ID: 1029273812

View in Genome Browser
Species Human (GRCh38)
Location 7:99392695-99392717
Sequence TTCACCTATGACGCCGCCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029273806_1029273812 9 Left 1029273806 7:99392663-99392685 CCGCGCAGGGCCACGACTGCTTC 0: 1
1: 0
2: 0
3: 3
4: 108
Right 1029273812 7:99392695-99392717 TTCACCTATGACGCCGCCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 33
1029273804_1029273812 13 Left 1029273804 7:99392659-99392681 CCCTCCGCGCAGGGCCACGACTG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1029273812 7:99392695-99392717 TTCACCTATGACGCCGCCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 33
1029273801_1029273812 18 Left 1029273801 7:99392654-99392676 CCCCGCCCTCCGCGCAGGGCCAC 0: 1
1: 0
2: 4
3: 16
4: 248
Right 1029273812 7:99392695-99392717 TTCACCTATGACGCCGCCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 33
1029273803_1029273812 16 Left 1029273803 7:99392656-99392678 CCGCCCTCCGCGCAGGGCCACGA 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1029273812 7:99392695-99392717 TTCACCTATGACGCCGCCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 33
1029273797_1029273812 26 Left 1029273797 7:99392646-99392668 CCAATGGCCCCCGCCCTCCGCGC 0: 1
1: 0
2: 3
3: 25
4: 312
Right 1029273812 7:99392695-99392717 TTCACCTATGACGCCGCCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 33
1029273805_1029273812 12 Left 1029273805 7:99392660-99392682 CCTCCGCGCAGGGCCACGACTGC 0: 1
1: 0
2: 1
3: 31
4: 371
Right 1029273812 7:99392695-99392717 TTCACCTATGACGCCGCCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 33
1029273802_1029273812 17 Left 1029273802 7:99392655-99392677 CCCGCCCTCCGCGCAGGGCCACG 0: 1
1: 0
2: 1
3: 27
4: 225
Right 1029273812 7:99392695-99392717 TTCACCTATGACGCCGCCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 33
1029273808_1029273812 -1 Left 1029273808 7:99392673-99392695 CCACGACTGCTTCCCGGTGCTGT 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1029273812 7:99392695-99392717 TTCACCTATGACGCCGCCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 33
1029273800_1029273812 19 Left 1029273800 7:99392653-99392675 CCCCCGCCCTCCGCGCAGGGCCA 0: 1
1: 0
2: 2
3: 21
4: 305
Right 1029273812 7:99392695-99392717 TTCACCTATGACGCCGCCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029273812 Original CRISPR TTCACCTATGACGCCGCCGC GGG Exonic
1077008663 11:370444-370466 TTCACCGAAGGCGCCCCCGCCGG - Intronic
1077076583 11:705109-705131 CTCACCTATGGCGCCTCCCCAGG + Intronic
1085691788 11:78670229-78670251 TTCACCTATGACGAGACGGCAGG - Exonic
1087672757 11:101127554-101127576 TCCGCCTCTGCCGCCGCCGCCGG - Exonic
1096445341 12:51685640-51685662 TTTACCTAACACGCCGCAGCTGG + Intronic
1106340281 13:28820390-28820412 TCCACCTGCGCCGCCGCCGCCGG + Exonic
1115083656 14:29487577-29487599 TTCACCTATCACACCTCCACAGG - Intergenic
1133871371 16:9689494-9689516 TTGACCTGTGACGCAGCCTCAGG - Intergenic
1149858098 17:60102717-60102739 TTCCCCTTTGCCGCCGCCGCCGG - Intergenic
1151293115 17:73164793-73164815 TTAACCTTTTACGCCCCCGCAGG + Intergenic
933052583 2:77618115-77618137 TTCACCTGTGACACAGCCTCAGG - Intergenic
935129076 2:100247802-100247824 TTCACCCATGAGACCGCCTCAGG - Intergenic
1174403887 20:50291484-50291506 TTCACCTATGATGGCTCCACTGG - Intergenic
1182120584 22:27783947-27783969 TTCCACGATGATGCCGCCGCAGG + Intronic
1183662482 22:39229837-39229859 TTCACCTGTGCCACCCCCGCCGG - Intronic
954676673 3:52319680-52319702 GTCACCCATGAGGCCGCGGCAGG + Intronic
955424580 3:58775055-58775077 TGCACCCATGACGCAGCCTCAGG + Intronic
968575273 4:1363190-1363212 TTCACCTCTGAGGCAGCCGCAGG - Intronic
980071395 4:128246242-128246264 TGCACCTATGACACAGCCTCAGG + Intergenic
1001591191 5:172866516-172866538 TTCCCCTGTGACGCAGCTGCAGG - Intronic
1015238347 6:130995575-130995597 TGCACCCATGACGCAGCCCCAGG - Intronic
1016494166 6:144641116-144641138 TGCACCTATGACACAGCCTCAGG + Intronic
1021147487 7:17106788-17106810 TGCTCCTATGACACCGCCTCAGG - Intergenic
1023742714 7:43294821-43294843 TGCACCTGTGACGCAGCCTCAGG + Intronic
1024462344 7:49671273-49671295 CTCTCCTATGAAGCCGCCTCTGG + Intergenic
1029273812 7:99392695-99392717 TTCACCTATGACGCCGCCGCGGG + Exonic
1036045937 8:5140449-5140471 TTCCCCAATGAGACCGCCGCGGG - Intergenic
1039373839 8:37013612-37013634 TTCACCCATGACACAGCCTCAGG - Intergenic
1048520115 8:135146085-135146107 TGCACCTATGACACAGCCCCAGG + Intergenic
1189669117 X:43388802-43388824 TGCACCTATGACACAGCCTCAGG + Intergenic
1194507446 X:94750342-94750364 TGCACCTATGACACAGCCTCAGG + Intergenic
1194906129 X:99577836-99577858 TTCACCCATGACACAGCCTCAGG - Intergenic
1195195844 X:102497418-102497440 TGCACCTATGACACAGCCTCAGG - Intergenic
1196884973 X:120235707-120235729 TGCACCTGTGACGCAGCCTCAGG - Intergenic
1198853973 X:140996218-140996240 TGCACCCATGACGCAGCCTCAGG - Intergenic
1198878040 X:141248888-141248910 TGCACCCATGACGCAGCCTCAGG + Intergenic