ID: 1029278825

View in Genome Browser
Species Human (GRCh38)
Location 7:99424038-99424060
Sequence GGCTCCCGGGACCAGCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 1, 2: 1, 3: 32, 4: 210}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029278816_1029278825 8 Left 1029278816 7:99424007-99424029 CCAGCAGCTCCCACCCTCTGTCA 0: 1
1: 0
2: 7
3: 53
4: 414
Right 1029278825 7:99424038-99424060 GGCTCCCGGGACCAGCGGCCAGG 0: 1
1: 1
2: 1
3: 32
4: 210
1029278817_1029278825 -1 Left 1029278817 7:99424016-99424038 CCCACCCTCTGTCAATCAAGCTG 0: 1
1: 0
2: 1
3: 18
4: 199
Right 1029278825 7:99424038-99424060 GGCTCCCGGGACCAGCGGCCAGG 0: 1
1: 1
2: 1
3: 32
4: 210
1029278818_1029278825 -2 Left 1029278818 7:99424017-99424039 CCACCCTCTGTCAATCAAGCTGG 0: 1
1: 0
2: 10
3: 291
4: 2197
Right 1029278825 7:99424038-99424060 GGCTCCCGGGACCAGCGGCCAGG 0: 1
1: 1
2: 1
3: 32
4: 210
1029278814_1029278825 18 Left 1029278814 7:99423997-99424019 CCATTGGGACCCAGCAGCTCCCA 0: 1
1: 0
2: 2
3: 26
4: 309
Right 1029278825 7:99424038-99424060 GGCTCCCGGGACCAGCGGCCAGG 0: 1
1: 1
2: 1
3: 32
4: 210
1029278820_1029278825 -5 Left 1029278820 7:99424020-99424042 CCCTCTGTCAATCAAGCTGGCTC 0: 1
1: 0
2: 0
3: 11
4: 169
Right 1029278825 7:99424038-99424060 GGCTCCCGGGACCAGCGGCCAGG 0: 1
1: 1
2: 1
3: 32
4: 210
1029278815_1029278825 9 Left 1029278815 7:99424006-99424028 CCCAGCAGCTCCCACCCTCTGTC 0: 1
1: 0
2: 3
3: 48
4: 381
Right 1029278825 7:99424038-99424060 GGCTCCCGGGACCAGCGGCCAGG 0: 1
1: 1
2: 1
3: 32
4: 210
1029278821_1029278825 -6 Left 1029278821 7:99424021-99424043 CCTCTGTCAATCAAGCTGGCTCC 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1029278825 7:99424038-99424060 GGCTCCCGGGACCAGCGGCCAGG 0: 1
1: 1
2: 1
3: 32
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029278825 Original CRISPR GGCTCCCGGGACCAGCGGCC AGG Intronic
900353658 1:2249300-2249322 GGCTCCAGGGTCCAGCGTGCAGG + Intronic
900490639 1:2947201-2947223 AGGTCCCTGGAGCAGCGGCCAGG - Intergenic
900513024 1:3069336-3069358 GGCGCCCCGGCCCGGCGGCCCGG - Intronic
900581145 1:3410285-3410307 GACTCCAGGACCCAGCGGCCTGG - Intronic
901242664 1:7704316-7704338 GGCTCCGGGGGCCGTCGGCCCGG + Intronic
901427127 1:9189398-9189420 GGCCCCCGAGACCAGGGGCCTGG + Intergenic
903326283 1:22570701-22570723 GGCTCCCGGGAGCTGGGGGCAGG + Intronic
903425665 1:23252437-23252459 GGCTCCTGGGAACTGTGGCCTGG + Intergenic
903969361 1:27108964-27108986 GGCTCCCAGGAGCAGAGCCCGGG - Intronic
904165590 1:28552964-28552986 GGCTCCCGAGCGCAGCGGCCCGG - Intergenic
904778300 1:32925230-32925252 GGTTGCCGGGCCCAGGGGCCAGG - Intergenic
907487821 1:54789355-54789377 GGCTCCCGTGAGCAGAGGCCTGG + Intronic
908796051 1:67832800-67832822 ACCTCCCGGGACCAGCCGGCGGG - Intronic
913250637 1:116909968-116909990 GGCTCCCGGGCCCGGCCGGCTGG + Intergenic
920013777 1:202888998-202889020 GGCTCCCGGGTGCTGCAGCCAGG - Exonic
924181951 1:241447719-241447741 GGCACCAGGCACCAGTGGCCAGG + Intergenic
1063204104 10:3814344-3814366 GACTCCCAGGGCCAGCGGCCTGG + Intergenic
1063420176 10:5906278-5906300 GGCTACCGGGACCAGCCGGTGGG + Exonic
1064031841 10:11887620-11887642 GGGTCCTGGGTCCAGAGGCCCGG + Intergenic
1065968216 10:30785481-30785503 GGCCCCTGGGAGCAGCGGCCAGG - Intergenic
1066059374 10:31708377-31708399 GGCTCCTGGGCCCAGCAGCCTGG - Intergenic
1076721792 10:132396384-132396406 GGTTGCCGGGCCCAGGGGCCAGG - Intergenic
1076824247 10:132959298-132959320 GGCTCCAGGGACCCGTGACCAGG - Intergenic
1077103812 11:833334-833356 GGGTCCCGGGACGCGCAGCCTGG + Intronic
1077297399 11:1832562-1832584 GGCTCCCGGGGACAGTGCCCTGG - Intronic
1078180204 11:9004462-9004484 GGCTCCAGGGTCCACCGCCCGGG + Intergenic
1079279178 11:19072642-19072664 GGCTGTAGGGACCAGCTGCCAGG + Intergenic
1083571816 11:63765212-63765234 GGCTGCCGGCGCCAGCGGCGAGG - Exonic
1084128746 11:67118396-67118418 GGCTCCTCGGTGCAGCGGCCTGG - Intergenic
1084192201 11:67504365-67504387 GGCTCCCGGCCCCGGCGGCGCGG - Intronic
1084515288 11:69634642-69634664 GGCTCCTGGGACCGCCAGCCTGG - Intergenic
1084588715 11:70078347-70078369 GGCCCGCGGGACCAGCAGCCGGG + Exonic
1084779212 11:71397573-71397595 GGCTCCAGGGACCCTGGGCCAGG + Intergenic
1084784812 11:71435900-71435922 GGCTCGGGGGCCCAGCGGCCTGG + Intronic
1085200178 11:74697106-74697128 TCCTCCCGGCACCAGCAGCCTGG + Intronic
1087141261 11:94768237-94768259 GGCTCTAGGGCCCAGCGGCCGGG + Intronic
1087172044 11:95059067-95059089 GCCTTCCTGGACCAGCGGCTTGG - Intergenic
1088797081 11:113273440-113273462 GGCTCCCAGCACCAAAGGCCCGG + Intronic
1089533865 11:119149230-119149252 GGCTCCCGGTCCCGGCGGCCCGG - Exonic
1091973858 12:4809884-4809906 GGCTCACGGACCCAACGGCCAGG + Exonic
1092160021 12:6310884-6310906 GGCGGCCGGGACCCGGGGCCTGG + Intronic
1093435478 12:19130212-19130234 GCCTCCCGGGGCCCGCGGCGCGG - Intronic
1096967734 12:55641828-55641850 GGCTCTCGGGACGACAGGCCTGG + Intergenic
1097186584 12:57199548-57199570 GGCTCCCGGGAGCTTCAGCCCGG + Intronic
1103403027 12:120656013-120656035 CCCTCCCGGGACCAGGAGCCAGG + Intronic
1103764951 12:123272974-123272996 GGCGCCCGGGACCAGCCACATGG - Intergenic
1104692671 12:130838862-130838884 GACTCCCGGGACCCCCGCCCTGG + Intronic
1105697179 13:22900483-22900505 GGCGCCCTGGAGCAGCGGGCGGG + Intergenic
1107312099 13:39090247-39090269 GGCTCCTGAGACCTGGGGCCTGG + Intergenic
1113849153 13:113408055-113408077 GGCCCCCGGGGACAGAGGCCGGG - Intergenic
1113875092 13:113589306-113589328 GGCTCCGGGAACCTGAGGCCTGG + Intronic
1114423303 14:22602468-22602490 GTCTCCCGGGAAGAGCTGCCTGG - Intronic
1114623544 14:24114069-24114091 CGCACCCTGGACCCGCGGCCGGG + Intronic
1115257764 14:31420670-31420692 GGGGCCTTGGACCAGCGGCCCGG - Intronic
1115871527 14:37809658-37809680 AGCTCCAGGGACCAGTGACCAGG + Intronic
1117937126 14:60919191-60919213 GGCTCCCTGGTCCAACGTCCTGG + Intronic
1117954302 14:61110922-61110944 GGCCCCAGGGGCCAGGGGCCAGG + Intergenic
1118030429 14:61812901-61812923 GGCTCGCGGCAGCAGCGGCCGGG + Intergenic
1121100259 14:91245381-91245403 GGCCCCCGGGGCCAGAGCCCTGG - Intronic
1121328854 14:93037048-93037070 GCCTCCCTGGTCCAGCTGCCTGG - Intronic
1122357411 14:101132012-101132034 AGCTCCCGGGGACAGCGGCCGGG - Intergenic
1122419687 14:101567457-101567479 TGCTCCGGGGGCCAGGGGCCAGG + Intergenic
1122779695 14:104138491-104138513 GGCTCCCGGGGCGGGCGGCGAGG - Intergenic
1122988522 14:105225043-105225065 GGCTCCTGGCACCTGCGGCCTGG - Intronic
1125874631 15:43133472-43133494 GGAGACCGGGACCAGTGGCCGGG - Intronic
1128028663 15:64460817-64460839 GGCTCCCGGGACCGGCCGCGCGG + Intronic
1128538547 15:68508919-68508941 GGCTCCCGTGCACAGCTGCCTGG + Intergenic
1128547601 15:68578727-68578749 GGCTCCCGGCACCTGCCGGCTGG - Intergenic
1128841293 15:70853655-70853677 GGCTCCCAGGGCTGGCGGCCGGG - Intronic
1130967091 15:88705536-88705558 GGGTCCCGCTGCCAGCGGCCGGG - Intergenic
1130990790 15:88874502-88874524 GGCTCCTGGGCTCAGCGTCCTGG - Exonic
1132348447 15:101122428-101122450 GGCTCAGGGGTCCAGCGGTCCGG - Intergenic
1132389455 15:101427808-101427830 GGCTGCTGAGACCAGCGGACAGG + Intronic
1132612106 16:822348-822370 TGGTCCCGTGACCAGCGTCCTGG + Intergenic
1132970017 16:2682645-2682667 GGCGCCCTGGCCCAGCGCCCTGG + Exonic
1133006179 16:2883058-2883080 GCCTCGGGGGACCTGCGGCCTGG - Intergenic
1133771406 16:8868906-8868928 GGCTCCCGGGGCCGCGGGCCAGG + Intronic
1134217906 16:12330646-12330668 GGCTCTGGGGTCCAGCCGCCTGG - Intronic
1139215893 16:65123573-65123595 GGCGCTCGGGACCCGCGGGCTGG - Intronic
1142130733 16:88430493-88430515 GGCTCTCGGGACCCGGGGCGCGG - Exonic
1142408725 16:89905309-89905331 GGCACCCGGGAACAGCAGCTCGG - Intronic
1144890997 17:18494370-18494392 GGCTCCCTGGCCCTGGGGCCGGG + Exonic
1145141226 17:20449948-20449970 GGCTCCCTGGCCCTGGGGCCGGG - Exonic
1145937914 17:28726053-28726075 GGCGCCCAGGAGCAGCGGCAGGG + Exonic
1149625555 17:58077973-58077995 GACTCCAGGGAGCAGCAGCCAGG - Intergenic
1150108265 17:62478142-62478164 GGCTCCGGGGAGTGGCGGCCGGG + Intronic
1151254487 17:72865190-72865212 GGGTCCCAGGAACAGGGGCCTGG + Intronic
1151683350 17:75633381-75633403 GGCTCCAGAGTCCAGGGGCCGGG - Intronic
1152424693 17:80212533-80212555 GGCACCAGGGAGCAGCTGCCTGG - Intronic
1152627299 17:81393600-81393622 GTCTCCCGGCTCCGGCGGCCGGG - Intergenic
1152656983 17:81524324-81524346 TGCTCCCTGGACCAGGGGGCTGG + Intergenic
1152806172 17:82357374-82357396 GGCTCCCGGGAGGAGCCCCCAGG - Intergenic
1153329989 18:3863765-3863787 GGCTCCCGAGCCCAGCCACCAGG - Intronic
1154132931 18:11751781-11751803 GAGCTCCGGGACCAGCGGCCCGG + Intronic
1156495857 18:37524814-37524836 CGCTGCCGGGAGCCGCGGCCGGG - Intronic
1159927841 18:74284657-74284679 GGCTCCCGTGCCCACCAGCCAGG + Intronic
1160679817 19:407533-407555 GGCTCCCGGGGCTGGCGTCCGGG + Exonic
1160696770 19:488809-488831 GCCTCCCGGGACCAGCGCGCTGG + Intergenic
1160860424 19:1235189-1235211 CCCTCCCGGGACCAGGCGCCTGG - Intronic
1161114277 19:2488205-2488227 GTCTCCCTGGCCCAGCGTCCTGG - Intergenic
1162788662 19:13051863-13051885 GGCTCCCGGGAGCAGCCGGGCGG + Intronic
1163145851 19:15379154-15379176 GGCTTCCGGGACAGGCGCCCTGG + Intronic
1163488893 19:17605710-17605732 GCCTCCCGGTACCAGAGCCCCGG + Exonic
1163823193 19:19508039-19508061 GGCTCTCGGGACCAGGACCCAGG - Exonic
1163829722 19:19541844-19541866 GGCTCCCCGGAGCAGCCTCCAGG - Intronic
1164627190 19:29737503-29737525 GGCTCCCAGGACCACATGCCAGG + Intergenic
1164781388 19:30896399-30896421 GGCTCCTGGGAGCAGCCTCCTGG - Intergenic
1165528748 19:36378988-36379010 GCCGCCCAGGTCCAGCGGCCCGG - Intronic
1165871368 19:38975687-38975709 GGGCCCCGGGACCGGCGGTCTGG + Exonic
1167467392 19:49657574-49657596 GGTGCCCGGGACCAAAGGCCAGG - Intronic
1168336228 19:55599267-55599289 GGCTCTCGGGGCCTGGGGCCTGG - Intronic
925046630 2:777624-777646 GGCTCCTGGGACCACCTACCAGG - Intergenic
926914382 2:17878616-17878638 GGCTCCCGGGAGCTGCGGGCGGG - Intronic
927702017 2:25275065-25275087 GGCTCCCGGGGCCGGCTGCGGGG - Exonic
928199838 2:29240802-29240824 GTCCCCAGGGACCAGCTGCCAGG + Intronic
930729018 2:54709688-54709710 TGATCACGGGACCAGCAGCCCGG - Intergenic
931429241 2:62196209-62196231 GGCGCCCCGGACGGGCGGCCCGG - Exonic
932180703 2:69643704-69643726 CGCTCCCGGGATCAGCTGGCGGG - Exonic
933666973 2:84971586-84971608 CGCTCCCGGGTCCAGCGCCTCGG - Intronic
934686502 2:96325574-96325596 GTCTCCCGGGACCCAGGGCCAGG - Intronic
936083762 2:109452874-109452896 GCCTCCTGGGACCAGCCTCCTGG - Intronic
936083768 2:109452888-109452910 GCCTCCCGGGACCAGCCTCCTGG - Intronic
936083778 2:109452916-109452938 GCCTCCCGGGACCAGCCTCCTGG - Intronic
936083784 2:109452930-109452952 GCCTCCCGGCACCAGCCTCCCGG - Intronic
936279120 2:111122567-111122589 GGCACCCGGCGCCAGCGGCGCGG + Intronic
937134928 2:119544408-119544430 CGCTCCCAGGGCCGGCGGCCGGG - Intergenic
937229525 2:120389429-120389451 GGGGCCCGGGGCCAGAGGCCAGG - Intergenic
937292974 2:120793185-120793207 GGCACCCGGGACCCAGGGCCCGG - Intronic
937321223 2:120961948-120961970 GGCTCCTGGGACCAGGTGCCAGG + Intronic
937933011 2:127220075-127220097 GGCTCCGGGGACCCTCGGCTCGG + Intronic
938100322 2:128493625-128493647 AGCTCCCGGACCCAGCAGCCTGG + Intergenic
942129470 2:172864385-172864407 GGCTCCCTGGATCAGCCACCAGG + Intronic
943811769 2:192195862-192195884 GGTTGCCGGGAGCATCGGCCGGG + Intergenic
946024509 2:216663995-216664017 GGCTCCCTGGATCAGCTTCCCGG - Exonic
947915333 2:233828794-233828816 AGCTCCCGGGACCTGGGCCCAGG - Intronic
948364029 2:237443071-237443093 GGATCCCAGGACCAGGGTCCAGG + Intergenic
948477743 2:238231394-238231416 GGCTGCGGGGCCCGGCGGCCTGG - Exonic
948625626 2:239266287-239266309 GGCTCCTGGGACCAGGGTCCCGG - Intronic
949031490 2:241799350-241799372 GGCTCTGGGGAGCAGGGGCCGGG + Intronic
1170493156 20:16898751-16898773 GGCTTCTGGGAGCAGAGGCCTGG + Intergenic
1171011892 20:21513514-21513536 GGCGCCCTGCCCCAGCGGCCCGG + Exonic
1171460550 20:25295675-25295697 GGCTCCTGGGTCCAGAGGCTAGG + Intronic
1172972065 20:38881039-38881061 GGCTCCTGGGACCTGAGGCTTGG + Intronic
1175205464 20:57307940-57307962 GGCTCCAGTGACCAACTGCCTGG - Intergenic
1175877899 20:62238903-62238925 CGATCCCGGGACCCCCGGCCCGG + Intronic
1175910976 20:62405428-62405450 CCCTCCCTGGAGCAGCGGCCAGG + Intronic
1175965341 20:62657474-62657496 GGCTCCCGGGCACAGCGGCCTGG - Intronic
1176194981 20:63832578-63832600 GGCTGCCGGGACCAACGCCTGGG + Intergenic
1177010862 21:15729750-15729772 GGCTCCCGGGCCAGGCAGCCAGG + Intergenic
1178251483 21:31007512-31007534 GGCACCCGGGGGCAGAGGCCAGG - Intergenic
1178915069 21:36701452-36701474 GGCTCCCCGGCCCAGGAGCCAGG + Intronic
1178992694 21:37367861-37367883 GCCTCCCGGGAGCCGGGGCCTGG + Intronic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1179948933 21:44698708-44698730 GAGTCCCGGGACAAGCGTCCAGG + Intronic
1180216297 21:46325264-46325286 GGCTCCCGGGCACGGCGGACAGG + Intronic
1180730117 22:17974974-17974996 GGCTCCAGAGTCCAGCTGCCTGG - Intronic
1181690288 22:24555331-24555353 GGCTTCCGGGGCCCGCGTCCTGG - Intronic
1183722159 22:39568859-39568881 GGCTCCCGGGGGCAACGGGCAGG - Intergenic
1184797029 22:46738429-46738451 GCCTCCCGGCCCCAGCGCCCTGG - Intergenic
1185021560 22:48379683-48379705 GGCTTCAGAGACCAGCGGCGGGG + Intergenic
950502401 3:13372790-13372812 GGCTTCCGGGGCCAGCTGGCGGG - Intronic
953531278 3:43741643-43741665 GGCTCCCTGGAGCTGCAGCCTGG - Intergenic
954581062 3:51703185-51703207 GGCTCCCAGGAGCAGCATCCAGG - Intronic
961665759 3:128492493-128492515 GGCGCACGGGACCAGCCGGCAGG + Intronic
961688283 3:128650501-128650523 GGGTCCCGGGAGCGGCGGCGAGG + Intronic
967087435 3:186108288-186108310 GGCGCACCGGAACAGCGGCCTGG - Intronic
968674649 4:1871146-1871168 GGCTCGCGGGGCCCGCGGCCCGG + Intergenic
968697920 4:2041839-2041861 TGCCCCCGGGAGCAGCGTCCAGG - Intronic
968697972 4:2042036-2042058 GGACCCCGGGACCAGCAGCGCGG - Exonic
969532370 4:7737004-7737026 GGCTCCAGGGACAGGCGGCCTGG + Intronic
973888564 4:55346739-55346761 GGCTCCGGGGAGCAGTGCCCGGG + Intronic
981434469 4:144703730-144703752 GGCTCCAGGCACCAACGTCCAGG + Intronic
984811183 4:183797631-183797653 CGCTCCCAGGAACAGCCGCCGGG - Intergenic
984823498 4:183905208-183905230 GCGTCCCGGGCCCAGCGCCCAGG + Intronic
985539046 5:479318-479340 TGCTCCAGAGACCAGAGGCCAGG - Intronic
985651175 5:1108469-1108491 GGCTCCCGGGCACAGCCGCGGGG + Intronic
986983840 5:13478405-13478427 GGCTCCGGGGACCAGCTTCCTGG - Intergenic
989011382 5:36876603-36876625 GGCACCCGGGCCCAGCAGCCGGG - Intergenic
989146708 5:38257724-38257746 CGATCCCGGGATCAGAGGCCAGG + Intergenic
991010815 5:61881428-61881450 GGCTGCCTGGACCAGCTGACAGG + Intergenic
991686809 5:69189320-69189342 ATCTCCCGGGAACAGCAGCCTGG - Intergenic
997697515 5:135873163-135873185 GGCTGAGGGGACCAGAGGCCAGG + Intronic
999141128 5:149362862-149362884 GGCTCCAGTGCCCAGCGCCCTGG + Intronic
999320889 5:150614408-150614430 GGCCCCCAGGACCAGAGGACCGG - Intronic
1001434994 5:171693379-171693401 GGCTGCAGGGAACAGGGGCCAGG - Intergenic
1002514968 5:179750915-179750937 AGCCCCCGGGACCTGCCGCCTGG - Intronic
1005987676 6:30884541-30884563 GGCTCCCGAGAGCAGCTGTCGGG - Intronic
1006096687 6:31660698-31660720 CGCTCCCGGGCCCAGCGTCGGGG + Exonic
1007237778 6:40403409-40403431 GGGGCCAGGGACCAGAGGCCTGG + Intronic
1007702145 6:43771647-43771669 TTCGTCCGGGACCAGCGGCCGGG - Intronic
1011099882 6:83709016-83709038 GGCTTCTGGGGCCAGGGGCCAGG - Intronic
1011193840 6:84763178-84763200 GGCTCTTGGGACCAGAGTCCGGG - Intronic
1014205419 6:118651230-118651252 GGCTCCGGAGGCCAGCGGCCGGG - Intronic
1016340859 6:143060604-143060626 GGGTCCCGGGACACCCGGCCAGG - Intronic
1018206919 6:161445065-161445087 GGCTTCAGGGACCAGATGCCAGG + Intronic
1018669562 6:166167715-166167737 GGCTCCCGGGTCCCGGGTCCCGG + Exonic
1018731830 6:166657123-166657145 GGCTCCTGGGACCTGGCGCCAGG - Intronic
1019290834 7:249271-249293 GGCACCAGGGACCAGGGGCCTGG - Intronic
1019478644 7:1256018-1256040 GGCTCCAGGGGCCAGCAGCTGGG + Intergenic
1020086206 7:5312258-5312280 GCGTCCCGGGACCAGAGGGCAGG + Intronic
1022020942 7:26398813-26398835 GGCTCCCGGGACCAGCGGGCGGG - Intergenic
1022739780 7:33109595-33109617 GGGTCTCGGGCCCAGCCGCCAGG + Intergenic
1025033037 7:55572554-55572576 GGCTCCCGGAACCCGAGGCCCGG + Intronic
1025106301 7:56174587-56174609 GGCTCCTGGGGCCAGCGGGGAGG + Intergenic
1025208099 7:57004814-57004836 GCCTCCCAGGACCAGAGGGCAGG - Intergenic
1026220468 7:68392127-68392149 GGCTCCGGCCACCAGTGGCCTGG - Intergenic
1029184863 7:98731339-98731361 GGCTCCCGGGACCAGCTGGAGGG + Intergenic
1029278825 7:99424038-99424060 GGCTCCCGGGACCAGCGGCCAGG + Intronic
1032020574 7:128405427-128405449 GGCGTCCTGGACCAGCGGCTGGG + Intronic
1032454581 7:132063784-132063806 GGCTCCCTGGACATGGGGCCTGG + Intergenic
1033275950 7:139971696-139971718 GGCTCCTGGGAGCAGCTCCCAGG - Intronic
1034456357 7:151173135-151173157 GGCCCGCGGGACCAACAGCCAGG + Intronic
1034983230 7:155491432-155491454 GGCTCCCGGGACCAGGGTGCAGG + Intronic
1035153293 7:156892841-156892863 GGGTCCGGGGACCGGGGGCCCGG + Intronic
1035371653 7:158382976-158382998 GGCACCAGGGACCAGCTTCCTGG - Intronic
1036915448 8:12799720-12799742 GGTCCCTGGGACCAGCAGCCTGG + Intergenic
1038671602 8:29587709-29587731 GGTTCCCTGGAGCAGCAGCCAGG + Intergenic
1038883587 8:31640024-31640046 GGCCCCCGGGCCCAGCGCCCCGG + Intronic
1039453995 8:37696230-37696252 GGCGCCCGGGGGCAGCGGCCGGG - Intronic
1040065313 8:43140341-43140363 GGCGCCCGGGAGCCGCGGGCGGG - Intergenic
1043148353 8:76682531-76682553 GGGTCCCTGGCCCAGAGGCCGGG - Intronic
1044648968 8:94474805-94474827 GGCCCCCGGGGCCAGCAACCAGG + Intronic
1048932496 8:139326229-139326251 GGGACCGGGGACCAGGGGCCAGG - Intergenic
1049212273 8:141392225-141392247 GGGTCCCGGGACGCGCGGGCAGG - Intronic
1049610639 8:143553284-143553306 GGCTCCTAGAACCAGGGGCCTGG + Exonic
1052051090 9:23850446-23850468 GGCTCCCGCGAGCAGCTGCTAGG + Intergenic
1054808298 9:69413283-69413305 GCCTCCGGGGAGCAGGGGCCAGG - Intergenic
1057772996 9:97983958-97983980 GCCTCCCGGGATGCGCGGCCGGG + Intronic
1057929443 9:99180853-99180875 GGCTTCCTGGACCAGAAGCCAGG + Intergenic
1059414709 9:114155739-114155761 GACTCCTGGGACCATGGGCCTGG + Exonic
1060523760 9:124309058-124309080 GGCTCCTGGGGGCAGCTGCCTGG - Intronic
1061208720 9:129178571-129178593 GGCTCCCGGGACCTAAGGCGAGG - Intergenic
1061262651 9:129488581-129488603 GGCTCCGGGAAACGGCGGCCTGG - Intergenic
1062030623 9:134360344-134360366 GGCTCCCGTGACCAGCGGGGTGG - Intronic
1062350048 9:136134070-136134092 ACCAGCCGGGACCAGCGGCCAGG - Intergenic
1062389319 9:136327727-136327749 AGCTCCCGGGCCCGGCCGCCAGG + Exonic
1062439759 9:136564432-136564454 GGCTCCAGGGACCTCCTGCCAGG - Intergenic
1062480146 9:136747327-136747349 TGCTCCCGGGCACCGCGGCCTGG - Intronic
1062665132 9:137666515-137666537 GGACCCTGGGACCAGAGGCCAGG + Intronic
1185871672 X:3669985-3670007 GGCTCCACCCACCAGCGGCCAGG - Intronic
1189336310 X:40172692-40172714 GGCTGGCGGGACAAGCGGCGGGG + Intronic
1190054165 X:47172234-47172256 GGCTCTAGGGTCCAGCTGCCCGG - Intronic
1190711851 X:53077320-53077342 TGGTCCCGGGGCCACCGGCCAGG + Exonic
1200065315 X:153501944-153501966 GGTTCCCGGGACCAGCTGTGGGG - Intronic
1200243777 X:154511905-154511927 GCCTCCCGGGGCCTGCGGCAGGG + Intronic