ID: 1029261076

View in Genome Browser
Species Human (GRCh38)
Location 7:99303265-99303287
Sequence AGGCCACCTCCTCCCATCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029261073_1029261076 -4 Left 1029261073 7:99303246-99303268 CCAGGCTGCCTGGGCAGGAAGGC No data
Right 1029261076 7:99303265-99303287 AGGCCACCTCCTCCCATCGTGGG No data
1029261068_1029261076 7 Left 1029261068 7:99303235-99303257 CCTGCTGAGGACCAGGCTGCCTG No data
Right 1029261076 7:99303265-99303287 AGGCCACCTCCTCCCATCGTGGG No data
1029261066_1029261076 15 Left 1029261066 7:99303227-99303249 CCTAGGCGCCTGCTGAGGACCAG No data
Right 1029261076 7:99303265-99303287 AGGCCACCTCCTCCCATCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029261076 Original CRISPR AGGCCACCTCCTCCCATCGT GGG Intergenic
No off target data available for this crispr