ID: 1029272961

View in Genome Browser
Species Human (GRCh38)
Location 7:99387930-99387952
Sequence TACAGCTTCCACCTGGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029272958_1029272961 -10 Left 1029272958 7:99387917-99387939 CCTGCTGGGCAGATACAGCTTCC 0: 1
1: 0
2: 4
3: 16
4: 168
Right 1029272961 7:99387930-99387952 TACAGCTTCCACCTGGATGGTGG 0: 1
1: 0
2: 0
3: 5
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029272961 Original CRISPR TACAGCTTCCACCTGGATGG TGG Intronic
900487229 1:2928874-2928896 TGCTGCTTCCACCGGGATGCGGG + Intergenic
901171623 1:7262580-7262602 TATAGCTTCCACCTAAAAGGTGG + Intronic
901294077 1:8147128-8147150 AACAGCTTGAACCTGGAAGGCGG + Intergenic
901704192 1:11061002-11061024 TGCAGCCTCCACCTGGAGGTGGG + Intergenic
904378712 1:30097181-30097203 TACAGCATCGACCTGCAGGGTGG - Intergenic
904663469 1:32102367-32102389 GAAATCTTCCTCCTGGATGGGGG - Intronic
904883273 1:33716462-33716484 CACACCTTCCACCTGGAAAGTGG - Exonic
905914969 1:41678415-41678437 TACAGCCTCCTCCTTGTTGGTGG - Intronic
906724938 1:48037291-48037313 TCCAACTTCTACCTGCATGGAGG + Intergenic
907832368 1:58077320-58077342 TCCAGCTTTCCCCTGCATGGCGG + Intronic
910621354 1:89259453-89259475 TGCAGCTTTCAACTGGGTGGAGG - Intronic
912209826 1:107545496-107545518 TAAATATACCACCTGGATGGAGG - Intergenic
912799298 1:112711187-112711209 TCCAGCTTCCACCTTGCTGCGGG + Intronic
918789282 1:188805381-188805403 TATTGCTTGAACCTGGATGGCGG - Intergenic
920079285 1:203360639-203360661 TCCAGCTTCCCGCTGGATCGTGG + Intergenic
920102947 1:203529359-203529381 TACAGCATCCTACTGCATGGGGG - Intergenic
922338129 1:224634203-224634225 CACAGCATCCACTTGGATGAGGG + Intronic
1062925359 10:1312251-1312273 TGCAGCTTCCACCAGGGTGTGGG + Intronic
1072266440 10:93732867-93732889 TACAGCTTTTACGTGGATGCAGG - Intergenic
1073997277 10:109329907-109329929 TAAATCTTCTTCCTGGATGGTGG - Intergenic
1074039034 10:109769866-109769888 TACAGCTTCCCACTGAATGTGGG - Intergenic
1076077283 10:127544492-127544514 TCCAGCTTCCATCTGCCTGGGGG + Intergenic
1077564575 11:3289366-3289388 TCCAGCCTCCACTTGAATGGAGG - Intergenic
1077570464 11:3335183-3335205 TCCAGCCTCCACTTGAATGGAGG - Intergenic
1082775430 11:57240998-57241020 TACAGCTGGCTCCTGGTTGGAGG - Intergenic
1084123487 11:67083251-67083273 TATGACTTCCTCCTGGATGGTGG - Intergenic
1085519227 11:77128426-77128448 TACAGCTGCCACCTGCACGGAGG - Exonic
1091048166 11:132343982-132344004 TCCAGCTTCCCCGTGGCTGGAGG + Intergenic
1091705187 12:2688760-2688782 TACCGCTTCCACCAGGCTGCTGG - Exonic
1096567944 12:52496736-52496758 GACAGCTCCCACCTGAAGGGAGG - Intergenic
1098235600 12:68415229-68415251 TACAGTTTCCACCTGGCTAAGGG + Intergenic
1100919086 12:99462274-99462296 AGCAGCTTGCACCTGGAAGGGGG - Intronic
1102168152 12:110822321-110822343 TGCAGCTGGCATCTGGATGGGGG + Intergenic
1102199632 12:111048433-111048455 CACAGCTCCCACCTTGCTGGGGG - Intronic
1104753461 12:131254438-131254460 TCCAGGTTCCACCTGGAGTGAGG - Intergenic
1110740926 13:78995639-78995661 TTCAGCTTCCTGCTGGTTGGTGG - Intergenic
1111353807 13:87070440-87070462 AATAGCTTCAACCTGGAAGGAGG - Intergenic
1111454127 13:88456868-88456890 AACAGCTTGAACCTGGGTGGTGG + Intergenic
1116510939 14:45746129-45746151 AACAGCTTGCACCTGGGAGGTGG - Intergenic
1116954720 14:50912108-50912130 TGCTGCTTCCACCTGCAAGGGGG + Intronic
1122597267 14:102902345-102902367 GACCCCTCCCACCTGGATGGTGG - Intronic
1122782961 14:104151355-104151377 TACAGCTCAGACCTGGGTGGGGG + Intronic
1124250942 15:28106391-28106413 TACAGCCTCCTCCTGGGTGAGGG - Intergenic
1129884707 15:79030174-79030196 CACAGCTCCCAGCTGGGTGGAGG - Intronic
1132010067 15:98267713-98267735 TGGGGCCTCCACCTGGATGGGGG + Intergenic
1133059402 16:3164664-3164686 TACAAATTCCACCTGACTGGAGG + Intergenic
1133555098 16:6898313-6898335 CATAGCTTCCCCTTGGATGGAGG + Intronic
1137473991 16:48790787-48790809 TAGAGTTTCCTCCTGGATAGAGG - Intergenic
1137866511 16:51902580-51902602 TACAGCTTCTGCCTGGATCATGG + Intergenic
1140460285 16:75134083-75134105 TAAAAATTCCACCTGGATTGGGG + Intergenic
1141634715 16:85308038-85308060 GACAGCTTCCACCAGGCAGGAGG + Intergenic
1141825703 16:86478329-86478351 CACAGCTGCCACCAAGATGGAGG + Intergenic
1144929589 17:18848567-18848589 CTCGGCTTCCTCCTGGATGGTGG + Intronic
1147305150 17:39558302-39558324 TTCAGCTTCATCCAGGATGGAGG + Intronic
1148571623 17:48674465-48674487 AACTGCTTGAACCTGGATGGTGG + Intergenic
1149679047 17:58491656-58491678 TACAGCTTCCAGTTGAATGCCGG - Exonic
1150104977 17:62455987-62456009 AATAGCTTCAACCTGGAAGGTGG + Intergenic
1158878050 18:61751873-61751895 AGCAGCTTCCACCTGGAGGAGGG + Intergenic
1161954548 19:7485989-7486011 TACTGCTGCCAGCTGGTTGGTGG - Exonic
1162479423 19:10920019-10920041 TGCAGCTGCAACCTGGCTGGGGG + Intronic
1164061937 19:21683210-21683232 TACACCTTCCTCCTTAATGGAGG - Intergenic
1165831134 19:38730996-38731018 TGCAGCCAGCACCTGGATGGGGG - Exonic
1167095624 19:47373588-47373610 TTCAGATTTCACCTGGGTGGAGG - Exonic
925718059 2:6803087-6803109 CACCCCTTCCACCTGGCTGGTGG + Intergenic
926854140 2:17233951-17233973 TACAGCTACAACCCTGATGGTGG - Intergenic
927371338 2:22358645-22358667 TACAGCTTACCCCTGGAAAGGGG + Intergenic
936802881 2:116288155-116288177 TACAACTTCCTGCTGGATAGGGG - Intergenic
941003181 2:160222082-160222104 TCCAGCTGACACCTGGAAGGTGG + Intronic
942248299 2:174026626-174026648 TAAAGCTTCCACCAGGCTGGAGG - Intergenic
942787711 2:179719352-179719374 TACACCTTTCACCTGGGTGCAGG - Intronic
943799931 2:192045155-192045177 TACAGCTACCACCTGAAAGTGGG + Intronic
1169968003 20:11238574-11238596 TAGAGATTCCACTTGGATTGTGG - Intergenic
1172013434 20:31859734-31859756 TACAGCCTCCGCCTCCATGGAGG + Intronic
1172484286 20:35288947-35288969 CACAGCCACCACCTGGGTGGGGG + Exonic
1173936776 20:46873375-46873397 TATATCTTCCAACTGGATGAAGG + Intergenic
1174340429 20:49891769-49891791 CCCTGCTTCCACCTGCATGGTGG + Exonic
1175721966 20:61293090-61293112 TGCAGCTCCCATCAGGATGGTGG + Intronic
1177003991 21:15648268-15648290 TACAGCTACTACCTCTATGGAGG + Intergenic
1177763660 21:25432450-25432472 CACAGCTTCCACATGGAAGATGG + Intergenic
1180220036 21:46352729-46352751 GACAGCTGACACCTGGATGTGGG - Intronic
1181617346 22:24064096-24064118 CCCTGCCTCCACCTGGATGGCGG - Exonic
1182034123 22:27184110-27184132 GACAGATTCCACCTTGATGGTGG - Intergenic
1182557689 22:31137982-31138004 TACATCCTACACCTGGGTGGTGG + Exonic
1183305683 22:37081887-37081909 GACAGCTTCCAACAGGGTGGAGG - Intronic
1184335829 22:43852545-43852567 GGCAGTTCCCACCTGGATGGGGG - Intronic
1184657308 22:45948298-45948320 CACAGCTGGCACCTGGAGGGAGG + Intronic
1184831003 22:46987099-46987121 TGCAGCTTCCACCTTGTTTGAGG - Intronic
1185033077 22:48455450-48455472 TACAGGTTGCTTCTGGATGGTGG - Intergenic
950758279 3:15196376-15196398 TACAGCTTCTACGTGGCTGATGG - Intergenic
951630213 3:24711931-24711953 TTCAGCTTTGACCAGGATGGAGG - Intergenic
955811759 3:62798349-62798371 TACAGCTTCCTGCTGGAAGGAGG - Intronic
964250684 3:154712976-154712998 CACAGCATCCACCTGGAGAGAGG + Intergenic
966147304 3:176826502-176826524 TAGAGCTTCCAGATGGAGGGTGG - Intergenic
967824444 3:193867440-193867462 TGCAGCCTGCACCTGGAAGGAGG - Intergenic
970102262 4:12538141-12538163 TACAGCTCCCACGTAGATGTGGG + Intergenic
972571346 4:40313016-40313038 GCCAGCTTTCACTTGGATGGTGG - Intergenic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
973778653 4:54267579-54267601 GACAGCTTCCAACTGGCTGAAGG - Exonic
974282283 4:59813021-59813043 TAATGCTTCTACCTGGAAGGGGG + Intergenic
977292892 4:95182315-95182337 TACACTTTCCTCCGGGATGGGGG - Intronic
979959439 4:126999527-126999549 TTAAGCTGCCACCTGGATGCAGG + Intergenic
983222166 4:165053815-165053837 ACCAGCTTCCACCTGGAAGTGGG - Intergenic
984818781 4:183861901-183861923 TCTAGTTACCACCTGGATGGTGG - Intronic
992601242 5:78402963-78402985 AACAGCTTGAACCTGGAAGGCGG - Intronic
994496256 5:100517281-100517303 TACTGCTTGCACCTGCATGTAGG + Intergenic
995113096 5:108449234-108449256 TCCAGCTTCCACATGTATGCAGG - Intergenic
995252630 5:110011853-110011875 TATAGCTCCCACCTGGACAGTGG + Intergenic
996541007 5:124630011-124630033 TAGAACTTCCAGCTGGGTGGGGG - Intergenic
997444433 5:133931147-133931169 TAGTGCTTCCTCCTGGGTGGTGG + Intergenic
998900258 5:146845591-146845613 TTCAGCTTACACCTTTATGGAGG - Intronic
1000163781 5:158627207-158627229 AACACCTTGCACCTGGATGCAGG + Intergenic
1001325306 5:170719595-170719617 TACAGACTGCACCTGGAGGGAGG - Intronic
1002575184 5:180170306-180170328 TGCAGCTGCCTCCTGGCTGGCGG - Intronic
1003238166 6:4317126-4317148 TACAGCCTCCAGCAGGGTGGGGG - Intergenic
1007198015 6:40079869-40079891 TACAGCTGCCATGAGGATGGTGG + Intergenic
1010509562 6:76701932-76701954 AACAGCTTGCCCCTGGCTGGTGG + Intergenic
1013470351 6:110458460-110458482 TTCAGCTTCCAACTGGCTGTAGG - Intronic
1014180906 6:118383279-118383301 TAAAGCAACCACCTGGCTGGTGG - Intergenic
1015728770 6:136326606-136326628 TACAGCTAGCATCAGGATGGGGG + Intergenic
1018206517 6:161441798-161441820 TGCAGCTGCCACCTGCCTGGGGG + Intronic
1020280980 7:6649837-6649859 TACAGATCCCACTGGGATGGGGG + Intronic
1022108717 7:27214620-27214642 TACAGCTTGCACCTTCACGGGGG - Intergenic
1022977777 7:35574862-35574884 ACCAGCTTCCGCCTGGCTGGAGG - Intergenic
1026970164 7:74462884-74462906 TCCAGAGCCCACCTGGATGGCGG - Intronic
1029170762 7:98627714-98627736 TCCAGCTTCCATCTGGGAGGAGG + Intronic
1029272961 7:99387930-99387952 TACAGCTTCCACCTGGATGGTGG + Intronic
1030123820 7:106135821-106135843 AACAGCTTACACCTGCAAGGAGG - Intergenic
1032034146 7:128509200-128509222 AACAGCTTCAACCTGGAAGGTGG + Intergenic
1033732484 7:144193658-144193680 TACAGCTTTCACTGGCATGGTGG - Intronic
1033743335 7:144292238-144292260 TACAGCTTTCACTGGCATGGTGG - Intergenic
1033750566 7:144357359-144357381 TACAGCTTTCACTGGCATGGTGG + Intronic
1034086355 7:148326280-148326302 TCCAGCTTCCCTCTGGATGATGG - Intronic
1035313831 7:157986059-157986081 TCCTGCTTCCAGATGGATGGAGG + Intronic
1036617360 8:10398948-10398970 TGCAGCTTCCACTTGAGTGGAGG + Intronic
1037592606 8:20325518-20325540 AACCTCTTCCACATGGATGGGGG - Intergenic
1038532440 8:28329266-28329288 GACAGCTTCGACCTGGAGGTAGG + Exonic
1039100780 8:33939913-33939935 CTCAGCTTCCACCTGCATAGAGG - Intergenic
1055017895 9:71638849-71638871 TACAGCTTGTGCCTGGGTGGGGG - Intergenic
1055566598 9:77575293-77575315 AACAGCTTGAACCTGGAAGGCGG + Intronic
1056742268 9:89267744-89267766 TGCAGCTTCCACCTGGGTTCAGG + Intergenic
1056913493 9:90725108-90725130 TACAGCGTGAACCTGGTTGGAGG - Intergenic
1057480184 9:95439206-95439228 CACAGCTTCCACTTACATGGCGG - Intergenic
1059342628 9:113607361-113607383 AACAGCTTGAACCTGGAAGGCGG + Intergenic
1059906838 9:118996261-118996283 AGCTGCTTCCACATGGATGGGGG + Intergenic
1187564251 X:20432827-20432849 TAAATCTTCCACCTAGATGTTGG - Intergenic
1189198519 X:39171840-39171862 TACAGCTTCCACCTGGTCACTGG + Intergenic
1189281097 X:39820705-39820727 CACAGGTACCACCTGGGTGGTGG - Intergenic
1191114935 X:56842259-56842281 TACAGCTTCCAGCATGAGGGAGG - Intergenic
1198473345 X:136971078-136971100 AATAGCTTCAACCTGGAAGGTGG - Intergenic