16743599-16743621 GCTTATAGATGGTCATCTTTTGG - Intergenic
932825507 2:74935345-74935367 GCTTGTAGATGGCCACCTTCGGG - Intergenic
939963822 2:148591435-148591457 GGTTGAATGTGGTCATCTTCTGG + Intergenic
942419247 2:175791144-175791166 GCTTGCAGATGGTCACCTTCTGG + Intergenic
1169054661 20:2610754-2610776 GGTTAACAATGGTCATCTTTGGG - Intronic
1169753593 20:9020972-9020994 AGTTGTCAATGGTCTTCTACAGG + Intergenic
1170712690 20:18806665-18806687 GCTGGTAGATGGCCATCTTCTGG + Intergenic
1173340914 20:42152004-42152026 TGATGTCGATGGTCAGCTTGTGG + Intronic
1175057389 20:56210625-56210647 GCTTGTAGATGGCCACCTTCTGG - Intergenic
1178978837 21:37244092-37244114 GGTTGAAGATGGGCAGCTTCAGG - Intronic
1184767714 22:46580243-46580265 GCTTGGAGATGGTCATCTGCTGG + Intronic
950138954 3:10601982-10602004 GGTTGTCCAGGGTCACGTTCAGG - Intronic
954568822 3:51623463-51623485 GGATGTCAATGGTTATCTTGTGG - Intronic
954745820 3:52787068-52787090 GCTTGTCGATGGTGGGCTTCAGG - Exonic
954751147 3:52814341-52814363 TCTTGTCCATGGTCATCTTCAGG + Exonic
959338670 3:105099305-105099327 GTTTGCAGATGGTCACCTTCTGG - Intergenic
960571184 3:119186735-119186757 AGTTGTCTTTGGCCATCTTCGGG - Exonic
963583143 3:147152222-147152244 GGTTTTCGATGTTCACCTACAGG + Intergenic
969035129 4:4247312-4247334 GGTTTCCGATGGTCATCTAAAGG - Intronic
972958734 4:44425046-44425068 GCTTGCAGATGGTCATCTTCAGG - Intronic
974092548 4:57327270-57327292 GTGTGTTGATGGTCATCTACAGG + Intergenic
978318823 4:107470680-107470702 AGTTGTTGATAGTCATGTTCAGG - Intergenic
979044806 4:115850644-115850666 GCTTCTCGTTGGTCATCTTGGGG - Intergenic
981623916 4:146735321-146735343 TTTTGTCGATGGGCATCATCAGG + Intronic
986078028 5:4358063-4358085 GGGTGTCCATGATCATCTTGTGG - Intergenic
986206053 5:5626285-5626307 GTTTGCAGATGGCCATCTTCTGG - Intergenic
986688624 5:10295672-10295694 GTTTGCAGATGGTCATCTTCTGG - Intronic
992668701 5:79037059-79037081 GGTTGCAGATGGCCACCTTCTGG - Intronic
995918483 5:117280199-117280221 GCTTGTGGATGGCCATCTTCTGG - Intergenic
1002693003 5:181063912-181063934 GGTTGGCGAGGGTTCTCTTCTGG + Intergenic
1018315141 6:162549176-162549198 GGTTGAAGATGGCCGTCTTCTGG - Intronic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1028968213 7:96826982-96827004 GCTTGTCGAGGGCCGTCTTCTGG + Intergenic
1029258241 7:99283947-99283969 GGTTGTCGATGGTCATCTTCAGG - Intergenic
1037657471 8:20897691-20897713 GGTTGGCCAAGGTCATCCTCGGG + Intergenic
1040974779 8:53177903-53177925 GGTTGTCAATTGTCTTGTTCAGG - Intergenic
1059987456 9:119834614-119834636 GGTTGCAGACGGTTATCTTCTGG - Intergenic
1195223529 X:102769062-102769084 GGTTGTGCATAGTCATTTTCAGG + Intergenic
1198286860 X:135199722-135199744 GCTTGAAGATGGTCACCTTCTGG + Intergenic
1200900846 Y:8430377-8430399 GGTTGTCCAGGATCACCTTCTGG - Intergenic
1201320592 Y:12694085-12694107 GTTTGTCGCTTCTCATCTTCAGG - Intergenic