ID: 1029270228

View in Genome Browser
Species Human (GRCh38)
Location 7:99373205-99373227
Sequence CCTCCAATGGGGAGGGTGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029270216_1029270228 23 Left 1029270216 7:99373159-99373181 CCTAGGGGGTCGAATTCAGTGGA 0: 1
1: 0
2: 1
3: 4
4: 69
Right 1029270228 7:99373205-99373227 CCTCCAATGGGGAGGGTGTCGGG 0: 1
1: 0
2: 1
3: 13
4: 147
1029270214_1029270228 24 Left 1029270214 7:99373158-99373180 CCCTAGGGGGTCGAATTCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1029270228 7:99373205-99373227 CCTCCAATGGGGAGGGTGTCGGG 0: 1
1: 0
2: 1
3: 13
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029270228 Original CRISPR CCTCCAATGGGGAGGGTGTC GGG Intronic
900414186 1:2527620-2527642 CTTCCAAGGGGGTGGGTGTGTGG + Intergenic
900605397 1:3521484-3521506 CCTGGGATGGGGAGGGTGTTGGG - Intronic
901404833 1:9038988-9039010 CCTCCAATGGGGCAGCTGTGAGG + Intronic
902150077 1:14435760-14435782 CTTCGAATGGGGATGGTGACAGG + Intergenic
902150084 1:14435795-14435817 CTTCGAATGGGGATGGTGACAGG + Intergenic
903124109 1:21236148-21236170 CCTCCAGTGGGATGGGAGTCAGG - Intronic
907384273 1:54115896-54115918 CCTGCAATGAGGACAGTGTCAGG + Intergenic
907554736 1:55334225-55334247 CCACCAATGTGGAGGATGTATGG + Intergenic
909155593 1:72071539-72071561 ACTCTAATGGGGATGGTGACAGG - Intronic
914684609 1:149967430-149967452 CCTCCAATGGTGGGGGTGGGGGG - Exonic
915326421 1:155083297-155083319 CCTCCAGTGGTGAGGGTGCCAGG - Intronic
917307297 1:173639663-173639685 CCTCCAAGGGGGAGGGATCCAGG + Intronic
920216077 1:204362284-204362306 ACTCCAATGGGGAAGGCGTGAGG + Intronic
920441748 1:205985480-205985502 CCTGGATTGGGGAGGGTCTCGGG - Intronic
921975950 1:221203515-221203537 CCACCAATGGGGTGGGGGGCTGG + Intergenic
924289411 1:242523458-242523480 CCTCCAGAGGGGAGGATTTCTGG + Intronic
924380083 1:243454834-243454856 CCTCCACTGTGGTCGGTGTCTGG + Intronic
1062802303 10:389296-389318 CCACCAATGGGGGGAGTCTCTGG + Intronic
1065115708 10:22480587-22480609 CCACCACGGGGGTGGGTGTCAGG - Intergenic
1068774572 10:60856256-60856278 CCTCCAATGGGAATGGTACCTGG + Intergenic
1069419150 10:68231188-68231210 CCTCCGCGGGGGTGGGTGTCCGG - Exonic
1073127304 10:101159344-101159366 CTTGCAAAGAGGAGGGTGTCTGG + Intergenic
1074289282 10:112126377-112126399 TCTCCAATGGGCAGGGTTTCAGG + Intergenic
1074877022 10:117621639-117621661 CCTCCAATGAGGAAGCTGTAAGG - Intergenic
1076632505 10:131859422-131859444 CCTCCAGTGGGGAGGGCACCAGG + Intergenic
1077783816 11:5360983-5361005 CCTGCAGTGGGGTGGGGGTCGGG + Intronic
1080691820 11:34564825-34564847 CCTCCACTCGGGAGGCTGTGTGG - Intergenic
1085013789 11:73159382-73159404 CCTCCAGGAGGGCGGGTGTCAGG + Intergenic
1085672512 11:78481234-78481256 AATCCAATGGGGAGGGTGAGAGG + Intronic
1086437539 11:86797225-86797247 TCCCCAGTGGGGAGGGGGTCGGG - Intronic
1087497621 11:98910311-98910333 CCTCCAGTGGGGACTCTGTCTGG - Intergenic
1087733708 11:101808012-101808034 CCTCCAATGGGAAGTGAGTTGGG - Intronic
1091799090 12:3313561-3313583 CCCCCAAGGGACAGGGTGTCAGG + Intergenic
1095900687 12:47325239-47325261 CCTACAACGGGGAGGGGGTGGGG - Intergenic
1097998115 12:65912506-65912528 CCTCCAATCTGTAGAGTGTCAGG + Intronic
1100097175 12:91054939-91054961 ACTCCAATTAGGAGGGTTTCAGG + Intronic
1102510198 12:113410078-113410100 GCTCCACTGGGGAGGGAGCCTGG - Intronic
1102603489 12:114051210-114051232 ACTCCAATGGGGAGGATACCAGG - Intergenic
1104675148 12:130707354-130707376 CCTCCCATGGGGAGGGAGGGAGG + Intronic
1108825432 13:54407655-54407677 TCTCCAATGGGGAGGGTGGAGGG - Intergenic
1109951336 13:69504651-69504673 CCTCCAATGAGGCAGTTGTCAGG - Intergenic
1112676706 13:101710169-101710191 CCTTCAATGGGTAGGGAGTTTGG + Intronic
1112752014 13:102592661-102592683 CCTCAAATGGGGCAGGTGACAGG + Intergenic
1114298242 14:21349992-21350014 CCACTAATGGGGTGTGTGTCTGG - Intronic
1114418543 14:22560160-22560182 CCAGCCATGGGGAGTGTGTCTGG - Intergenic
1116146148 14:41071771-41071793 CCTGCAAAGGGGAGGGAGACTGG + Intergenic
1117176278 14:53150293-53150315 CATCCAAGGGTGAGGGTATCAGG - Intronic
1117474095 14:56076582-56076604 CCTGCAATGGGGTGGGTTTCAGG - Intergenic
1122061449 14:99139209-99139231 CCTGCAATGGGGAGGTGGTGAGG - Intergenic
1123124983 14:105940141-105940163 CCTCCCATGGGGTCAGTGTCAGG - Intergenic
1126908994 15:53398895-53398917 CCTCAAAAGGGGAAGGTGCCTGG + Intergenic
1129385214 15:75192513-75192535 GCTCCCCTGGGGAGGGTTTCAGG - Intergenic
1132642147 16:982786-982808 CCACCCATGGGGAGGGAGTGCGG + Intronic
1132662237 16:1066643-1066665 CCTCCAGGGGCTAGGGTGTCTGG - Intergenic
1132864146 16:2085375-2085397 CCTGCAGTGGGTAGGGAGTCTGG + Intronic
1133023015 16:2975155-2975177 CCTCCAGTGGAGAGCGTCTCTGG - Intronic
1135288140 16:21211623-21211645 CCCCCAATGGGGAGAGGGTGTGG - Exonic
1139397194 16:66649727-66649749 CCCCCCATGAGGAGGGAGTCGGG - Intronic
1139505257 16:67395319-67395341 CCTCCAGTGGGGAGGGATTTGGG - Intronic
1140925387 16:79577577-79577599 CCTCCAAAGGGCAGGGCTTCGGG + Intergenic
1142157676 16:88540028-88540050 CCTCCAAGGAGGAGGGGGTTGGG - Intergenic
1143594462 17:7906191-7906213 CCTCCCCTGGGGAGGATGCCTGG - Intronic
1145974746 17:28977639-28977661 GCTCCATTGTGGAGGGTGCCAGG + Intronic
1146164711 17:30578566-30578588 CCTGCAGTGGGGAGGGTCTCAGG - Intergenic
1146798801 17:35801944-35801966 CCTCCACTGGGGTGGGAGTGGGG + Intronic
1147197506 17:38777377-38777399 CCTACAATGGAGAGGGCATCTGG - Intronic
1150007222 17:61477236-61477258 CCTTCAATGGGGAGGGCGTCTGG + Intronic
1150483439 17:65528102-65528124 CCCAGAATGGGGAGGGTGCCTGG + Intergenic
1151439283 17:74117828-74117850 GGTCCAAGGGGGACGGTGTCTGG - Intergenic
1153336414 18:3930527-3930549 CCTGCAATAGGAAGGGTGCCGGG + Intronic
1153432705 18:5036499-5036521 TCTCCACTGGGGATGGGGTCAGG - Intergenic
1154491456 18:14925337-14925359 CCCCCAATGGGAAGTGTGCCAGG - Intergenic
1158395957 18:57078502-57078524 CCTCCAGGGCGTAGGGTGTCAGG - Intergenic
1158566829 18:58561257-58561279 ACTCTACTGGGGAGGGTGTGAGG + Intronic
1158984460 18:62800127-62800149 CACCTAATAGGGAGGGTGTCCGG + Intronic
1160840977 19:1146942-1146964 ACTCCAATGTGCAGGGTGTCTGG + Intronic
1161509425 19:4662411-4662433 CCCCCGGTGGGGAGGGGGTCGGG - Intronic
1161567927 19:5013675-5013697 CCTCCCATGAGGAGGCTGTGAGG + Intronic
1164179351 19:22806340-22806362 CCACCACTGGGGAGGGAGTTTGG - Intergenic
1165006920 19:32814872-32814894 CCTCCCATGGTGAGGGTGGGGGG - Intronic
1165116900 19:33533990-33534012 CCTCCAAGAGAAAGGGTGTCGGG - Intergenic
1165461174 19:35945125-35945147 ACTCTGATGGGGAGGGTGTCGGG + Exonic
1167498924 19:49834913-49834935 TCTGGAATGGGGAGGGGGTCAGG + Intronic
925064485 2:919179-919201 CCTCCCATAGGGATGGAGTCAGG - Intergenic
926273837 2:11388607-11388629 CATCCAATGGGGAAGGTATAAGG + Intergenic
930026976 2:47034852-47034874 CCTGTACTGGGGAGGGTCTCCGG - Intronic
933129495 2:78655226-78655248 CGCCCAGTGGGGAGGGGGTCAGG - Intergenic
937543599 2:122988884-122988906 GCTCCAAGGGGGAGTGTCTCTGG + Intergenic
941453687 2:165691188-165691210 GCTACAATGAGGAGGGTGTGGGG + Intergenic
942073663 2:172337397-172337419 CCACCAAGAGGGAGGGTGTGAGG + Intergenic
943491126 2:188557717-188557739 CCCCCAATGGGGAGTCTGTGTGG + Intronic
946247251 2:218394838-218394860 CAACCAATGGGGAGGGTTTGGGG + Intronic
946765413 2:223035947-223035969 CCTCTGTTGGGAAGGGTGTCTGG + Intergenic
947883896 2:233546955-233546977 CCTCTAATTGGGAAGGTGCCCGG + Intronic
1168906111 20:1405087-1405109 ACTCCAATGGGGATGGCATCAGG + Intergenic
1169847022 20:10005042-10005064 CCTGCCATGGGGAGGGTGAGGGG + Intronic
1172511612 20:35504753-35504775 CCTCCATTGGGGAGGTTTTGTGG - Exonic
1172560879 20:35887400-35887422 ACTCTACTGGGGAGGGTTTCAGG + Intronic
1173360887 20:42343388-42343410 TCTCCAAGGGGCAGGGTGTTGGG - Intronic
1173641778 20:44608092-44608114 CTTGCCTTGGGGAGGGTGTCTGG + Intronic
1174272618 20:49380642-49380664 ACTCCAAGGTGGAGGGTGTGGGG + Intronic
1174842371 20:53912213-53912235 CCTCGGTTGGGGAGGGTGTGGGG + Intergenic
1175793625 20:61757719-61757741 GCTGCCATGTGGAGGGTGTCAGG + Intronic
1178876910 21:36420776-36420798 ACTCCCAAGGGGAGGGTGACAGG - Intergenic
1179792231 21:43762419-43762441 CCTCCAAAGGGGAGGTTTTTAGG - Intergenic
1185021745 22:48380476-48380498 CCGCCAATGGGGAGGTCCTCAGG + Intergenic
951206726 3:19933615-19933637 CCTCCTTTGGGCAGGGTGTGTGG - Exonic
953461546 3:43085247-43085269 CATCAAGTGGGGAGGGTGTGGGG + Intronic
954894372 3:53963450-53963472 CCTTCAAGGGGGCGGGTGTCAGG + Intergenic
956348325 3:68305647-68305669 TCTCCAGTGGGGTGGGGGTCAGG + Intronic
962752516 3:138444266-138444288 CCTCAGATGGGGAGGGTGGAGGG + Intronic
968231548 3:197007615-197007637 CCTCCCTGGGGGAGGGTTTCAGG + Intronic
968556282 4:1247979-1248001 CCTCCAAGGGCGCCGGTGTCTGG - Intronic
968873609 4:3253918-3253940 TCAGCACTGGGGAGGGTGTCGGG + Intronic
969200999 4:5605806-5605828 ACTGCACTGGGGAGGGTGGCGGG + Intronic
969313933 4:6370382-6370404 CTGCAAATGGGGAGGGTGTGGGG - Intronic
969977197 4:11115872-11115894 CCTGAAATGGGGTGGGTGTCAGG + Intergenic
974595730 4:64012671-64012693 CCTCCCATGTGGCGGGTGCCAGG + Intergenic
981908841 4:149954499-149954521 CTGCCTGTGGGGAGGGTGTCAGG - Intergenic
982166063 4:152614562-152614584 CCTGCCCTGGGGAGGGTGTGAGG - Intergenic
984764098 4:183386294-183386316 CCTCCGATGGGCAGCATGTCCGG + Intergenic
985129633 4:186726705-186726727 CCTCCAAGGGGGAGGGAGTGGGG - Intronic
985599185 5:816966-816988 CTTCCCATGGGGAGAGTGTCAGG - Intronic
986990646 5:13549062-13549084 ACTCCATTGGGGATGGTATCTGG - Intergenic
990737305 5:58878370-58878392 CTTCAAATGGGGAGATTGTCTGG + Intergenic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
996830258 5:127732834-127732856 CCTGCAAGGGTGAGGGTGGCAGG + Intergenic
999335779 5:150715152-150715174 CCTCCAAGGGGGTGGGGGTGGGG + Intronic
1001537065 5:172505547-172505569 CCAGCAATGGCAAGGGTGTCTGG - Intergenic
1002946424 6:1765780-1765802 CCTCCATCGGGGAGTGTCTCGGG - Intronic
1006714357 6:36105793-36105815 CCTTAAATGTGGAGGGTGTGGGG - Intronic
1006818039 6:36866868-36866890 ACTCCAATGGGGATGGCATCAGG + Intronic
1007613810 6:43168452-43168474 CATCTATAGGGGAGGGTGTCTGG - Intergenic
1010406145 6:75508044-75508066 CGTCAAAGGGTGAGGGTGTCAGG + Intergenic
1010812718 6:80318111-80318133 GCTACAATGGGAAGGGTGTTGGG - Intronic
1015908145 6:138138624-138138646 CCTCAAATGGGAAGAGTGTTGGG + Intergenic
1018103777 6:160464581-160464603 CCTCCACTGGGTCGGGTTTCTGG - Intergenic
1018660300 6:166079674-166079696 GCTCCAATGGGGTGGTTGTATGG - Intergenic
1023856713 7:44188658-44188680 CCTCCACTGGGGAGGGGCTCTGG - Intronic
1023856952 7:44189829-44189851 CCTCCACTGTGGAGGGTCTCTGG - Intronic
1027560472 7:79722225-79722247 TCTCCAAGGGAGAGGGTGTATGG - Intergenic
1029270228 7:99373205-99373227 CCTCCAATGGGGAGGGTGTCGGG + Intronic
1030687778 7:112504435-112504457 CCTGCACTGGGGAGCGTTTCTGG + Intergenic
1034380673 7:150689380-150689402 TCTCCCATGGGGAGGGTATAGGG - Intronic
1034718017 7:153261774-153261796 GCTCCCATGGGGAGGGTAACTGG - Intergenic
1035019349 7:155791508-155791530 CCCCCAAAAGGGAGGGTGTTTGG + Intergenic
1036164777 8:6422491-6422513 CCTACAATGGGGATGGTCACTGG + Intronic
1036200934 8:6771219-6771241 CCTCCCATGGGGTGGGGGACGGG + Intergenic
1038491742 8:27976644-27976666 CATTCAGTGGGAAGGGTGTCTGG + Intronic
1047463671 8:125091977-125091999 ACGGCAATGGGGAGGGTGGCAGG + Intronic
1047678642 8:127230798-127230820 CCTACAATGGGGGTGGTTTCTGG - Intergenic
1056969668 9:91191745-91191767 CCTCCAAAGGGTACGGAGTCTGG + Intergenic
1057474587 9:95387894-95387916 CCACCAATGGTGGGGGTGTGTGG + Intergenic
1059374636 9:113872698-113872720 GCTTCAAGGGGGAGGGTGTGTGG - Intergenic
1059737267 9:117114877-117114899 GCTCCAATGGGGATGTTGACTGG - Intronic
1187428349 X:19199015-19199037 CCTCCCATGAGGAGGGTCACTGG + Intergenic
1191722799 X:64248731-64248753 GCTGTAATGGGGAGGGTGTGTGG + Intergenic
1192429733 X:71103727-71103749 CCTCCCAAGGGGAGGTAGTCTGG + Intergenic
1193531140 X:82656107-82656129 CATCCAATTGGTGGGGTGTCTGG - Intergenic
1197765396 X:130056737-130056759 CCCCCACTGGGGAGGGGGTGAGG + Exonic
1200920785 Y:8611091-8611113 CCTCCAATTGGGAGCTTGCCAGG - Intergenic
1201038484 Y:9806180-9806202 CCTCAAATGGGAAGTGTGCCAGG - Intergenic