ID: 1029269082

View in Genome Browser
Species Human (GRCh38)
Location 7:99365753-99365775
Sequence ATCCTGTTTCAGGTGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 241}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029269067_1029269082 16 Left 1029269067 7:99365714-99365736 CCCCGGCCTGGAGTGTCTCTGCG 0: 1
1: 0
2: 2
3: 4
4: 115
Right 1029269082 7:99365753-99365775 ATCCTGTTTCAGGTGGGGCAGGG 0: 1
1: 0
2: 1
3: 21
4: 241
1029269068_1029269082 15 Left 1029269068 7:99365715-99365737 CCCGGCCTGGAGTGTCTCTGCGG 0: 1
1: 0
2: 1
3: 26
4: 247
Right 1029269082 7:99365753-99365775 ATCCTGTTTCAGGTGGGGCAGGG 0: 1
1: 0
2: 1
3: 21
4: 241
1029269073_1029269082 10 Left 1029269073 7:99365720-99365742 CCTGGAGTGTCTCTGCGGGGTGA 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1029269082 7:99365753-99365775 ATCCTGTTTCAGGTGGGGCAGGG 0: 1
1: 0
2: 1
3: 21
4: 241
1029269065_1029269082 29 Left 1029269065 7:99365701-99365723 CCAGCAGGGGGAGCCCCGGCCTG 0: 1
1: 0
2: 4
3: 47
4: 380
Right 1029269082 7:99365753-99365775 ATCCTGTTTCAGGTGGGGCAGGG 0: 1
1: 0
2: 1
3: 21
4: 241
1029269070_1029269082 14 Left 1029269070 7:99365716-99365738 CCGGCCTGGAGTGTCTCTGCGGG 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1029269082 7:99365753-99365775 ATCCTGTTTCAGGTGGGGCAGGG 0: 1
1: 0
2: 1
3: 21
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029269082 Original CRISPR ATCCTGTTTCAGGTGGGGCA GGG Intronic
900112464 1:1014288-1014310 TTGCTGCTTCAGGTGGGCCACGG - Exonic
900922300 1:5680922-5680944 ATCCGGTCTCAGCTGGGGAAAGG + Intergenic
901924227 1:12555660-12555682 TGCCTGTTGCAGGTGGGCCAAGG - Intergenic
901935123 1:12621454-12621476 AGCCTGATTCAGGAGGGCCAGGG - Intergenic
901978568 1:13015054-13015076 ATTCTTTTTTAGGTTGGGCAGGG + Intronic
902003514 1:13213884-13213906 ATTCTTTTTTAGGTTGGGCAGGG - Intergenic
902022742 1:13359623-13359645 ATTCTTTTTTAGGTTGGGCAGGG - Intergenic
904432077 1:30470762-30470784 AACCTGCTTCAGGCGGGGCCAGG + Intergenic
905788888 1:40779663-40779685 TACGTGTTTCAGGTGGAGCAGGG - Intergenic
905863518 1:41365067-41365089 ACCCTGTGTTAGATGGGGCAGGG + Intronic
910938181 1:92504382-92504404 ATCCTGGTTGAGGTTAGGCAGGG + Intergenic
912490749 1:110061405-110061427 GTCCTGGTTCAGGTAGGGCTGGG + Intronic
915386067 1:155493575-155493597 TTCATTTTTCAGGGGGGGCATGG + Intronic
916475314 1:165163135-165163157 GTCCTGTTTCAGCTTGGGCCCGG - Intergenic
916852718 1:168719867-168719889 TTCCAGTTTCAGATGGAGCAGGG - Intronic
917537017 1:175881727-175881749 TTCCTGTTTCATTTGGAGCAGGG - Intergenic
918134619 1:181660647-181660669 TTCCTGTCTCAGGTCAGGCATGG - Intronic
919305076 1:195822064-195822086 ATGCTTTTTTAGGTCGGGCACGG + Intergenic
921611119 1:217213652-217213674 ATACTGTTTCAGGCTGGGCACGG + Intergenic
924310106 1:242731998-242732020 TTTCTGTTTTAGGTGGGGCCAGG - Intergenic
924929960 1:248721817-248721839 ATACTGTTGCAAGTGTGGCAGGG - Intronic
1062900444 10:1141231-1141253 AGCCTGTTTTAGTTTGGGCAAGG - Intergenic
1063274587 10:4551251-4551273 AACCTGTTGCAGGTGGGTGATGG + Intergenic
1063292823 10:4768076-4768098 AGCCTGTTTCATGTGCAGCATGG - Intergenic
1064265409 10:13821441-13821463 ATCCCGGTTCAGGCTGGGCAGGG - Intronic
1064461785 10:15541640-15541662 ATCCTGTGTCAGGTGATACAAGG + Intronic
1066129741 10:32381328-32381350 TTCCTGTCTCAGGAGTGGCAGGG + Intergenic
1069396608 10:67996320-67996342 AGACTGTTTCTTGTGGGGCAGGG - Intronic
1073338441 10:102727851-102727873 ACTCTGTCTCAGGAGGGGCAGGG + Intronic
1074741649 10:116490643-116490665 CACATGTTTCAGGTGGGACAGGG + Intergenic
1074926715 10:118080608-118080630 ATCAAGTTTAAGGTGGGGAAGGG - Intergenic
1076170375 10:128314417-128314439 TTCCTTTTTCAGGTGGGGAGTGG + Intergenic
1076328009 10:129643453-129643475 AGCCTGTTTGAGCTGGGCCAGGG + Intronic
1076935998 10:133567835-133567857 ATCCTGGAGCAGGTGGGGCAGGG + Intronic
1078173939 11:8954577-8954599 ATCCAGTTTCAGGCCAGGCATGG - Intronic
1080643276 11:34170644-34170666 CCACTGTTTCAGGTGGTGCAAGG - Intronic
1082109246 11:48255966-48255988 ATAGTGTTTCAGGAGGGACATGG + Intergenic
1085044879 11:73346949-73346971 ACCCTGATGCAGGTGGGGCTCGG + Exonic
1086342301 11:85858540-85858562 ATACTGTTCCAAGTGTGGCAGGG + Intronic
1088248228 11:107839941-107839963 AATGTGTTTCAGGTTGGGCACGG - Intronic
1091339467 11:134799184-134799206 ATTCTGTTTCAGGAGGCGGAGGG + Intergenic
1094587024 12:31786954-31786976 ATTCTGTTTAAGGCCGGGCATGG - Intergenic
1095612713 12:44148973-44148995 AGCCTGGTTGAGGTGGGGTAGGG - Intronic
1096206178 12:49723867-49723889 ACACTGTTTCAGGCTGGGCACGG + Intronic
1097671915 12:62550237-62550259 AGGCTGTTTCAGGCTGGGCATGG + Intronic
1097966322 12:65585204-65585226 ATTCTGTTTCAGGCTGGACATGG - Intergenic
1098769390 12:74535035-74535057 ATCCTGCCTCAGGCGGGGCGCGG + Intergenic
1100124352 12:91405729-91405751 ATCTTGTTTCTGCTGGGGCCAGG - Intergenic
1100181169 12:92087979-92088001 ATGCTGTATCTGGGGGGGCAGGG + Intronic
1101946172 12:109139235-109139257 AGCCTGTTTCAGGCAGAGCAGGG + Intronic
1102172837 12:110855079-110855101 ATCCCTTTTCAGGCCGGGCATGG - Intronic
1103912590 12:124360570-124360592 ATTTTGTCTCAGGTGTGGCAGGG - Intronic
1105055297 12:133093159-133093181 TTCCTTCTTCAGGTTGGGCAGGG + Intronic
1110179177 13:72595047-72595069 ATCCTCTTTCAGGGGGAGCAGGG - Intergenic
1111132322 13:83993098-83993120 ATCGTGTTTCACTTGGGGTAGGG + Intergenic
1111157815 13:84351416-84351438 ATCCTGTTCTAGGAGGGACAAGG + Intergenic
1112319178 13:98391559-98391581 ATCCTGTTTCTGGCTGGGCATGG - Intronic
1113141916 13:107161871-107161893 ATCGTGTTTCAGGCCGGGCGCGG - Intergenic
1114719218 14:24862286-24862308 ATCCAGGTTTAGGTCGGGCATGG - Intronic
1119170293 14:72529748-72529770 ATCCTGCTACAAGTGGGGAATGG - Intronic
1120111230 14:80560081-80560103 ATCCTTTTTGAGGTGGACCAAGG + Intronic
1121747053 14:96305078-96305100 TTCCTTATTGAGGTGGGGCATGG - Intronic
1122983885 14:105203484-105203506 GTCCTGTTCCAGGTGGGGCAGGG - Intergenic
1124657653 15:31522301-31522323 AACCTGTTTGAGCTGGGACATGG + Intronic
1125983466 15:44025972-44025994 TTCCTTTTTTTGGTGGGGCAGGG + Intronic
1126078859 15:44939081-44939103 AACCTGTTTCAGGCTGGGCACGG - Intergenic
1127470642 15:59287058-59287080 ATCCTCTGTCAGGTGGTGGAAGG - Intronic
1128683810 15:69669246-69669268 TTCCTGTCTCATTTGGGGCAGGG - Intergenic
1129876346 15:78978065-78978087 GGGCTGTTGCAGGTGGGGCAAGG + Intronic
1130136513 15:81186013-81186035 ATCTTTTTGCTGGTGGGGCAAGG + Intronic
1132464253 16:70473-70495 ATCCTGCTTCTGGTGGGTCCTGG - Intronic
1133107361 16:3521121-3521143 AGCCAGTTTCAGGAGGGGAAGGG - Intronic
1135016722 16:18929759-18929781 AAATTGCTTCAGGTGGGGCATGG + Intergenic
1135322356 16:21505612-21505634 AAATTGCTTCAGGTGGGGCATGG + Intergenic
1136684985 16:31988772-31988794 GTCCTGCTGCAGCTGGGGCATGG + Intergenic
1136710445 16:32232641-32232663 CTAATGTTACAGGTGGGGCATGG + Intergenic
1136757467 16:32696770-32696792 CTAATGTTACAGGTGGGGCATGG - Intergenic
1136785599 16:32932307-32932329 GTCCTGCTGCAGCTGGGGCATGG + Intergenic
1136810639 16:33173605-33173627 CTAATGTTACAGGTGGGGCATGG + Intergenic
1136817115 16:33283685-33283707 CTAATGTTACAGGTGGGGCATGG + Intronic
1136823680 16:33340216-33340238 CTAATGTTACAGGTGGGGCATGG + Intergenic
1136884172 16:33921497-33921519 GTCCTGCTGCAGCTGGGGCATGG - Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1138987528 16:62348850-62348872 ATCCTGTCTTGGGTGGGGCTGGG + Intergenic
1141029510 16:80575293-80575315 AGCCTGTTGGAGGTGGGGCAGGG + Intergenic
1141810393 16:86371914-86371936 ATCCTGCCTCAGGAGGGGCCAGG - Intergenic
1142020647 16:87780107-87780129 ACCCTGTCTCAGGCCGGGCACGG - Intergenic
1203059615 16_KI270728v1_random:957119-957141 CTAATGTTACAGGTGGGGCATGG - Intergenic
1143807117 17:9438422-9438444 ATACTGGTTCAGGAGGGCCAAGG - Intronic
1144125751 17:12201537-12201559 AACTTGTTCCAGGTGGTGCAAGG + Intergenic
1144452385 17:15391699-15391721 TTCATGTTGCAGGTGGGGCCTGG + Intergenic
1144699522 17:17327941-17327963 ATCATGTTTCTGGCTGGGCATGG - Intronic
1146887940 17:36484951-36484973 ATCCTGTGCCAAGTCGGGCATGG - Intergenic
1147266655 17:39238407-39238429 CTCCTGCTTCAAGTAGGGCAAGG - Intergenic
1149357338 17:55855141-55855163 ATCCTGTTTCATCTGGGGCCTGG - Intergenic
1149722625 17:58861633-58861655 ATGCTGTTTCTGGCTGGGCACGG + Intronic
1150005442 17:61466117-61466139 TGCCTGCTTCAGGTGGGGCTGGG + Intronic
1152161728 17:78672980-78673002 ATCCTGTGACAGCTGCGGCATGG - Intergenic
1152881428 17:82818269-82818291 ATTCTGTTCCTGGTGGGACATGG + Intronic
1153057203 18:957827-957849 AGCCTGTTCTATGTGGGGCAAGG + Intergenic
1153204980 18:2689509-2689531 ATCATGTTTCAGGCTGGGCGCGG - Intronic
1153356975 18:4148020-4148042 TTTCTGTTTCTGGTTGGGCACGG + Intronic
1155383140 18:25246737-25246759 ATCCTCTCTTAGGTGGGGAAAGG - Intronic
1155553133 18:26987884-26987906 ATCCAGTATCAGGTTGAGCATGG - Intronic
1157642597 18:49232897-49232919 ATTCCGTTTCAGGCTGGGCATGG - Intronic
1157762921 18:50277187-50277209 ATCCTGTCTCCTGTGGGGCTAGG + Exonic
1160017171 18:75153925-75153947 CTCCTGTTGCACGTGGGGCCAGG + Intergenic
1160178122 18:76612516-76612538 ATCCTTTTTCCGGTGAGGCAGGG + Intergenic
1160598857 18:79997245-79997267 ATACTGTTTGAGGTTGGGTAGGG - Intronic
1160768443 19:819578-819600 TTCCTGTTGCAGGACGGGCATGG - Intronic
1161314155 19:3610129-3610151 ATCCTGTTAGAGGTGGGGGCTGG + Intergenic
1162232396 19:9278552-9278574 GTCCTCTTCCTGGTGGGGCATGG - Intergenic
1163787755 19:19285155-19285177 AACCTGTTTGAGGCTGGGCACGG - Intronic
1163925861 19:20342854-20342876 AAACTGTTACAGGTCGGGCATGG + Intergenic
1164599266 19:29549827-29549849 CTCCTCCTTCAGCTGGGGCATGG + Intronic
1165245064 19:34493939-34493961 GGCCTCTTTCAGCTGGGGCAGGG + Intronic
1166168582 19:41010124-41010146 CTCATGTTGCAGGTGGGCCAGGG + Exonic
1166282497 19:41803754-41803776 TTGCTGTTTCAGGCCGGGCATGG - Intronic
1167091990 19:47350708-47350730 ATGCTTTTTCAGGCCGGGCATGG - Intronic
1168296758 19:55380713-55380735 ATCCTTTATGAGGTTGGGCATGG - Intronic
926712422 2:15891876-15891898 ATCCTGATTCCTGTGGGGCAGGG + Intergenic
929605493 2:43231442-43231464 ACCCTCTGTCAGGTGGGGGAAGG - Intronic
931403651 2:61954963-61954985 ATCCTTTATCAGGCTGGGCATGG - Intronic
933477212 2:82806466-82806488 ATTCTGTTTCAGGTTTGGGAGGG - Intergenic
933770923 2:85743485-85743507 ATCCTCTTTTGAGTGGGGCAGGG - Intergenic
935545314 2:104394819-104394841 ATACTGTTGCAAGTGTGGCAAGG - Intergenic
939749575 2:146026548-146026570 CTGCTGTCTCAGGTGCGGCAGGG - Intergenic
939858172 2:147386036-147386058 TTACAGTTTCAGGTTGGGCATGG + Intergenic
940039698 2:149347382-149347404 ATTCTTTTTTAGGTTGGGCAGGG + Intronic
941145687 2:161841366-161841388 AACCTGTGTCAGCAGGGGCATGG - Intronic
941575654 2:167226877-167226899 CTCCTTGTTCAGCTGGGGCATGG + Intronic
942535807 2:176962255-176962277 AGCCTGGTGCAGCTGGGGCATGG - Intergenic
943093536 2:183402186-183402208 TTCCTGATTCAGGTGTGGGAAGG + Intergenic
944879044 2:203992641-203992663 AGTTTGTTTCAGGTGGGGTAGGG + Intergenic
945009517 2:205446260-205446282 ATCCTGAGGGAGGTGGGGCAGGG + Intronic
945322154 2:208436721-208436743 ATCCTGTTTCTGGGAGGGCTTGG + Intronic
947157384 2:227176026-227176048 GTCCTGTGTCAGGTGGGATAAGG - Intronic
947397694 2:229702625-229702647 ATCCTGGTTCTGGCCGGGCACGG + Intronic
947570641 2:231231672-231231694 TTTTTTTTTCAGGTGGGGCATGG - Intronic
1169264333 20:4158427-4158449 ATCTGGATTCAGGTGGAGCATGG + Intronic
1170684807 20:18559541-18559563 TTGCTGGTTCAGGTGGGTCAGGG + Intronic
1171959374 20:31482840-31482862 TTCCTGTATGTGGTGGGGCATGG + Intronic
1174483588 20:50847750-50847772 ATTCAGTTACAGGTGGGACACGG + Intronic
1174708668 20:52682844-52682866 AAGCAGTTGCAGGTGGGGCATGG + Intergenic
1174859285 20:54075246-54075268 TTCCTGTCTCAGCTGGAGCAGGG - Intergenic
1178634523 21:34290575-34290597 ATCCGCTTTCAGGTGGTGCCTGG - Intergenic
1179454715 21:41491111-41491133 ATTCTGTTTCAGTTGGGGGTCGG + Intronic
1180022809 21:45139588-45139610 CTCCTCTGTCACGTGGGGCAGGG + Intronic
1180204139 21:46246876-46246898 ATGCTGTTGCAGGTGGCCCATGG - Exonic
1181535913 22:23544654-23544676 TTCCTTCTTCAGGTTGGGCAGGG - Intergenic
1182093591 22:27612085-27612107 TGCCTGTTTCAGCTGGTGCATGG - Intergenic
1183029020 22:35088007-35088029 ATCCTGTTTCAAGAGGAGCCTGG - Intergenic
1183867294 22:40713953-40713975 ATGCTGATTGAGGTGGGGCTTGG - Intergenic
1184663890 22:45977528-45977550 TTCCAGTTTCCGGTGGGGGAGGG + Intergenic
950025705 3:9818656-9818678 CTCCTGTTTCAGGCTGGTCACGG - Intronic
950726472 3:14920364-14920386 ATCATTTATTAGGTGGGGCATGG + Intronic
950852912 3:16079884-16079906 ACCCTTCTTCAGGTGGGTCAAGG + Intergenic
950881980 3:16329428-16329450 ATCCGTTTACAGGTGGGGCCAGG + Intronic
951041152 3:17990006-17990028 TTCCTGTTGCAGGTGGTTCATGG + Intronic
951490106 3:23260782-23260804 ACCCTGTCTCAGGTGGGGGTTGG + Intronic
951711667 3:25590027-25590049 ATCCTGTTTCAGGCTGGGGCCGG + Intronic
952315825 3:32231513-32231535 ATCCTGTTCCAGATAGGGAAAGG - Intergenic
954296085 3:49675104-49675126 TTCCTGGGTCAGGTGGGGCTGGG + Intronic
959257240 3:104031141-104031163 ATCCTCTTTCAGGAGTGGCCAGG - Intergenic
960011766 3:112841685-112841707 ACCCTATTTCAGGAGTGGCAAGG - Intronic
960181743 3:114588135-114588157 ATTCTGTTTTAGGTGGGGGAAGG + Intronic
962270119 3:133971370-133971392 ATCCTGCTTCAGGTGGGCAGAGG - Intronic
962348851 3:134642270-134642292 CTCCTGTTTCATATGGGGCATGG + Intronic
964909292 3:161758475-161758497 ATCCTGCTTCAAGGGAGGCATGG + Intergenic
966748342 3:183299288-183299310 ATTCTGGTGCAGGTGGTGCAGGG - Intronic
968503069 4:960139-960161 AGCCTGTGTCTGCTGGGGCAGGG + Exonic
968748612 4:2374319-2374341 ATCCTGTTTCAGGCCAGGCATGG + Intronic
968974084 4:3812000-3812022 ATCCTGTCTCACCTGGGCCATGG - Intergenic
969091050 4:4694238-4694260 CTCCTGTGTGAGGTGGGGCTAGG + Intergenic
970157920 4:13160035-13160057 ACACTGTTTCAGGCCGGGCATGG - Intergenic
970227617 4:13876153-13876175 GTGCTGTTTAAGGTGAGGCATGG - Intergenic
970793781 4:19889564-19889586 TGCCTGTTTCAAGTGTGGCAAGG + Intergenic
972580960 4:40395303-40395325 TTCCTGTTACAGGTGAGGAATGG + Intergenic
974097784 4:57383985-57384007 ACCCTGTTTCAGCTGGTGCATGG - Intergenic
976329457 4:83812727-83812749 ATACTGGTTCAGCTGGAGCAAGG - Intergenic
977613172 4:99057929-99057951 ATCAAGTTTGAGGTGGGACAGGG - Intronic
981251617 4:142609842-142609864 ATTCTGTTTCAGCTGGTGCCTGG - Intronic
981874056 4:149519712-149519734 ATCCTGTTTTGGGCTGGGCATGG + Intergenic
981899711 4:149848364-149848386 GTCCTGTTTCAGCTCGCGCACGG - Intergenic
983223905 4:165068289-165068311 ATGTTGTTTCAGGCTGGGCACGG - Intergenic
983935321 4:173498992-173499014 ATCCTGATGCTGGTGGGGGAAGG - Intergenic
984255417 4:177384418-177384440 ATCCTCATTCAGGCGGGGCGTGG + Intergenic
985965431 5:3335897-3335919 ATCCTGCAGCAGCTGGGGCATGG + Intergenic
986364381 5:7016206-7016228 ATCCTGTTTCTCGTGGCTCACGG + Intergenic
987524162 5:19026248-19026270 ATCCTATTTAAGATGGGGAAGGG + Intergenic
988269691 5:28997746-28997768 ATCGTGTTTCTAGTGGGGGATGG - Intergenic
988588234 5:32526379-32526401 GTCTGGCTTCAGGTGGGGCATGG - Intergenic
992057111 5:73001104-73001126 TACATGTTTCTGGTGGGGCATGG + Intronic
993876635 5:93315065-93315087 TTCCTGTTTAAAGTGGGGCCTGG - Intergenic
995170208 5:109101289-109101311 ATACTGTTTAATGTGGAGCAAGG + Intronic
995250327 5:109985674-109985696 TTCCTGTTAGAGGTGGGGCCTGG - Intergenic
995733141 5:115267042-115267064 AAAATGTTTTAGGTGGGGCATGG - Intergenic
996414475 5:123195381-123195403 TTTTTGTTCCAGGTGGGGCATGG - Intergenic
997553058 5:134770502-134770524 ATACTTTTACAGGTGGGGTAAGG - Intronic
997618532 5:135270129-135270151 ATTCAGTTTCTGTTGGGGCAGGG + Intronic
998091501 5:139373500-139373522 ATTCTCCCTCAGGTGGGGCAGGG + Intronic
998856463 5:146399365-146399387 ATCCTGCTTCAGGAGGGCAAGGG + Intergenic
999412191 5:151360508-151360530 GTGCTGTTTCAGGGGTGGCAGGG + Intergenic
1000698888 5:164422866-164422888 ATCGTGTTTTAGGGGGTGCAGGG + Intergenic
1001493950 5:172174868-172174890 AGCCTGGGTCAGGTGGTGCAGGG - Intronic
1003219595 6:4146950-4146972 ATCCTGTTTCTGGAGGGAAATGG + Intergenic
1005165338 6:22913399-22913421 AGCCTGTTTGAGGTGGGAGAAGG - Intergenic
1006873439 6:37274758-37274780 ATCTTGGTTAGGGTGGGGCATGG + Intronic
1010033307 6:71291327-71291349 AGCCTGATTGAGGTGGGTCAGGG + Intronic
1010567089 6:77429319-77429341 ATACTGTTTCGGGCTGGGCATGG - Intergenic
1011379865 6:86731548-86731570 ACCCTGCTTCAGGTCGTGCATGG - Intergenic
1011806595 6:91079530-91079552 ATCCTGTTTGAGTGGGAGCAGGG + Intergenic
1012080937 6:94757927-94757949 GCCCTGTTTCAGCTGGCGCAAGG - Intergenic
1012215030 6:96572365-96572387 ATGCTGCTTCAGCAGGGGCAGGG + Intronic
1013329539 6:109086066-109086088 ATCCTGTATTAGGCCGGGCACGG + Intronic
1015619928 6:135120751-135120773 AACCTGCTTCAGGGAGGGCATGG - Intergenic
1020103243 7:5407335-5407357 CTCCTGCCCCAGGTGGGGCAGGG - Intronic
1020376761 7:7495988-7496010 ATCCTGTGGCAGGAGGAGCAAGG - Intronic
1021913202 7:25406749-25406771 TTCCTATTTCAAGTGGGGCGGGG - Intergenic
1022475199 7:30705460-30705482 ATCCTGGTTCAGGAAGGCCAGGG + Intronic
1022690436 7:32646347-32646369 ATCCTATTTGGGGTGGGGTAGGG + Intergenic
1022917977 7:34980193-34980215 ATCCTATTTGGGGTGGGGTAGGG + Intronic
1025529836 7:61866173-61866195 ATAGTGTTTCAGGCCGGGCACGG + Intergenic
1025768417 7:64481021-64481043 ATACTGTTTAAGGTTGGGTAGGG + Intergenic
1026897891 7:74021100-74021122 ATCCTGTTCCTGGCCGGGCACGG + Intergenic
1028708691 7:93882103-93882125 AACCTGCTTCAGGTTGGGCAAGG + Intronic
1028947599 7:96598581-96598603 CTCCTGCTTCAGGTGGAACATGG - Intronic
1029269082 7:99365753-99365775 ATCCTGTTTCAGGTGGGGCAGGG + Intronic
1030032985 7:105386421-105386443 ATCTTGATTCAGGTCGGGCACGG + Intronic
1034457735 7:151180427-151180449 AGCCTGTTTCAGGAGGCTCAAGG - Intronic
1035810894 8:2490147-2490169 ACCCTATTTCAGGCTGGGCACGG - Intergenic
1036244007 8:7101399-7101421 AACCTGTTCCAGGTGAGGCTGGG + Intergenic
1036296766 8:7543642-7543664 GTTCTGTTTCAGGTGGAGCAGGG + Intergenic
1036325801 8:7777377-7777399 GTTCTGTTTCAGGTGGAGCAGGG - Intergenic
1039791107 8:40876179-40876201 TTGCTGTCTCAGGAGGGGCAGGG - Intronic
1040316867 8:46266674-46266696 CTTCTTTTTCAGGTTGGGCAGGG + Intergenic
1042750618 8:72153910-72153932 ATGCTATTTAAGGTGGGGAAAGG - Intergenic
1042821158 8:72931719-72931741 AACCTGAGGCAGGTGGGGCATGG + Intronic
1044508010 8:93042985-93043007 TTTGTGTTTCAGGTGGGGGATGG + Intergenic
1045151142 8:99409457-99409479 AACTTGTTTCAGGCTGGGCATGG - Intronic
1045697592 8:104827727-104827749 ATCCTGATGCTGGTGGGCCAGGG - Intronic
1046625719 8:116574920-116574942 ATCCTGATTCAGTGGGGGCATGG - Intergenic
1047199127 8:122749082-122749104 AGCCTGTTTCAAGTGGGGATAGG - Intergenic
1047296369 8:123573806-123573828 ATCCTGTCTCAGGCCGGGCACGG - Intergenic
1047662279 8:127050355-127050377 ATTCTGATTCAGGTAGTGCAAGG - Intergenic
1048453839 8:134559218-134559240 AACCTGTTGCAGGTGGGTGAGGG - Intronic
1048802575 8:138207498-138207520 GTATTGTTTCAGGTGGGGCGCGG - Intronic
1049710173 8:144059851-144059873 ATCCTGGAGCAGGTGGGCCAGGG - Exonic
1050092957 9:2033954-2033976 ATACTGTTTCAGGCCGGGCCTGG + Intronic
1050474903 9:6031000-6031022 ATCCTGTTTCAGGTGGTCAGGGG - Intergenic
1051152768 9:14102152-14102174 ATACTGTTTTTGGTGGGGGAGGG - Intronic
1051698316 9:19792172-19792194 ATGTTATTTCAGATGGGGCAAGG - Intergenic
1056596590 9:88012870-88012892 CTCCTTTTTCAGGTGATGCAGGG + Intergenic
1057256863 9:93556694-93556716 ATTCTGTTTTAGGTTGGGCCTGG + Intronic
1057325922 9:94063141-94063163 ATGCTGTATCATGTGGGACAAGG + Intronic
1058233555 9:102461499-102461521 GTGCTGTTGCTGGTGGGGCAGGG + Intergenic
1061661337 9:132132311-132132333 TCCCAGTTTCAGGAGGGGCAGGG + Intergenic
1185789035 X:2914528-2914550 CTGCATTTTCAGGTGGGGCAAGG - Intronic
1187202994 X:17154040-17154062 TTCCTGATTCAGTTGGTGCAGGG - Intergenic
1187239120 X:17496365-17496387 AGCCTGTTTGAGGTGGGTCAGGG - Intronic
1187847953 X:23560804-23560826 GGCCTGTTTCAGGTGGGGGAAGG - Intergenic
1188507309 X:30896481-30896503 AACCAGTTTCAGGCTGGGCATGG + Intronic
1199902602 X:152191550-152191572 AGCCTGGGTCAAGTGGGGCATGG + Intronic
1200260183 X:154611034-154611056 CTTCTTTTTCAGGTTGGGCAGGG + Intergenic