ID: 1029265083

View in Genome Browser
Species Human (GRCh38)
Location 7:99332516-99332538
Sequence ATTCTGTTCAGGGTCGTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 65}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029265083_1029265087 20 Left 1029265083 7:99332516-99332538 CCATTGACGACCCTGAACAGAAT 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1029265087 7:99332559-99332581 CAATGCTAGATTTATTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029265083 Original CRISPR ATTCTGTTCAGGGTCGTCAA TGG (reversed) Intronic
903461974 1:23526555-23526577 ATTCTGTTCAAGGTCTTCCTGGG - Intronic
908829629 1:68166016-68166038 AATCTGTTGAGGATCCTCAAAGG + Intronic
910267416 1:85352363-85352385 TTCCAGTTCAGGGTCATCAAGGG - Intronic
919716228 1:200779649-200779671 ATACTGTGGAGGGTAGTCAAAGG + Intronic
922675668 1:227547504-227547526 ATGTTGTTGAGGGTCATCAAGGG + Intergenic
923064832 1:230508121-230508143 ATTCTGTTTAGGGGCGGTAAGGG + Intergenic
924156504 1:241182151-241182173 ATCCAGTTCAGGGACGTGAATGG - Intronic
1070903227 10:80049025-80049047 GTTCTGCTCAGGGTCATCATTGG + Intergenic
1078020566 11:7653166-7653188 ATCCAGTTCAGGGGCATCAAGGG - Exonic
1085970217 11:81580425-81580447 ATTCTGATCAGAGTCTTCACGGG - Intergenic
1091384332 12:83199-83221 ATTCTGTTTAGGTTCCTCAAGGG + Intronic
1095316261 12:40765685-40765707 ATTCTTGTCAAGGTCATCAAAGG - Intronic
1108573721 13:51773489-51773511 TTTCTGTTCAGAGTAGTCAAGGG + Intronic
1109062957 13:57643158-57643180 ATTCTTTTCATGATTGTCAAAGG - Intronic
1110223513 13:73096522-73096544 ATTCCTTCCAGGGTCGGCAAAGG + Intergenic
1111606507 13:90546389-90546411 ATTCTGGTCAGTGTTTTCAATGG - Intergenic
1118596896 14:67442660-67442682 ATACTGTTCAGGGACAGCAAAGG + Intergenic
1125248869 15:37676535-37676557 TTTCAGTTCAGGGTCCTCAAGGG + Intergenic
1129036294 15:72650558-72650580 ATACTGTTCAGCTTTGTCAATGG + Intergenic
1129213595 15:74086666-74086688 ATACTGTTCAGCTTTGTCAATGG - Intergenic
1129396807 15:75254419-75254441 ATACTGTTCAGCTTTGTCAATGG + Intergenic
1129400417 15:75278696-75278718 ATACTGTTCAGCTTTGTCAATGG + Intronic
1129474035 15:75771404-75771426 ATACTGTTCAGCTTTGTCAATGG + Intergenic
1129730730 15:77930990-77931012 ATACTGTTCAGCTTTGTCAATGG - Intergenic
1132563277 16:608558-608580 ATTCTTTTCAGGATGGTAAAGGG - Intronic
1137449163 16:48554864-48554886 ATTCTGCTCAGGGCCTTCAAAGG + Intronic
1141098699 16:81181209-81181231 ATTCTGCTCAGGGTCACCATGGG - Intergenic
1141312625 16:82929692-82929714 CTTCTTTTCAGGTTCATCAACGG - Intronic
1146643698 17:34562311-34562333 GTTCTGCTCAGGGTCGCCACTGG + Intergenic
1146790870 17:35749950-35749972 ATTCGGGTCAGGGTGGACAATGG + Intronic
1150505394 17:65693430-65693452 ATTCTGCTCAGTGAAGTCAAGGG + Intronic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1154066692 18:11113341-11113363 ATTTTGTCCAGGTTGGTCAATGG - Intronic
1168549353 19:57280382-57280404 CTCCTGTCCTGGGTCGTCAATGG - Intronic
929643908 2:43608626-43608648 ATTCTCTTCAGCTTCCTCAATGG - Intergenic
930934169 2:56927059-56927081 ATTCTATTCAGGGCTGTAAATGG + Intergenic
938761866 2:134433428-134433450 TTTCTGTTCTGGCTCTTCAAAGG + Intronic
939488221 2:142843908-142843930 ATTCTATTCATAGTCATCAAAGG - Intergenic
940763931 2:157769296-157769318 ATTCTGTTCAGTGTCTTTGATGG - Intronic
942190001 2:173460077-173460099 ATTCTGTTCAGGCTGGACCAAGG + Intergenic
942644195 2:178093179-178093201 ATACTGTTTAGGGTCTTCTATGG + Intronic
943279651 2:185916057-185916079 ATTCTTTTCAGTGTTGTCACTGG - Intergenic
1172187341 20:33039374-33039396 ATCTTGATCTGGGTCGTCAAGGG - Exonic
1184923974 22:47624712-47624734 ATTTTCTGCAGGGTGGTCAAAGG - Intergenic
954466178 3:50656338-50656360 ATTCTGTCCTGGGTGGTCAGTGG - Intergenic
967805045 3:193708335-193708357 ATAATGTTCAGAGTCATCAAGGG + Intergenic
969394905 4:6914225-6914247 TTATTGTTCAGGGTCCTCAAAGG - Intronic
969970292 4:11040014-11040036 AGCCTGTTCAGGGTAATCAAGGG - Intergenic
976122297 4:81796422-81796444 ATCATGTTCAGGGTCTTGAATGG + Intronic
976787844 4:88842420-88842442 ATTAAGTTCAAGGTCTTCAAAGG - Intronic
990823550 5:59871400-59871422 TTTCTGTTCAGGGTCTCAAAAGG - Intronic
995458520 5:112377636-112377658 ATTATGTTGAGGGTCGCCATGGG - Intronic
999481845 5:151955935-151955957 ATTATGTTCATGATTGTCAAGGG - Intergenic
1001845898 5:174921269-174921291 ATACTGTTCAGCTTTGTCAATGG - Intergenic
1012760173 6:103291812-103291834 GTTCTTTTCAGGGACGTCAATGG + Intergenic
1013189136 6:107787063-107787085 ATTCTGTCCAGGGCCGACACAGG - Intronic
1018575055 6:165251393-165251415 ATTCTGGTCAGGGGCTTCACAGG + Intergenic
1021482121 7:21129609-21129631 ATTCTGTTTAGTGTTGTCATTGG + Intergenic
1021577266 7:22115958-22115980 CTGCTGTTCAGGGTCTTCCAGGG + Intergenic
1022295305 7:29045547-29045569 ATTCTCTTCATTGTCTTCAAAGG + Intronic
1029265083 7:99332516-99332538 ATTCTGTTCAGGGTCGTCAATGG - Intronic
1029412097 7:100419950-100419972 ATTCTGTTATGGCTAGTCAAAGG - Intronic
1032304666 7:130721423-130721445 TTTCTGTTCAAGATCCTCAATGG + Intergenic
1039769448 8:40668906-40668928 ATGGTGTTCTGGGTAGTCAAGGG - Intronic
1046392447 8:113593246-113593268 CTTTTGTTCAGGGTCTTCAGAGG - Intergenic
1048396079 8:134015241-134015263 ATTCTGTTGAGGGTGGTCTGGGG - Intergenic
1049592118 8:143467490-143467512 ATTCTTTTCAAGTTCCTCAAGGG + Intronic
1058033301 9:100223678-100223700 GTTCTATTTAGGGTCATCAAGGG + Intronic
1060110698 9:120904521-120904543 AGTCTGTCCAGGCTCGTCATTGG - Exonic
1186540164 X:10392329-10392351 ATTCTTTTATGGGTCATCAATGG - Intergenic
1195749524 X:108150191-108150213 ATTCTCTTCAGTGTCAACAAAGG - Exonic