ID: 1029264152

View in Genome Browser
Species Human (GRCh38)
Location 7:99325439-99325461
Sequence GGCTTTCCACAGAGGGAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029264140_1029264152 14 Left 1029264140 7:99325402-99325424 CCAGGAAGGGTCGAGAAAGTTCC No data
Right 1029264152 7:99325439-99325461 GGCTTTCCACAGAGGGAGCACGG No data
1029264139_1029264152 15 Left 1029264139 7:99325401-99325423 CCCAGGAAGGGTCGAGAAAGTTC No data
Right 1029264152 7:99325439-99325461 GGCTTTCCACAGAGGGAGCACGG No data
1029264149_1029264152 -7 Left 1029264149 7:99325423-99325445 CCTGGGGGGCTTCAGGGGCTTTC No data
Right 1029264152 7:99325439-99325461 GGCTTTCCACAGAGGGAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029264152 Original CRISPR GGCTTTCCACAGAGGGAGCA CGG Intergenic
No off target data available for this crispr