ID: 1029270432

View in Genome Browser
Species Human (GRCh38)
Location 7:99374268-99374290
Sequence GCCCACCGGCATCAGCGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 59}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029270426_1029270432 1 Left 1029270426 7:99374244-99374266 CCGCCCAGGGCCTGCACAGTTGG 0: 1
1: 0
2: 1
3: 16
4: 214
Right 1029270432 7:99374268-99374290 GCCCACCGGCATCAGCGTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 59
1029270422_1029270432 12 Left 1029270422 7:99374233-99374255 CCGCCTGCTCCCCGCCCAGGGCC 0: 1
1: 0
2: 8
3: 133
4: 972
Right 1029270432 7:99374268-99374290 GCCCACCGGCATCAGCGTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 59
1029270430_1029270432 -9 Left 1029270430 7:99374254-99374276 CCTGCACAGTTGGCGCCCACCGG 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1029270432 7:99374268-99374290 GCCCACCGGCATCAGCGTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 59
1029270419_1029270432 17 Left 1029270419 7:99374228-99374250 CCGGACCGCCTGCTCCCCGCCCA 0: 1
1: 0
2: 3
3: 39
4: 445
Right 1029270432 7:99374268-99374290 GCCCACCGGCATCAGCGTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 59
1029270423_1029270432 9 Left 1029270423 7:99374236-99374258 CCTGCTCCCCGCCCAGGGCCTGC 0: 1
1: 0
2: 8
3: 103
4: 931
Right 1029270432 7:99374268-99374290 GCCCACCGGCATCAGCGTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 59
1029270428_1029270432 -2 Left 1029270428 7:99374247-99374269 CCCAGGGCCTGCACAGTTGGCGC 0: 1
1: 0
2: 1
3: 7
4: 102
Right 1029270432 7:99374268-99374290 GCCCACCGGCATCAGCGTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 59
1029270429_1029270432 -3 Left 1029270429 7:99374248-99374270 CCAGGGCCTGCACAGTTGGCGCC 0: 1
1: 0
2: 1
3: 14
4: 158
Right 1029270432 7:99374268-99374290 GCCCACCGGCATCAGCGTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 59
1029270416_1029270432 28 Left 1029270416 7:99374217-99374239 CCTGGCCACGCCCGGACCGCCTG 0: 1
1: 0
2: 0
3: 14
4: 186
Right 1029270432 7:99374268-99374290 GCCCACCGGCATCAGCGTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 59
1029270424_1029270432 3 Left 1029270424 7:99374242-99374264 CCCCGCCCAGGGCCTGCACAGTT 0: 1
1: 0
2: 0
3: 19
4: 224
Right 1029270432 7:99374268-99374290 GCCCACCGGCATCAGCGTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 59
1029270425_1029270432 2 Left 1029270425 7:99374243-99374265 CCCGCCCAGGGCCTGCACAGTTG 0: 1
1: 0
2: 4
3: 29
4: 291
Right 1029270432 7:99374268-99374290 GCCCACCGGCATCAGCGTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 59
1029270417_1029270432 23 Left 1029270417 7:99374222-99374244 CCACGCCCGGACCGCCTGCTCCC 0: 1
1: 1
2: 3
3: 42
4: 459
Right 1029270432 7:99374268-99374290 GCCCACCGGCATCAGCGTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 59
1029270415_1029270432 29 Left 1029270415 7:99374216-99374238 CCCTGGCCACGCCCGGACCGCCT 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1029270432 7:99374268-99374290 GCCCACCGGCATCAGCGTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 59
1029270418_1029270432 18 Left 1029270418 7:99374227-99374249 CCCGGACCGCCTGCTCCCCGCCC 0: 1
1: 1
2: 5
3: 57
4: 553
Right 1029270432 7:99374268-99374290 GCCCACCGGCATCAGCGTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029270432 Original CRISPR GCCCACCGGCATCAGCGTGA AGG Intronic
907520557 1:55020775-55020797 GGCCACCTGCATCAGAGTGGTGG - Intergenic
908508234 1:64827364-64827386 GCCCAGGGGCATGAGGGTGAGGG + Intronic
911030113 1:93478542-93478564 GCACAGTGGCATCAGCTTGATGG + Intronic
920013120 1:202884678-202884700 GCCCACAGGCAGACGCGTGACGG + Intronic
920030511 1:203034764-203034786 CCCCACCCTCATCAGGGTGATGG - Intronic
1072003556 10:91220778-91220800 GCGCGCCGGCCTCAGAGTGAAGG - Intronic
1081044031 11:38250031-38250053 GGGCACCTGCATCAGGGTGAAGG + Intergenic
1083682572 11:64358258-64358280 TCCCACCGGCCTCAGGGTGTGGG + Intergenic
1095971692 12:47905738-47905760 GCCCCGTGGCATCGGCGTGAGGG + Intronic
1100981185 12:100164037-100164059 GCCCAGCGGCAGCAGGGTGAGGG - Intergenic
1106675454 13:31953210-31953232 GCCCACGGGCACCAGCTTGGAGG - Intergenic
1121742811 14:96266077-96266099 GCCCGCCACCATCAGGGTGAGGG + Intronic
1122648041 14:103207791-103207813 GCCCACCAGCACCAGCAGGACGG - Intergenic
1122658642 14:103279525-103279547 GCCCACCAGCACCCGCGGGACGG - Intergenic
1134522764 16:14926128-14926150 GCCCAGCACCGTCAGCGTGAAGG - Intronic
1134549864 16:15133928-15133950 GCCCAGCACCGTCAGCGTGAAGG + Intronic
1134710434 16:16324779-16324801 GCCCAGCACCGTCAGCGTGAAGG - Intergenic
1134718605 16:16369067-16369089 GCCCAGCACCGTCAGCGTGAAGG - Intergenic
1134949170 16:18343866-18343888 GCCCAGCACCGTCAGCGTGAAGG + Intergenic
1134956148 16:18383092-18383114 GCCCAGCACCGTCAGCGTGAAGG + Intergenic
1136651552 16:31677475-31677497 GCCCACAGGCATCAGAAAGATGG - Intergenic
1142175392 16:88642829-88642851 GCCCCCCAGCATCAGTGTGGGGG + Intergenic
1143702600 17:8672425-8672447 TCCCACAGGCATCAGGGTGGTGG - Intergenic
1152176107 17:78788635-78788657 GCCCACCCGCATCTGCTAGAAGG + Intronic
1155958657 18:31975371-31975393 GCACACCAGCATCAGCCTGGGGG - Intergenic
1160048867 18:75413097-75413119 GCCCAGGAGCATCAGCGTGGAGG - Intronic
1160192249 18:76723827-76723849 TCCCACTGGCATCAGGGTGGAGG - Intergenic
1160455130 18:78994291-78994313 GCCCTCCGGCAGCGGCGTGTTGG - Exonic
1162950776 19:14071083-14071105 GCCCACGGGCATCAGCTTGGAGG - Intergenic
1163732195 19:18955577-18955599 GCCCAGCAGCACCAGTGTGAGGG + Intergenic
1167253974 19:48416091-48416113 GGAGACCGGCATCAGCGTCATGG + Exonic
1168339415 19:55614839-55614861 GCCCTGCGGCATCTGCGGGAAGG + Exonic
926128495 2:10286139-10286161 GCCCAGGGGCAGCAGCGGGAGGG + Intergenic
927572189 2:24169440-24169462 GCTCACAGGAATCAGGGTGAAGG + Exonic
933705076 2:85283649-85283671 CCCCATCTGCTTCAGCGTGATGG - Intronic
937225999 2:120369106-120369128 GCCCAAAGGCTTCAGGGTGAGGG - Intergenic
938390007 2:130897511-130897533 GCCAACCTGGAGCAGCGTGAGGG + Intronic
1170647960 20:18213468-18213490 GCCCACAGGGATCACCATGAAGG - Intergenic
1172684805 20:36745801-36745823 GCCCGCCGGCGACAGCGTGTGGG - Intronic
1180748802 22:18110709-18110731 GCCCCCCGGCATCACAGTGCCGG - Intronic
1184242901 22:43220784-43220806 CTCCACCTGCAGCAGCGTGATGG - Intronic
954439264 3:50512656-50512678 GACCCCAGGCCTCAGCGTGATGG - Intergenic
961457164 3:127029984-127030006 GACCACCTGGACCAGCGTGAGGG + Exonic
966935931 3:184709437-184709459 GCCCACCACCTTCTGCGTGAGGG - Intergenic
968509294 4:988305-988327 GGCCACCTGCACCAGCGTCAGGG - Exonic
989480528 5:41925482-41925504 GCTCACCGGCAGCCGCGTCAGGG - Exonic
1002193073 5:177488960-177488982 ACCCCCCAGCATCAGCGTGCCGG - Intronic
1006341156 6:33447836-33447858 CTCCACCAGCATCAGCCTGAAGG - Exonic
1008819001 6:55608795-55608817 GCCAACTAGCAGCAGCGTGATGG + Intergenic
1012161135 6:95887399-95887421 GAGCACCGGAATCAGCTTGAAGG - Intergenic
1019903774 7:4044852-4044874 GCCCACATTCACCAGCGTGACGG + Intronic
1023370221 7:39505675-39505697 CCCCACTGGCAGCAGAGTGAGGG + Intergenic
1029270432 7:99374268-99374290 GCCCACCGGCATCAGCGTGAAGG + Intronic
1035665435 8:1376647-1376669 TCCCACCGGGGTCAGAGTGAGGG - Intergenic
1038238519 8:25785411-25785433 GCCCTCCTGCATCAGCCTCACGG + Intergenic
1039129576 8:34247850-34247872 GCCTACCAGCATCAGAGTCAGGG + Intergenic
1049360023 8:142208032-142208054 GGCCACCTGCTTCAGGGTGATGG - Intergenic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1062447007 9:136599340-136599362 TCCTGCTGGCATCAGCGTGAAGG - Intergenic
1062678674 9:137763962-137763984 GCCAACAGGCACCAGGGTGAGGG - Intronic
1186639680 X:11442209-11442231 CCCCACCGGCATCAATGAGAGGG + Intronic
1192988652 X:76427902-76427924 GCCCACCGGCGTTGGCGTGTAGG - Exonic