ID: 1029261068

View in Genome Browser
Species Human (GRCh38)
Location 7:99303235-99303257
Sequence CAGGCAGCCTGGTCCTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029261068_1029261076 7 Left 1029261068 7:99303235-99303257 CCTGCTGAGGACCAGGCTGCCTG No data
Right 1029261076 7:99303265-99303287 AGGCCACCTCCTCCCATCGTGGG No data
1029261068_1029261083 28 Left 1029261068 7:99303235-99303257 CCTGCTGAGGACCAGGCTGCCTG No data
Right 1029261083 7:99303286-99303308 GGCCACTGTGGACCCGAGCATGG No data
1029261068_1029261075 6 Left 1029261068 7:99303235-99303257 CCTGCTGAGGACCAGGCTGCCTG No data
Right 1029261075 7:99303264-99303286 AAGGCCACCTCCTCCCATCGTGG No data
1029261068_1029261080 16 Left 1029261068 7:99303235-99303257 CCTGCTGAGGACCAGGCTGCCTG No data
Right 1029261080 7:99303274-99303296 CCTCCCATCGTGGGCCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029261068 Original CRISPR CAGGCAGCCTGGTCCTCAGC AGG (reversed) Intergenic
No off target data available for this crispr