ID: 1029278920

View in Genome Browser
Species Human (GRCh38)
Location 7:99424496-99424518
Sequence TGCCATACCTCTAGAGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029278914_1029278920 1 Left 1029278914 7:99424472-99424494 CCCCTCAGGAATTCTGAGAATCC 0: 1
1: 0
2: 0
3: 11
4: 232
Right 1029278920 7:99424496-99424518 TGCCATACCTCTAGAGTGTTGGG No data
1029278913_1029278920 7 Left 1029278913 7:99424466-99424488 CCACGGCCCCTCAGGAATTCTGA 0: 1
1: 0
2: 2
3: 12
4: 146
Right 1029278920 7:99424496-99424518 TGCCATACCTCTAGAGTGTTGGG No data
1029278916_1029278920 -1 Left 1029278916 7:99424474-99424496 CCTCAGGAATTCTGAGAATCCCT 0: 1
1: 0
2: 3
3: 22
4: 228
Right 1029278920 7:99424496-99424518 TGCCATACCTCTAGAGTGTTGGG No data
1029278915_1029278920 0 Left 1029278915 7:99424473-99424495 CCCTCAGGAATTCTGAGAATCCC 0: 1
1: 0
2: 0
3: 12
4: 162
Right 1029278920 7:99424496-99424518 TGCCATACCTCTAGAGTGTTGGG No data
1029278909_1029278920 29 Left 1029278909 7:99424444-99424466 CCTCGGGGGCTTTGAAAACTGCC 0: 1
1: 0
2: 0
3: 18
4: 131
Right 1029278920 7:99424496-99424518 TGCCATACCTCTAGAGTGTTGGG No data
1029278912_1029278920 8 Left 1029278912 7:99424465-99424487 CCCACGGCCCCTCAGGAATTCTG 0: 1
1: 0
2: 2
3: 10
4: 105
Right 1029278920 7:99424496-99424518 TGCCATACCTCTAGAGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029278920 Original CRISPR TGCCATACCTCTAGAGTGTT GGG Intronic
No off target data available for this crispr