ID: 1029273090

View in Genome Browser
Species Human (GRCh38)
Location 7:99388527-99388549
Sequence CAGCTCCGTGGACTGGGCAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 143}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029273081_1029273090 18 Left 1029273081 7:99388486-99388508 CCTCACTAAGCCCTGCACACACA 0: 1
1: 0
2: 2
3: 47
4: 527
Right 1029273090 7:99388527-99388549 CAGCTCCGTGGACTGGGCATCGG 0: 1
1: 0
2: 1
3: 9
4: 143
1029273082_1029273090 8 Left 1029273082 7:99388496-99388518 CCCTGCACACACATTAGTCCTGA 0: 1
1: 0
2: 1
3: 7
4: 143
Right 1029273090 7:99388527-99388549 CAGCTCCGTGGACTGGGCATCGG 0: 1
1: 0
2: 1
3: 9
4: 143
1029273084_1029273090 -10 Left 1029273084 7:99388514-99388536 CCTGACTTCCCTGCAGCTCCGTG 0: 1
1: 0
2: 3
3: 25
4: 283
Right 1029273090 7:99388527-99388549 CAGCTCCGTGGACTGGGCATCGG 0: 1
1: 0
2: 1
3: 9
4: 143
1029273083_1029273090 7 Left 1029273083 7:99388497-99388519 CCTGCACACACATTAGTCCTGAC 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1029273090 7:99388527-99388549 CAGCTCCGTGGACTGGGCATCGG 0: 1
1: 0
2: 1
3: 9
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029273090 Original CRISPR CAGCTCCGTGGACTGGGCAT CGG Intronic
900310108 1:2029425-2029447 CTGCTCCCTGGGGTGGGCATGGG + Intronic
900477240 1:2881723-2881745 CAGACCCCAGGACTGGGCATGGG + Intergenic
900584661 1:3426843-3426865 CAGGGCTGTGGTCTGGGCATGGG + Intronic
901511976 1:9722039-9722061 CAGCTCCTTGGTCTGGGGCTTGG - Exonic
903432589 1:23318453-23318475 CAGTTGCTTGGAATGGGCATAGG - Intronic
905883080 1:41477017-41477039 CAGCTGCCTGGCCTGGCCATGGG + Intergenic
906680189 1:47721012-47721034 CAGCACCTTGGACTAGGCAGTGG + Intergenic
906797190 1:48707666-48707688 AAGCTCCATGGGCTGGGAATTGG + Intronic
907819113 1:57949413-57949435 CTGGTCCGTGGCCTGGGGATTGG + Intronic
910868952 1:91814048-91814070 CAGGTCCGTGGCCTGGGGGTGGG + Intronic
913183571 1:116345903-116345925 CAGGTCTGTGTTCTGGGCATGGG + Intergenic
914260435 1:145994685-145994707 CAGCACCTTGGTCTGGCCATTGG + Exonic
915029278 1:152862232-152862254 CTCCTCCTTGGACTGAGCATAGG - Intergenic
915663044 1:157419572-157419594 CATCTCCGTGGTCTGGGTCTTGG - Intergenic
916194432 1:162210307-162210329 CAGAGCTGTGGGCTGGGCATGGG - Intronic
917778259 1:178362094-178362116 CTGCTCCGTGGCCTGGGGGTTGG + Intronic
917969386 1:180197265-180197287 CAGCCCCGGGCAGTGGGCATAGG + Exonic
1070551213 10:77492038-77492060 CTGCTCCGTTCACTGGGGATGGG + Intronic
1073575450 10:104618944-104618966 CAGCTCCCTGGAATGGAGATTGG + Intergenic
1073740255 10:106398646-106398668 CTGGTCCGTGGCCTGGGGATTGG - Intergenic
1075065826 10:119288272-119288294 AAGGTCTGTGGACAGGGCATAGG + Intronic
1075103890 10:119524553-119524575 CAGCACCGAGGACAGGGCCTGGG - Intronic
1076661439 10:132058346-132058368 CAGCTCCGTAGACCAGGCACAGG + Intergenic
1077333656 11:1994150-1994172 CAGCTCTGTGCACTGGGAATGGG + Intergenic
1082986946 11:59177245-59177267 CATCTCCAGGGCCTGGGCATGGG - Intronic
1082987720 11:59182429-59182451 CAGCACCCGGGACTGGGCAATGG - Exonic
1085727441 11:78966592-78966614 CAGCTCCTTGCACTGGGCTGTGG - Intronic
1090839133 11:130473980-130474002 CTCCTCCCTGGACTGGGCAGAGG + Exonic
1202816637 11_KI270721v1_random:49332-49354 CAGCTCTGTGCACTGGGAATGGG + Intergenic
1092509879 12:9143813-9143835 CAGCTCAGTGGAGAGGACATAGG + Intergenic
1093881923 12:24414531-24414553 CAGCCCCGTGTACTGGTCAAAGG + Intergenic
1102195748 12:111024085-111024107 CAGCTCGGTGGATGGGGCCTGGG + Intergenic
1104429149 12:128702814-128702836 CCACTCCATGGACGGGGCATGGG - Intronic
1104485187 12:129145485-129145507 CAGCTCCGTGCACTCTGCCTGGG + Intronic
1104856187 12:131903539-131903561 CAACTCCCTGAGCTGGGCATCGG - Intronic
1104996586 12:132661652-132661674 CAGCTCCTGGTACTGGTCATTGG + Exonic
1106465881 13:30014126-30014148 CAGCCTCCTGGAATGGGCATGGG + Intergenic
1110317667 13:74129994-74130016 CAGCTCTCTGGGCTGGGCTTGGG + Intronic
1112903915 13:104393789-104393811 CAGCCCTGTGGCCTGGCCATGGG - Intergenic
1115146591 14:30233784-30233806 CAGGTCCGTGCTTTGGGCATGGG - Intergenic
1118309207 14:64680402-64680424 CAGCTCTGTGGCCTGGGCCCTGG + Intergenic
1122238997 14:100349505-100349527 CCGCTGTGTGGCCTGGGCATGGG - Intronic
1122343427 14:101043591-101043613 GTGCTCCGAGGACTGGCCATTGG - Intergenic
1122379468 14:101291480-101291502 CAGCTACGTGGGCTGGAGATAGG - Intergenic
1122648095 14:103207981-103208003 CAGCCTCGTGTGCTGGGCATTGG - Intergenic
1125267198 15:37896733-37896755 AAGATCAGTGGACTGGGTATTGG - Intergenic
1125522191 15:40354488-40354510 CAGCCCCGTGGAGTGGGGGTGGG + Intronic
1130632500 15:85582824-85582846 CAGCTCAGCAGACTGGGCTTGGG - Intronic
1131177559 15:90219676-90219698 CTGCTCCCAGGACTGGGGATGGG - Intronic
1132375475 15:101325739-101325761 CAGCTCCGTGGACAGAGCCCAGG + Intronic
1134190962 16:12121000-12121022 CAGCTCCAGGAACTGAGCATGGG - Intronic
1135239780 16:20793971-20793993 CAGCTCCGGGGGCTTGGCATAGG + Intronic
1136085935 16:27885017-27885039 CAGCTCCGAGGGCTGGTGATTGG - Intronic
1138443703 16:57050253-57050275 CTGCCCCAGGGACTGGGCATGGG - Intronic
1139615105 16:68084270-68084292 TAGCTCCGTGCCCCGGGCATAGG - Intergenic
1140982305 16:80122517-80122539 TAGCTCCCTGTTCTGGGCATCGG - Intergenic
1142621127 17:1166314-1166336 CAGGACCGGGGACTGGGCACTGG - Intronic
1142996717 17:3764805-3764827 CGTCTCCCTGGACTGGGCCTGGG - Intronic
1144512633 17:15890711-15890733 CAGCTCCGTGCACTGGGAGGCGG - Intergenic
1144781484 17:17810479-17810501 TAGCTCCGTGGACTAGGCGGGGG + Exonic
1145123842 17:20284224-20284246 CAGCTCCCTGCACTGGGAAGTGG - Intronic
1147606599 17:41777233-41777255 AAGCAGCATGGACTGGGCATAGG - Intronic
1148213481 17:45821712-45821734 CAGCCGCTTGCACTGGGCATGGG + Intronic
1148386575 17:47238576-47238598 CAGCTCCCTGGGCTGGGCTCTGG + Intergenic
1148535743 17:48437242-48437264 AAGCTCAGTGGACAGGGCATGGG + Intergenic
1148556348 17:48581142-48581164 AAGGTCCCAGGACTGGGCATAGG - Intronic
1149541649 17:57472280-57472302 CCGGTCCCTGGACTGAGCATAGG - Intronic
1150620000 17:66801045-66801067 CAGCTCAGTAGAGTCGGCATTGG - Intronic
1151329466 17:73398349-73398371 CACCTCCATGGAGCGGGCATCGG + Exonic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1152181597 17:78825578-78825600 CAGGTCTGCGGTCTGGGCATTGG - Intronic
1153779880 18:8485137-8485159 CAGCTTTGTGCACTGGGCACTGG + Intergenic
1157813800 18:50716853-50716875 CCGCTCTGTGTACAGGGCATGGG - Intronic
1161854147 19:6753961-6753983 CAGATGCAGGGACTGGGCATAGG + Intronic
1162327899 19:10009564-10009586 CAGCACCATGGACAGGGCTTCGG - Intronic
1163698606 19:18776140-18776162 CAGGTCAGTGGCCTGGGCAGTGG - Intronic
1166090560 19:40506060-40506082 CAGCTCTGTGGCCTGGACCTCGG - Intronic
1166822886 19:45591434-45591456 GAGCTCCGTGGTCTGGGCCACGG - Exonic
1166939337 19:46353378-46353400 CAGCTGGGTGGAGTGGGCAGGGG - Intronic
1168242697 19:55095389-55095411 CAGTTCCCTCGACTGGGCAGGGG + Intronic
1168407842 19:56120312-56120334 CAGCTCCCTGGACTGGGGGTCGG + Intronic
925284278 2:2705731-2705753 CAGGTCCCTGGGCAGGGCATGGG - Intergenic
925924178 2:8658819-8658841 CAGATGCGTGTACTGGGCATGGG + Intergenic
929532322 2:42761021-42761043 CAGCTCCAGGGGCTGGGGATGGG - Intergenic
930096779 2:47571468-47571490 CAGCACCGCGGACAGCGCATCGG + Intergenic
930692363 2:54377725-54377747 CAGCTCCTTGGGCTTGGCGTCGG + Intronic
931542289 2:63342283-63342305 CAGGTCCATGGCCTGGGGATTGG + Intronic
931562565 2:63578537-63578559 CACCTGAGTGGACTGGGAATGGG + Intronic
935183024 2:100706925-100706947 CAGCTCCGAGCGCTGGGCAGGGG + Intergenic
936981890 2:118272310-118272332 CAGCTCCTAGCACTGGTCATTGG + Intergenic
940094856 2:149962810-149962832 CACCTCCCTTGACTGGGAATGGG + Intergenic
947116639 2:226778704-226778726 CACCTATGTGTACTGGGCATTGG - Intronic
1169145863 20:3251999-3252021 TGGCTCTGTGGACTGGGCCTGGG + Exonic
1169535834 20:6538988-6539010 AAACTCTGTGGACCGGGCATGGG - Intergenic
1171376343 20:24696554-24696576 TGGCCCAGTGGACTGGGCATGGG + Intergenic
1171449524 20:25225909-25225931 CAGCCCCGCGGACGGGGCATGGG - Exonic
1173910359 20:46664348-46664370 CAGCTTTGGGGCCTGGGCATTGG + Intronic
1174043724 20:47718147-47718169 CAGGTCTGAGGGCTGGGCATGGG + Intronic
1175670560 20:60899457-60899479 CAGCACCATGGACTGGGGCTGGG - Intergenic
1180696001 22:17751960-17751982 CTGTTCTGTGGACTGGGCAGTGG - Intronic
1183279619 22:36924874-36924896 GAGGTCCATGGACTGGGCCTGGG - Intronic
1183283990 22:36951414-36951436 GAGGTCCATGGACTGGGCCTGGG + Intergenic
1183598164 22:38824680-38824702 CAGCACCCTGGACAGGGCATTGG - Intronic
1184045551 22:41970408-41970430 CTGCTCCGTGGGCTGTGCAAGGG - Intergenic
1184088106 22:42277925-42277947 CAGCTCCTTGTGCTGGGCACTGG - Intronic
1185225110 22:49647746-49647768 CAGCTGTGTGGACTGGGAGTTGG - Intronic
949592651 3:5510247-5510269 CACCTCCCTTGGCTGGGCATTGG - Intergenic
950882483 3:16334551-16334573 CAGCTCAGAGAACTGGGCAATGG + Intronic
954099211 3:48356436-48356458 CAGGTCTGTGGACTGGTCAGAGG + Intergenic
954608975 3:51934272-51934294 CAGCACCCTGGACAGGGCCTAGG + Intronic
956328008 3:68074341-68074363 CTGGTCCGTGGTCTGGGGATTGG + Intronic
963084212 3:141421943-141421965 CAGCACTGTGAACTGGGGATGGG + Intronic
963377948 3:144494180-144494202 AAGGTCCGTGGCCTGGGGATTGG + Intergenic
963537661 3:146548016-146548038 CAGGTCCGTGGCCTGGGGCTTGG + Intergenic
964871606 3:161319255-161319277 CAGGTCAGTGGACTGGGCGGGGG + Intergenic
967743367 3:193027656-193027678 CAACTCCTTGGACAAGGCATGGG - Intergenic
970295672 4:14626869-14626891 CAGCTCCGTGGTCTGTGGAATGG - Intergenic
972635190 4:40877892-40877914 CAGCTCAGGGTACAGGGCATGGG + Intronic
972648473 4:40992731-40992753 CAGCTCCCTGGCCTGGACATCGG - Intronic
982888242 4:160811327-160811349 CATATCTGGGGACTGGGCATGGG + Intergenic
989516136 5:42346333-42346355 AAGCTCAGTGGAGTGGGCAATGG + Intergenic
992209892 5:74468572-74468594 CAGCTCACTGGACAGGGAATGGG + Intergenic
995040664 5:107584417-107584439 CAGCTACCTGGACTGTGCCTTGG - Intronic
997259302 5:132453903-132453925 CAGCACCATGGCCTGGTCATTGG + Intronic
1005938912 6:30546279-30546301 CAGCTCCGTGGTCTCTGGATGGG + Exonic
1013926622 6:115480667-115480689 CACCTCTGTGGGCAGGGCATAGG - Intergenic
1015145093 6:129976628-129976650 CTAGTCCGTGGTCTGGGCATTGG + Intergenic
1015736133 6:136402039-136402061 CAACCCCTTGGACTGGCCATAGG + Intronic
1017985596 6:159440738-159440760 GAGCTCCGAGGAGTGGGGATGGG - Intergenic
1018756312 6:166852672-166852694 CAACTCCGGGAGCTGGGCATTGG + Intronic
1020280469 7:6647651-6647673 CAACTCCGTGGACTCGCCGTGGG + Intronic
1021448667 7:20760540-20760562 CTGGTCCGTGGTCTGGGGATTGG - Intronic
1022508038 7:30918840-30918862 CAGGTCCCTTGACTGGGCCTAGG + Intronic
1022956290 7:35384707-35384729 CAGACATGTGGACTGGGCATAGG - Intergenic
1027234416 7:76289592-76289614 CAGCTCTGGGGACTGGGCCAAGG - Intergenic
1027702539 7:81486299-81486321 CAGCTGTGGGTACTGGGCATGGG - Intergenic
1029273090 7:99388527-99388549 CAGCTCCGTGGACTGGGCATCGG + Intronic
1030257524 7:107527847-107527869 CAGGGCTGTGGCCTGGGCATTGG - Intronic
1031392774 7:121236085-121236107 CAGCTCAGTGGATGGGGCAGAGG + Intronic
1031643912 7:124200257-124200279 CAGTTCCATGGACTGTGCGTGGG - Intergenic
1034424174 7:151005707-151005729 CAGCTCGGTGGTCTGGGAACAGG - Intronic
1034526949 7:151670716-151670738 CAGCTCCGTGCATTATGCATAGG - Intronic
1035629011 8:1094109-1094131 CAGCTCCGTGGAGTGGGCAGGGG + Intergenic
1037284647 8:17286018-17286040 CAGCCCAGTCGACTGGGCAGAGG - Intronic
1037284811 8:17287875-17287897 CAGCCCAGTCGACTGGGCAGAGG - Intronic
1041303165 8:56434230-56434252 CTGGTCCGTGGCCTGGGGATTGG + Intergenic
1045143512 8:99313746-99313768 CACCTCTGGGGACAGGGCATAGG - Intronic
1052225306 9:26078038-26078060 AAGCTCCCTGGACTGGGGAAGGG - Intergenic
1056710810 9:88991090-88991112 CAGGTCCGAGGTCTGGGCTTGGG - Exonic
1057306944 9:93918040-93918062 CAGCTCCGTGGAAAGGACAGTGG + Intergenic
1059258730 9:112955360-112955382 CAGATGCATGGAATGGGCATGGG + Intergenic
1060474363 9:123975844-123975866 CAGCTCTGGGCACTGGGCACTGG + Intergenic
1190318343 X:49165239-49165261 CCGCTCCACGGCCTGGGCATGGG - Exonic
1199783373 X:151082988-151083010 CAGGTCCGTAGTCTGGGCTTGGG - Intergenic