ID: 1029259784

View in Genome Browser
Species Human (GRCh38)
Location 7:99294014-99294036
Sequence GCAGGAGGAAGCTGGCCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 348}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029259778_1029259784 -6 Left 1029259778 7:99293997-99294019 CCCTCTGGCCCTCATTTGCAGGA No data
Right 1029259784 7:99294014-99294036 GCAGGAGGAAGCTGGCCGCCAGG 0: 1
1: 0
2: 0
3: 34
4: 348
1029259775_1029259784 4 Left 1029259775 7:99293987-99294009 CCTTGACAGCCCCTCTGGCCCTC No data
Right 1029259784 7:99294014-99294036 GCAGGAGGAAGCTGGCCGCCAGG 0: 1
1: 0
2: 0
3: 34
4: 348
1029259776_1029259784 -5 Left 1029259776 7:99293996-99294018 CCCCTCTGGCCCTCATTTGCAGG No data
Right 1029259784 7:99294014-99294036 GCAGGAGGAAGCTGGCCGCCAGG 0: 1
1: 0
2: 0
3: 34
4: 348
1029259773_1029259784 13 Left 1029259773 7:99293978-99294000 CCTATGTTTCCTTGACAGCCCCT No data
Right 1029259784 7:99294014-99294036 GCAGGAGGAAGCTGGCCGCCAGG 0: 1
1: 0
2: 0
3: 34
4: 348
1029259779_1029259784 -7 Left 1029259779 7:99293998-99294020 CCTCTGGCCCTCATTTGCAGGAG 0: 1
1: 0
2: 0
3: 12
4: 164
Right 1029259784 7:99294014-99294036 GCAGGAGGAAGCTGGCCGCCAGG 0: 1
1: 0
2: 0
3: 34
4: 348
1029259772_1029259784 23 Left 1029259772 7:99293968-99293990 CCTGTAAGTGCCTATGTTTCCTT No data
Right 1029259784 7:99294014-99294036 GCAGGAGGAAGCTGGCCGCCAGG 0: 1
1: 0
2: 0
3: 34
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029259784 Original CRISPR GCAGGAGGAAGCTGGCCGCC AGG Intergenic