ID: 1029261083

View in Genome Browser
Species Human (GRCh38)
Location 7:99303286-99303308
Sequence GGCCACTGTGGACCCGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029261068_1029261083 28 Left 1029261068 7:99303235-99303257 CCTGCTGAGGACCAGGCTGCCTG No data
Right 1029261083 7:99303286-99303308 GGCCACTGTGGACCCGAGCATGG No data
1029261074_1029261083 9 Left 1029261074 7:99303254-99303276 CCTGGGCAGGAAGGCCACCTCCT No data
Right 1029261083 7:99303286-99303308 GGCCACTGTGGACCCGAGCATGG No data
1029261078_1029261083 -8 Left 1029261078 7:99303271-99303293 CCTCCTCCCATCGTGGGCCACTG No data
Right 1029261083 7:99303286-99303308 GGCCACTGTGGACCCGAGCATGG No data
1029261073_1029261083 17 Left 1029261073 7:99303246-99303268 CCAGGCTGCCTGGGCAGGAAGGC No data
Right 1029261083 7:99303286-99303308 GGCCACTGTGGACCCGAGCATGG No data
1029261077_1029261083 -5 Left 1029261077 7:99303268-99303290 CCACCTCCTCCCATCGTGGGCCA No data
Right 1029261083 7:99303286-99303308 GGCCACTGTGGACCCGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029261083 Original CRISPR GGCCACTGTGGACCCGAGCA TGG Intergenic
No off target data available for this crispr