ID: 1029259783

View in Genome Browser
Species Human (GRCh38)
Location 7:99294006-99294028
Sequence CCTCATTTGCAGGAGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029259772_1029259783 15 Left 1029259772 7:99293968-99293990 CCTGTAAGTGCCTATGTTTCCTT No data
Right 1029259783 7:99294006-99294028 CCTCATTTGCAGGAGGAAGCTGG 0: 1
1: 0
2: 3
3: 28
4: 247
1029259775_1029259783 -4 Left 1029259775 7:99293987-99294009 CCTTGACAGCCCCTCTGGCCCTC No data
Right 1029259783 7:99294006-99294028 CCTCATTTGCAGGAGGAAGCTGG 0: 1
1: 0
2: 3
3: 28
4: 247
1029259773_1029259783 5 Left 1029259773 7:99293978-99294000 CCTATGTTTCCTTGACAGCCCCT No data
Right 1029259783 7:99294006-99294028 CCTCATTTGCAGGAGGAAGCTGG 0: 1
1: 0
2: 3
3: 28
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029259783 Original CRISPR CCTCATTTGCAGGAGGAAGC TGG Intergenic
902238427 1:15072889-15072911 CCTCATTAGTAGGATGAGGCCGG + Intronic
903576240 1:24341412-24341434 CCACATCTGCTGCAGGAAGCTGG - Intronic
904282316 1:29429267-29429289 CCTCATTAGTGGGAAGAAGCGGG - Intergenic
904400636 1:30254244-30254266 CCTCATTAGCTGGGGGCAGCTGG + Intergenic
904872482 1:33627485-33627507 CCCCATTCTCAGGACGAAGCAGG + Intronic
905565208 1:38958840-38958862 CCTCAGTGTCAGCAGGAAGCAGG + Intergenic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
907137493 1:52153598-52153620 CCTCATCCTCAGGAGGAAGTAGG - Intronic
907971314 1:59384315-59384337 CCACCTTTGCAAGAGGAACCTGG - Intronic
908355336 1:63322034-63322056 TCTAATTAGCAGGAGGGAGCCGG + Intergenic
910260974 1:85293627-85293649 CCTCACATGGAGGAGAAAGCAGG - Intergenic
910449548 1:87331610-87331632 CCTCATTTGCTGGAGGCGGGCGG + Intronic
910938244 1:92504770-92504792 CCTCAGTTACAGGAGAAAGCAGG - Intergenic
914690707 1:150023940-150023962 TAACATATGCAGGAGGAAGCTGG - Intergenic
914744375 1:150490799-150490821 CTCCATTTGGATGAGGAAGCTGG + Intronic
917030917 1:170690630-170690652 TCTCATATATAGGAGGAAGCAGG - Intronic
918209217 1:182336064-182336086 CCTCAGTGCCAGCAGGAAGCAGG - Intergenic
918247402 1:182671984-182672006 CCTCATTGGCAGGATGCAGAAGG + Intronic
922923263 1:229326882-229326904 CCTTATTTGCTAGAGGAAACAGG - Exonic
922966406 1:229694537-229694559 CTTAATTTGCAGCAGGAAGCGGG + Intergenic
923088632 1:230721240-230721262 CAACATTTGAAGGAGGAAGAAGG - Intergenic
923857344 1:237859253-237859275 CATCATTTGCTGGAGCAAGAAGG - Intergenic
924385581 1:243495867-243495889 CCTCATCTGCCAGAGCAAGCAGG + Intronic
1062973617 10:1666575-1666597 CCTCGGCTGCAGGAGGACGCTGG - Intronic
1063662833 10:8045730-8045752 CCTCGTTTGCAGGAAAGAGCTGG + Intergenic
1063906647 10:10786644-10786666 CCTTATTTGCAGGAGGTCACAGG + Intergenic
1063946397 10:11180399-11180421 CCTCATCTGCAGGATGAACAGGG + Intronic
1064261811 10:13792219-13792241 CCATCTTTGCAGGAGGATGCTGG + Intronic
1066566733 10:36729180-36729202 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1067189505 10:44057575-44057597 GCTAATTTGGAGGAGGCAGCGGG - Intergenic
1068351884 10:55858230-55858252 CCTGATTTGCAGGGGGGAGTGGG + Intergenic
1068579685 10:58725018-58725040 CCCCATTTGCAGCAGGAATCTGG + Intronic
1068890768 10:62146487-62146509 CCACATTTGCTGGGGGATGCTGG - Intergenic
1072311221 10:94157265-94157287 CAACATTTGCAAGAGGAAGAGGG - Intronic
1072346843 10:94515946-94515968 CCTCCTTGGCAGGAAGGAGCAGG + Intronic
1072885815 10:99272724-99272746 CCACACTTGCAGGAGTAAGGTGG - Intergenic
1073799116 10:107022084-107022106 CCTCATTTCCAGGATGGAGGAGG + Intronic
1074601366 10:114917164-114917186 CCTCATTTCCAGCAGGAGGAAGG + Intergenic
1075530110 10:123221936-123221958 CCTCATGTGGGAGAGGAAGCAGG + Intergenic
1077424094 11:2466362-2466384 CCTACTTTGCAGGAGGAGGGGGG + Intronic
1077781447 11:5334295-5334317 CCTCCTTTGGAGAAGGAAGTGGG + Intronic
1080259438 11:30330975-30330997 ACTCATTTGTAGTACGAAGCTGG - Exonic
1082872422 11:57955675-57955697 CCTCAGTGGAATGAGGAAGCAGG - Intergenic
1083387381 11:62321579-62321601 GTACATTGGCAGGAGGAAGCTGG + Intergenic
1087619530 11:100525927-100525949 CCTCTTTTGGTGGAGGTAGCAGG - Intergenic
1088672929 11:112161293-112161315 CCTCATTTGGACAAGGAAGTTGG + Intronic
1089164911 11:116468361-116468383 CCTCATTTCCTGGGGGAAGCTGG + Intergenic
1089893940 11:121908625-121908647 CCTCACTTGCCAAAGGAAGCAGG + Intergenic
1090106225 11:123855459-123855481 CTGCATCTGCAGGAGGCAGCTGG - Intergenic
1090973437 11:131662240-131662262 CCTAATTTAGAGGGGGAAGCTGG - Intronic
1091071672 11:132570433-132570455 CCTCATCTTCAGGAGCAGGCAGG + Intronic
1092765601 12:11850201-11850223 CCGAGTGTGCAGGAGGAAGCAGG - Intronic
1093703803 12:22253137-22253159 TCTAATTTGTAGGAGGAAGCGGG - Intronic
1096649126 12:53053318-53053340 CCTCAGCTTCAGGAGGAAGGTGG - Intronic
1097192715 12:57227072-57227094 CCTCGGCTGCAGGAGGGAGCCGG - Intergenic
1097434229 12:59540211-59540233 CCTAATTTCCAGGGGGAAACAGG + Intergenic
1098534300 12:71576992-71577014 CCTCCTTTCCTGGAGGAAACTGG - Intronic
1098999448 12:77160926-77160948 TCTCATTTGTAGAAGGAAGTGGG - Intergenic
1100138003 12:91578861-91578883 CCTCATCATCAGGAGAAAGCGGG - Intergenic
1100744349 12:97629108-97629130 CCTCATTTGCAAAAGGAGACTGG - Intergenic
1101136341 12:101747654-101747676 CTTCATCTGTAGGAGGAGGCAGG + Intronic
1101285946 12:103312579-103312601 CCTCAGTAGCCTGAGGAAGCTGG - Intronic
1101785038 12:107875111-107875133 CCTAATCTGCAGAAGGTAGCTGG + Intergenic
1101960465 12:109245727-109245749 CCTCATTTCCACCAGGAAGTCGG - Exonic
1102348785 12:112176787-112176809 CCTAAGTTGGAGGAGGGAGCAGG - Intronic
1102489420 12:113280505-113280527 CCTCATTTAGGTGAGGAAGCAGG + Intronic
1103922021 12:124404101-124404123 CCTCTTTTGGAGGTGGAAGCTGG + Intronic
1104337786 12:127916556-127916578 CCTTATTAGAAGGAGGAAGGAGG + Intergenic
1104360977 12:128132888-128132910 CCCAATTTGAAGGAGGAAGGAGG + Intergenic
1104857856 12:131910237-131910259 ACTCATCTGCAGGAGGAAGGAGG - Exonic
1106073086 13:26432226-26432248 TCTCATTTGCAACATGAAGCTGG + Intergenic
1106101330 13:26696834-26696856 GGCCCTTTGCAGGAGGAAGCTGG + Intergenic
1106171871 13:27295579-27295601 TTTCATTTTCAGGAGGAAACTGG + Intergenic
1107400177 13:40061896-40061918 CCTCCTTAGCAGGGGGAAGTGGG + Intergenic
1107545316 13:41428523-41428545 CCTCGTTTCCAGGGGGAAGAGGG + Intergenic
1108484151 13:50908088-50908110 GGTCCTTTGCAGGACGAAGCTGG - Intergenic
1109596685 13:64565239-64565261 CCTCTCTTGCAGGAGTAAGGTGG + Intergenic
1113753318 13:112791408-112791430 CCTCATCTGCAGGGAGAACCAGG - Intronic
1114004825 14:18301121-18301143 CCTGATTAGTAGGAGGAGGCAGG - Intergenic
1114545086 14:23493993-23494015 CTTCATTTGGATGAGGAAACTGG + Intronic
1115366493 14:32563324-32563346 TCTCCTTTGCAGGAGGAAACTGG - Intronic
1117017087 14:51528888-51528910 CCTTAGTGGCAGGAGGAAACTGG - Intronic
1118302865 14:64630761-64630783 CCACATTAGCAGGTGGAAGAGGG + Intergenic
1118319110 14:64742974-64742996 CCTCATAGGTAAGAGGAAGCCGG + Exonic
1119033016 14:71207164-71207186 CCTCTTTTGCACGAGGAGGTAGG - Intergenic
1123389282 15:19853355-19853377 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1124829949 15:33138589-33138611 CCTCACTTCCAGGAGGAGTCAGG - Intronic
1125720671 15:41843730-41843752 CTTCCTGAGCAGGAGGAAGCAGG + Exonic
1125758434 15:42081538-42081560 CTTCCTGAGCAGGAGGAAGCAGG - Exonic
1126189955 15:45868861-45868883 CCTCATATTCAGGGAGAAGCAGG + Intergenic
1129229932 15:74191431-74191453 CCTCCTTTGCAGGAAGAAGCTGG - Exonic
1130279659 15:82510555-82510577 CACCATTTGCAGAAGAAAGCAGG - Intergenic
1130431324 15:83850171-83850193 CCTCCGTAGCGGGAGGAAGCAGG - Intronic
1131699415 15:94918067-94918089 CCTCTATTCCAGGAGGGAGCTGG + Intergenic
1133030277 16:3007620-3007642 CCCCACTTGCAGGGGGCAGCGGG - Intergenic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1138284114 16:55794769-55794791 CCTTATCAGCAAGAGGAAGCCGG + Intergenic
1138284888 16:55802218-55802240 CCTTATCAGCAAGAGGAAGCCGG - Intergenic
1139134053 16:64179871-64179893 CCTTTCTTGCAGGAGGAAGGTGG - Intergenic
1139188676 16:64836723-64836745 CCTGATCAGCAGGAGGAGGCGGG - Intergenic
1141069178 16:80937826-80937848 CCTCAGTTTAAGGAGGGAGCTGG + Intergenic
1141887750 16:86904311-86904333 CCTCATTGACTGGAGGAAACAGG + Intergenic
1142119559 16:88379300-88379322 CCTGCTTTCCAGGAGGAAACTGG - Intergenic
1143114775 17:4576325-4576347 CCTGCTTTGGAGGAGGAAGATGG + Intergenic
1143776331 17:9201586-9201608 CCTCCCTTGTAGGAGAAAGCTGG + Intronic
1143935473 17:10479866-10479888 CCTCACTGGAAGGAGGAAGATGG + Intergenic
1144497520 17:15757884-15757906 CCTCAGGTGCAGGGGGTAGCGGG - Intergenic
1144629313 17:16862368-16862390 CCTCAGGTGCAGGGGGTAGCGGG - Intergenic
1144652112 17:17013747-17013769 CCTCAGGTGCAGGGGGTAGCGGG + Intergenic
1145160884 17:20572934-20572956 CCTCAGGTGCAGGGGGTAGCGGG - Intergenic
1145715557 17:27016699-27016721 TGTCCTTTGCAGGATGAAGCTGG - Intergenic
1147592064 17:41689809-41689831 CCTCAGTGCCAGCAGGAAGCAGG - Exonic
1148165811 17:45483396-45483418 ACCCACTTCCAGGAGGAAGCTGG - Intronic
1148360740 17:47010270-47010292 CTACATTTGCAAGTGGAAGCTGG - Intronic
1148368169 17:47072245-47072267 ACCCATTCCCAGGAGGAAGCTGG + Intergenic
1150139040 17:62713201-62713223 CAGCTTTTGCAGGAGGAAGCCGG - Intronic
1151402396 17:73864355-73864377 CTTCATTTACAGATGGAAGCTGG + Intergenic
1152097052 17:78278477-78278499 CCTCATTTCCAGTAACAAGCGGG + Intergenic
1152172502 17:78761981-78762003 CCTCATTGTATGGAGGAAGCAGG - Intronic
1152695409 17:81741507-81741529 CCCCTTTTGCAGGAGGATGGGGG + Intergenic
1153238368 18:3010016-3010038 CTTGATTTTCAGCAGGAAGCTGG - Intronic
1153416037 18:4846651-4846673 GCTGAGTTGCAGAAGGAAGCAGG - Intergenic
1154472406 18:14717373-14717395 TGTCCTTTGCAGGATGAAGCTGG + Intergenic
1154532598 18:15362757-15362779 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1156870485 18:41939761-41939783 CCTCATTTGAAGGGGGATGAAGG - Intergenic
1157467024 18:47956063-47956085 CCTGATTTTGAGGATGAAGCTGG + Intergenic
1157548234 18:48563011-48563033 GGTCATTTGCAGGAGGAAGCAGG - Intronic
1161406135 19:4092157-4092179 CCTCTTTTGCAGCTGGAGGCAGG + Intronic
1161451561 19:4348982-4349004 CCTCAGTGCCAGCAGGAAGCAGG + Intronic
1162100958 19:8338372-8338394 CCTGCTGGGCAGGAGGAAGCAGG + Intronic
1162473841 19:10888173-10888195 CCTCTTTAGCACCAGGAAGCAGG + Intronic
1167799632 19:51731841-51731863 CCACATGTGCAAGAGGAACCTGG - Intergenic
1202635640 1_KI270706v1_random:41567-41589 CCTCAGCTGCACAAGGAAGCAGG - Intergenic
925551712 2:5083508-5083530 CATCATTGGGTGGAGGAAGCAGG + Intergenic
925837168 2:7957517-7957539 CCTCATTTTCTGGAGGATACTGG + Intergenic
925917775 2:8619164-8619186 CCTCAGGTGCAGGATGGAGCTGG - Intergenic
925993394 2:9271544-9271566 CCTCAGTGCCAGCAGGAAGCAGG + Intronic
927820038 2:26256226-26256248 GCTGATTTGAGGGAGGAAGCAGG + Intronic
928024883 2:27731115-27731137 CACCGTTTGCAGGAGGAATCAGG + Intergenic
928982298 2:37148552-37148574 ACTCATTTGTAGTACGAAGCTGG - Intronic
929235921 2:39605497-39605519 CCTCATTTGCAGGTGTACGGTGG + Intergenic
929968374 2:46552404-46552426 CGTCATTTGCAGGCTAAAGCTGG - Intronic
931073184 2:58678183-58678205 CCTCATGTGCAGGTAAAAGCTGG - Intergenic
931077969 2:58737464-58737486 TCACATTTGCAGGAGGAAGATGG - Intergenic
932750909 2:74371166-74371188 TCTCCTTTGCAGGAGGAGGAGGG - Exonic
933194349 2:79371626-79371648 CCTACTTTGCAGGAGGAACATGG + Intronic
934654527 2:96110269-96110291 CCCCATTTGCAGGTGGGAGTTGG + Intergenic
935743328 2:106170067-106170089 CCTCCTTTGCAGCATGAATCAGG - Intronic
938531702 2:132193978-132194000 CCTGATTAGCAGGAGGAGGTAGG + Intronic
940046585 2:149416466-149416488 CCTAATTGGCAGGAAGAGGCAGG - Intronic
946148320 2:217747502-217747524 GAACACTTGCAGGAGGAAGCAGG - Intronic
947837368 2:233185274-233185296 CCTCAGTTGGAGAAGGAGGCAGG - Intronic
947960637 2:234233807-234233829 CATCATTTTCAGAAGGAACCAGG + Intergenic
948372488 2:237498463-237498485 CCTGATATGCTGGAGGAAGGAGG + Intronic
948552088 2:238779392-238779414 CCTCATGTGCTGGAGGATGATGG + Intergenic
1170117216 20:12873225-12873247 CCTCATTTGCTGATGGTAGCAGG - Intergenic
1170967506 20:21088155-21088177 TCTCATCTGAAGGAGGAAGGAGG - Intergenic
1171203766 20:23263555-23263577 CCTCATGAACAGGAGGCAGCAGG + Intergenic
1171233045 20:23502543-23502565 TCTTATGTGCAGCAGGAAGCAGG - Intergenic
1172173524 20:32958962-32958984 CCTGATTTGCAGGGAGGAGCAGG + Intronic
1174459657 20:50673415-50673437 CCACCTTTGCAGGGGGTAGCTGG - Intronic
1175957230 20:62617596-62617618 CCTCATGGGCAGCAGGAACCAGG + Intergenic
1176764760 21:13005452-13005474 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1176802085 21:13440526-13440548 TGTCCTTTGCAGGATGAAGCTGG - Intergenic
1178351193 21:31873857-31873879 CCTCATCGGCAGCAGGAAGCTGG + Exonic
1179633520 21:42692963-42692985 CCACATGTCCAGGAGGGAGCCGG + Intronic
1180106595 21:45622858-45622880 CCTCATCTGCAGGAGGACACTGG - Intergenic
1180429339 22:15231911-15231933 CCTGATTAGTAGGAGGAGGCAGG - Intergenic
1180511945 22:16100245-16100267 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1180967612 22:19798758-19798780 CCTCATTTCCTGCGGGAAGCTGG - Intronic
1181510184 22:23385539-23385561 CCTCATTTGGAGGAAGAACCAGG - Intergenic
1181549124 22:23626674-23626696 CCTCACCTGCAGTAGGAGGCTGG - Intronic
1181799541 22:25335489-25335511 CCTCACCTGCAGTAGGAGGCTGG + Intergenic
1182867859 22:33620222-33620244 CCTTGTTGGCAGGATGAAGCTGG - Intronic
1184599473 22:45534026-45534048 GCTCATCTGCAGGAGGGAGGTGG + Intronic
1185107535 22:48882825-48882847 CCTCCTTAGCGGGAGGCAGCAGG + Intergenic
950871538 3:16233931-16233953 CCTCATCTTGAGGAGGCAGCTGG + Intergenic
953454294 3:43029683-43029705 CCTCATGTCCAGGAGGCAGAAGG + Intronic
954806274 3:53222736-53222758 CCTCTTTGGGAGGAGGAAGAGGG - Intergenic
956097276 3:65730396-65730418 CCTCATTTAAAGCAGGAAGCAGG + Intronic
957715686 3:83927653-83927675 CGTCATTTGGAGGTGGAAGGAGG + Intergenic
957834878 3:85574353-85574375 CCTCATTAGCAGCACAAAGCTGG - Intronic
960042151 3:113161652-113161674 CCTCATCTGAAGGAGGACTCTGG - Intergenic
961658314 3:128455281-128455303 CCTCAGAGGCAGCAGGAAGCAGG + Intergenic
966923855 3:184631821-184631843 CCTCCTTTCCAGGATGGAGCAGG - Intronic
967405236 3:189108275-189108297 CTTCATTTGGAGCTGGAAGCAGG + Intronic
969698180 4:8747775-8747797 CCTCATTATTCGGAGGAAGCCGG + Intergenic
969828181 4:9774857-9774879 CCTTATTTGCAGAAGGAATGAGG - Intronic
969842595 4:9893388-9893410 TCTCATTTGCAGGGGGAGGGCGG + Intronic
972370228 4:38416402-38416424 CCACATTTGCAGGTGCATGCTGG - Intergenic
972423670 4:38912773-38912795 CCACATTCGGAGGTGGAAGCTGG + Intronic
975726266 4:77294665-77294687 ACTGATCAGCAGGAGGAAGCTGG - Intronic
979124954 4:116957789-116957811 TGTCATATGCAGGATGAAGCTGG - Intergenic
979366069 4:119824979-119825001 CCTCAGTTGCAGCAGTAACCTGG + Intergenic
980694458 4:136337396-136337418 CCTCTTTTCCATGAGGCAGCTGG - Intergenic
983532167 4:168822137-168822159 CCTCATTTCCAAGAGGACTCAGG + Intronic
983914449 4:173276674-173276696 CCTATTGTGGAGGAGGAAGCAGG + Intronic
985630660 5:1012374-1012396 CCACATCTGCAGGAGGCAGCAGG + Intronic
988468411 5:31513247-31513269 CCACAGTTGCAGGATGATGCAGG - Intronic
990020577 5:51122074-51122096 CCGTATTTGCAGGAGGAGCCTGG + Intergenic
991956808 5:72002848-72002870 CCTCATTTACAGAATGAAACTGG - Intergenic
996213974 5:120845318-120845340 TCTCATTTGCAGGATGAAGAGGG + Intergenic
996279855 5:121716148-121716170 CCACTCTTGCAGGAGGAAGATGG - Intergenic
1000023541 5:157339306-157339328 CCTAGTTTGGAGGAGGCAGCTGG - Intronic
1001078926 5:168652609-168652631 CCTGCTTTGCAGGTGGAACCTGG + Intergenic
1001867317 5:175116839-175116861 CCTCATTTGAGGGAGGAGGTAGG + Intergenic
1003124436 6:3344810-3344832 CCCCATTTTAAGGAGGCAGCAGG - Intronic
1003146231 6:3512840-3512862 CCTCATTTTCACTAGGAAGCAGG - Intergenic
1011693991 6:89895604-89895626 CATCCTTTGCAGTAGGAACCTGG + Exonic
1012663820 6:101940588-101940610 CCTCATTTCCAGGACACAGCAGG - Intronic
1014566615 6:122956681-122956703 CCTGATTTGGTGGAGGTAGCAGG - Intergenic
1014796394 6:125729901-125729923 CCTCATTTACAAAAGGAAGTGGG - Intergenic
1016354861 6:143207594-143207616 CCTCATATCCAGGAGCAAGGTGG + Intronic
1017119966 6:151014987-151015009 CCACATTTAAAGGAGGAGGCTGG - Intronic
1018781328 6:167068754-167068776 CCACACTTGCAGGAGTAAGGTGG + Intergenic
1019515233 7:1436946-1436968 CCTCTTTTGGAGGAAGAAGGTGG + Intronic
1019774701 7:2905705-2905727 CCTGACCTGCAGGAGGAAGCGGG + Intergenic
1020764605 7:12304096-12304118 CCTCTGCTGCAGGAGGAAGTGGG - Intergenic
1020823274 7:12997050-12997072 TGTCCTTTGCAGGATGAAGCTGG - Intergenic
1021778460 7:24077364-24077386 CCACTTTTGCAGGAGTAAGGTGG + Intergenic
1023138496 7:37077519-37077541 ACACAGTTGCAGGATGAAGCAGG + Intronic
1023285378 7:38613846-38613868 GCACAGTTGCATGAGGAAGCAGG - Intronic
1025797826 7:64756388-64756410 CCTCATTTCCAGCAGAAAGCGGG + Intergenic
1026913207 7:74104789-74104811 CTGCATTGGCAGGAGGGAGCTGG - Intronic
1028071018 7:86450922-86450944 TCACATTTCCAGGAGGAAGAAGG + Intergenic
1028281442 7:88934693-88934715 CCACTTTTGCAGGAGTAAGGTGG - Intronic
1029259783 7:99294006-99294028 CCTCATTTGCAGGAGGAAGCTGG + Intergenic
1029689774 7:102173599-102173621 CTTCCTTTGCAGAATGAAGCAGG - Intronic
1030202203 7:106917178-106917200 ACTCATTTACAGCAGGAGGCGGG + Intergenic
1032331407 7:130984099-130984121 CCTATTTTGCAGGAGGAAAATGG - Intergenic
1032541359 7:132705702-132705724 CCTTATATGCAGAAGGAAACAGG + Intronic
1034047483 7:147945442-147945464 CATCATTTGCAGTACGAAGCAGG + Intronic
1035008099 7:155685028-155685050 CTTCAGTTGCAGGAGCAACCTGG - Intronic
1035597183 8:867372-867394 CCTAATTTGCTGGAGTCAGCAGG + Intergenic
1037785475 8:21900443-21900465 TCTTATTTGTAGGTGGAAGCAGG + Intergenic
1038192710 8:25338557-25338579 CCTCCTTTCCAGGTGGAAGTGGG + Intronic
1038382420 8:27108838-27108860 CCTCATTTGCAGGAGCAGGCAGG + Intergenic
1039473534 8:37827694-37827716 CCTCATCTGAAGGAGGAGGCTGG + Intronic
1042006172 8:64182685-64182707 CCACAGTGGGAGGAGGAAGCGGG - Intergenic
1042065743 8:64873999-64874021 CGTCATTTGCAGGATGAATCTGG + Intergenic
1042226170 8:66515991-66516013 CCACATTTTCCGGAGGATGCCGG - Exonic
1042564706 8:70100295-70100317 CCTGATTGGCAGGAGGAAGTAGG - Intergenic
1043323622 8:79022269-79022291 GCACATTTGCAGGAGGAATATGG - Intergenic
1044639442 8:94363104-94363126 ACTCATTTCCAGGAGGAAGAAGG - Intergenic
1045353995 8:101368825-101368847 CGTCTGTTGCAGAAGGAAGCCGG - Intergenic
1045864114 8:106845335-106845357 ACTCATTTTCAGAAGGAGGCAGG - Intergenic
1046272580 8:111915867-111915889 CCTGATTAGCAGGAGGAGGTGGG + Intergenic
1046564233 8:115878303-115878325 GCTCTTTTGCTGGAGGAAGGGGG - Intergenic
1047482544 8:125298529-125298551 CCTCATTAGCAGGATAATGCGGG + Intronic
1047828064 8:128599957-128599979 AAACATTTGCAGGAGGAAGGAGG - Intergenic
1048274200 8:133053488-133053510 CCTGATTTGTGGGAGGCAGCTGG + Intronic
1049275758 8:141719346-141719368 ACCCCTCTGCAGGAGGAAGCTGG + Intergenic
1049319000 8:141985963-141985985 GCTCATTTTCAGGAGGATTCAGG - Intergenic
1050689948 9:8215137-8215159 TCTCCTTTGCAGGAGGAAACTGG - Intergenic
1053710310 9:40800474-40800496 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1054420217 9:64921269-64921291 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1056018231 9:82414946-82414968 CATTATTTGCAGGAGTAAGGTGG - Intergenic
1056560118 9:87722811-87722833 GCCCCTCTGCAGGAGGAAGCTGG + Intergenic
1056568158 9:87792991-87793013 CACCCTCTGCAGGAGGAAGCTGG - Intergenic
1056787718 9:89604904-89604926 CCTCATTTACATCAGAAAGCGGG + Intergenic
1057748158 9:97768914-97768936 CCACATTTGCCTGAAGAAGCTGG - Intergenic
1058684082 9:107465689-107465711 CCGCCTTTGCTGGAGGGAGCCGG - Intergenic
1058995180 9:110292381-110292403 CCTCCTTTGCAGGACGAGGTGGG - Intergenic
1059902033 9:118938681-118938703 CTTCATTTTCTGGAGGCAGCAGG - Intergenic
1060184252 9:121554204-121554226 CCAACTTTGCAGGAGGAGGCAGG + Intergenic
1060492308 9:124093838-124093860 TCTCATTGCCAGGAGGAAGCAGG + Intergenic
1060518833 9:124282536-124282558 CCTCATTCCCAGGAGGAGACAGG + Intronic
1060979114 9:127782639-127782661 CCACTTTTGGAGGAGGAGGCAGG - Intergenic
1061866618 9:133494678-133494700 CCTTATCTGCAGGAGGAGGCGGG - Intergenic
1062157696 9:135062598-135062620 CCTCACTTTAAGGAGGAAGCAGG + Intergenic
1186306167 X:8260969-8260991 TCTCATTTGCAAGTGGGAGCTGG + Intergenic
1188655794 X:32693684-32693706 CCTCTTTTGGAGGATGACGCGGG - Intronic
1188875587 X:35426462-35426484 CCAAATTTGGAGGAGGAACCTGG + Intergenic
1192195211 X:69023337-69023359 CCTCATTTGGAGGATGATGGTGG + Intergenic
1193203143 X:78715649-78715671 CCTCCTTTGGTGGAGGTAGCAGG - Intergenic
1195217393 X:102714397-102714419 CCTGTTTTGTAGGAGGCAGCCGG + Exonic
1196022764 X:111007511-111007533 CCTCACCTGGAGGAGGCAGCTGG - Intronic
1196276010 X:113766152-113766174 CCTCATTGGCAGCAGGTACCTGG + Intergenic
1199726238 X:150585187-150585209 TCTCATTTGAAGGCAGAAGCAGG - Intronic