ID: 1029283473

View in Genome Browser
Species Human (GRCh38)
Location 7:99451145-99451167
Sequence GGTTTCCTGAGCCTCCACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029283473_1029283481 25 Left 1029283473 7:99451145-99451167 CCCATGTGGAGGCTCAGGAAACC 0: 1
1: 0
2: 0
3: 5
4: 161
Right 1029283481 7:99451193-99451215 AAGTAGTCGTCTAACAGTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1029283473_1029283480 24 Left 1029283473 7:99451145-99451167 CCCATGTGGAGGCTCAGGAAACC 0: 1
1: 0
2: 0
3: 5
4: 161
Right 1029283480 7:99451192-99451214 TAAGTAGTCGTCTAACAGTGAGG No data
1029283473_1029283482 29 Left 1029283473 7:99451145-99451167 CCCATGTGGAGGCTCAGGAAACC 0: 1
1: 0
2: 0
3: 5
4: 161
Right 1029283482 7:99451197-99451219 AGTCGTCTAACAGTGAGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029283473 Original CRISPR GGTTTCCTGAGCCTCCACAT GGG (reversed) Intronic
900473100 1:2864079-2864101 GGTCCCCTGAGCCGGCACATGGG - Intergenic
902400552 1:16154822-16154844 GGTTTCCGCAGGCTCCACAAGGG - Intronic
903765671 1:25732630-25732652 AGTTTCCTCATCCTCCACAGTGG - Intronic
904007174 1:27369453-27369475 GATTCCCTGAGCCTCCACAGTGG - Exonic
904799999 1:33085912-33085934 GGTGCCCTGGGCCTCCACGTGGG + Intronic
907960209 1:59272405-59272427 GGTTTCCTGAGCTGCGAAATGGG + Intergenic
910865508 1:91784732-91784754 AGATTCCTGAGCCTCCCCCTGGG - Intronic
911167615 1:94738207-94738229 GGTTTTCTGATCCTGCACAATGG + Intergenic
912730739 1:112100806-112100828 GGTTTCCTGCCCCTCCAGAATGG - Intergenic
912745055 1:112239266-112239288 GCTTTCCTCAGCCTGCACATGGG + Intergenic
913040964 1:115022749-115022771 GGTTTGGTGAACCTCCCCATAGG - Intergenic
915075171 1:153302311-153302333 TGTTTCCTGAGCCTCTCCTTTGG - Intronic
917296408 1:173523830-173523852 GCTTTCCTGGGCCTCCATTTTGG + Intronic
917977625 1:180250605-180250627 GCTTCCCTGAGCCGCCACACTGG - Intronic
923814466 1:237359885-237359907 TGATTCCTAGGCCTCCACATTGG - Intronic
1064447197 10:15406306-15406328 GGTTTCCTGAGTGTCAAAATGGG + Intergenic
1067549459 10:47223628-47223650 GGTTTCCTCAGCCACAAAATGGG + Intergenic
1067787984 10:49264838-49264860 TGTTTCCAGAGCCTCCAAAAAGG - Intergenic
1069179637 10:65342196-65342218 GAATCCCTGAGCCTCCACACAGG + Intergenic
1072628899 10:97132255-97132277 GGTTACCTGAGCCTGCAGAGGGG - Intronic
1073216380 10:101839037-101839059 GGGTTCCTGAGCCTCTAAGTTGG - Intronic
1076219834 10:128724175-128724197 GGTTTCCTGAACCTCGACCCTGG + Intergenic
1076365887 10:129920917-129920939 GGTTTCCTCATCCTCAAAATGGG + Intronic
1077021295 11:418242-418264 GGATTCCTGCGGCCCCACATGGG + Exonic
1077300802 11:1846124-1846146 GGTTCCCTGGGCCTCCACCGAGG + Intergenic
1077603572 11:3591545-3591567 CGCTCCGTGAGCCTCCACATCGG + Intergenic
1081007648 11:37766958-37766980 TCTTTCCTGAGCCTGCACCTGGG + Intergenic
1084259472 11:67966141-67966163 CGCTCCGTGAGCCTCCACATCGG + Intergenic
1091119380 11:133044071-133044093 GCTTTCCTGATCCTCTCCATAGG - Intronic
1092050028 12:5462219-5462241 GGTTTTTTAATCCTCCACATAGG + Intronic
1094742175 12:33302333-33302355 TGTTTTCTGAGCCCCAACATAGG + Intergenic
1095114899 12:38341512-38341534 GGTTTCCTAAGTTTCTACATAGG + Intergenic
1101540253 12:105658670-105658692 GGCTTCTAGAGCCTTCACATTGG + Intergenic
1102014648 12:109639755-109639777 GGTCACCTGAGGCTCCACTTTGG - Intergenic
1103140827 12:118546716-118546738 GGGTTCCTGTGCCTCTCCATGGG + Intergenic
1103148254 12:118614080-118614102 TGATTCCTAATCCTCCACATAGG - Intergenic
1103887858 12:124216325-124216347 GGTCTTCTCAGCCTCCACACGGG + Intronic
1104371510 12:128227901-128227923 TGTATCCTGAGCCCCCACAGGGG + Intergenic
1104648980 12:130517487-130517509 GGTTGCCTGAGCCTCCATGATGG - Intronic
1106505224 13:30365203-30365225 CATTTTCTGAGCCTGCACATTGG - Intergenic
1107260338 13:38482740-38482762 GGCTTCCGGTGCCTCCATATGGG + Intergenic
1107320386 13:39180079-39180101 GGTTTCCTAAGCATGCCCATGGG + Intergenic
1107396040 13:40018537-40018559 CCTTTTCTGACCCTCCACATAGG - Intergenic
1108145505 13:47472401-47472423 AGTTTCCAAAGACTCCACATTGG - Intergenic
1109393371 13:61722508-61722530 GGTTTCCTTAGGCTCCTCACTGG - Intergenic
1110125384 13:71935885-71935907 GGTTTCCTCAGCCTAAACTTAGG + Intergenic
1111023416 13:82485760-82485782 GGCTTGCTAAGCCTCCACAATGG - Intergenic
1112393646 13:99008532-99008554 GCTTTCAAGAGACTCCACATGGG - Intronic
1115753179 14:36510090-36510112 GGACTCCTGAGCCTCGACCTGGG - Intronic
1116801896 14:49452279-49452301 AGTTCCCTGAGCCTCACCATGGG - Intergenic
1118153606 14:63215972-63215994 ATTATCCTGAGCGTCCACATAGG - Intronic
1118816617 14:69318635-69318657 GGTTTCCTGAGCCCACAGAGTGG + Intronic
1121386060 14:93526554-93526576 GTTTTCCAAAGCCTCTACATTGG + Intronic
1121665092 14:95666140-95666162 GGTTTCATGACACTGCACATGGG + Intergenic
1122717844 14:103706114-103706136 GGTCTCCTGAGCCTCCGTGTCGG - Intronic
1125407973 15:39372633-39372655 GGTTTCCTGAACCTAAGCATAGG - Intergenic
1125592304 15:40862330-40862352 GGTTTCCTAAGCCTTCCCACAGG + Intergenic
1126679026 15:51186427-51186449 GGTTTCCAGAGCTTCCCCACAGG - Intergenic
1126734404 15:51716899-51716921 GGTTTCCACAGCCTCCTCTTAGG + Intronic
1128803574 15:70513824-70513846 GGATTTCTGGGCCTCCTCATGGG + Intergenic
1129659746 15:77546562-77546584 GGATTCCTGGGCATGCACATTGG - Intergenic
1130137183 15:81191056-81191078 AGTTGCCTCAGCCTCCACACTGG + Intronic
1131221631 15:90589453-90589475 GGGATCCTGAGCCTCAACCTCGG + Intronic
1132678464 16:1130299-1130321 GGCGTCCCCAGCCTCCACATGGG - Intergenic
1133872943 16:9706465-9706487 GGTTTACAGAGGCTGCACATAGG + Intergenic
1137467061 16:48719354-48719376 GGTTTTTTCAACCTCCACATGGG + Intergenic
1141903678 16:87008785-87008807 GGCTTCCTGAGCTTGCAAATTGG + Intergenic
1142003956 16:87680243-87680265 TGATCCCTGAGCCACCACATTGG + Intronic
1143771929 17:9174383-9174405 GCTTACCTGAGGCTCCACACAGG + Intronic
1144074947 17:11708947-11708969 TGATTCCTGAGCCTCTAGATAGG + Intronic
1144850950 17:18243742-18243764 GGCTTGCTGAGTCTCCAGATGGG - Intronic
1145274106 17:21419941-21419963 GGCTTCCTCAGCCTCCGCCTTGG + Intergenic
1145311968 17:21705840-21705862 GGCTTCCTCAGCCTCCGCCTTGG + Intergenic
1151745710 17:76010628-76010650 TGTTTCCTGAGACTCCCCAGTGG + Intronic
1152226510 17:79095293-79095315 GGTTTCCACAGCCTCCCCATGGG + Intronic
1153756911 18:8293422-8293444 GATTCCCTGAGCCTTCACGTGGG - Intronic
1161884597 19:6984441-6984463 TGTTTCCTGAGCTTCCAAAAGGG - Intergenic
1163640786 19:18460941-18460963 AGGTTCCTGAGGCTCCACCTTGG - Intronic
1167806967 19:51793923-51793945 GATTTGATGAGCTTCCACATTGG + Intronic
925564549 2:5235930-5235952 GGTTTATTGAGTCTCCACTTCGG - Intergenic
928101668 2:28440907-28440929 GGTTTCTTGTGTCTCCATATTGG - Intergenic
929576945 2:43057899-43057921 GGATTCCTGAGACTCCACCGGGG + Intergenic
931228457 2:60353573-60353595 GGTTTCCTGAGCCTCAGCTGGGG - Intergenic
932556366 2:72828404-72828426 GTTTTTGTGAGCCTCCACAGAGG + Intergenic
932863303 2:75316640-75316662 AGGTTCCTGAGCCTACACTTGGG - Intergenic
938069179 2:128299561-128299583 AGTTTCCTCATCCACCACATGGG - Intronic
938668919 2:133568366-133568388 GTTTTCCTGAACATCCACAGCGG + Exonic
940811589 2:158248954-158248976 AGCTTCCTGAGCCTGCAGATGGG - Intronic
941528637 2:166637191-166637213 GGTCACCAGAGCCTCCATATGGG - Intergenic
946777981 2:223163817-223163839 GGCTTCCTCAGTCTCCAAATTGG - Intronic
947341041 2:229139904-229139926 GTTTTTCTCACCCTCCACATGGG + Intronic
948619314 2:239224185-239224207 GATTTCCTTAGCCTGCAGATGGG - Intronic
1168837927 20:890207-890229 TGTTACCTGAGCCTCCATGTCGG + Exonic
1169586659 20:7093152-7093174 CTTTTCCTGAGCATCCACATGGG - Intergenic
1169657087 20:7936977-7936999 GCTTTCCTGGGCCTCCACTTTGG + Intronic
1172794412 20:37527306-37527328 GGTCTCCTGAGGCTCCGCTTCGG - Intronic
1174079792 20:47962701-47962723 GGGTTCCTGAAACTCCACAGGGG + Intergenic
1174157084 20:48522647-48522669 GGGCTCCAGAGCCTCCACAGGGG + Intergenic
1174246227 20:49183362-49183384 GTTTTCATGAGCCTCTAAATTGG - Intronic
1174508994 20:51036915-51036937 ATCTTGCTGAGCCTCCACATTGG + Intergenic
1176070033 20:63221454-63221476 TGCTCCCTGAGCCTCCACCTTGG - Intergenic
1179179157 21:39030668-39030690 GCTCTTTTGAGCCTCCACATGGG + Intergenic
1181143932 22:20830260-20830282 GGTTACCTAAGCCTCTTCATAGG + Intronic
1182102636 22:27668870-27668892 GGTTCCCCAAGCTTCCACATGGG + Intergenic
1182133441 22:27877454-27877476 GGATTACTGAGTCTCCACACTGG + Intronic
1183586601 22:38756273-38756295 GGTGTTCTGAGCCGCCAGATCGG - Intronic
1184263037 22:43330186-43330208 GGTTTCCTCATCCATCACATGGG - Intronic
949911780 3:8916165-8916187 GGTTTCCTGATCCTCCTGAAGGG - Intronic
951100290 3:18679903-18679925 GTTTTCCTGGGCTTCCACAATGG - Intergenic
953201705 3:40783629-40783651 GGGTTCCTGGGCCCCCAGATGGG - Intergenic
953469556 3:43155275-43155297 GGTTTCCTGTGCTTCTAAATAGG + Intergenic
954688453 3:52383182-52383204 GGTTTTCAGAGCTTCTACATGGG + Intronic
955572285 3:60321082-60321104 GAGTCCCTGAGCCTCCACAAAGG - Intronic
961513648 3:127419763-127419785 GGTTCCCTGAGCCCTCACCTTGG - Intergenic
961637812 3:128344032-128344054 GCCTTCCTGAGGCTCCACAAGGG + Intronic
963001476 3:140685600-140685622 GGCTTCCTGAGCCCCAACACAGG + Intronic
963289321 3:143471380-143471402 TATGTCCAGAGCCTCCACATAGG - Intronic
964956549 3:162365559-162365581 GCTTTCCTCACCCTCCTCATTGG + Intergenic
969018040 4:4118198-4118220 CGCTCCGTGAGCCTCCACATCGG + Intergenic
969150335 4:5163921-5163943 TGTTTCCTGCTCCTCCGCATGGG + Intronic
972865943 4:43232679-43232701 GGTTTCCTATGCTTCCTCATAGG - Intergenic
975832051 4:78379758-78379780 GGTTCCCTGATCCTCCCAATTGG + Exonic
979552633 4:122008398-122008420 GGTTTCCTCATCTGCCACATAGG + Intergenic
983426625 4:167592342-167592364 TGTTTGCTGATACTCCACATAGG - Intergenic
984240760 4:177216958-177216980 CGTTTTCTAAGCCTCAACATAGG - Intergenic
995597263 5:113761185-113761207 GGTTTCCTGATTCTGCACTTAGG + Intergenic
997833304 5:137171480-137171502 TGGGTCCTGATCCTCCACATTGG - Intronic
999368490 5:151038518-151038540 GGTTTCCTCAGCCTCTACCCTGG + Intronic
1008453051 6:51675126-51675148 GGGTTCCAGAGCCACCAAATGGG + Intronic
1010408869 6:75537778-75537800 AATTTCCTCAACCTCCACATGGG + Intergenic
1010573584 6:77507008-77507030 GGTCTCCTATTCCTCCACATTGG + Intergenic
1010595705 6:77761142-77761164 AGGTTCCTGAGCCTCCAACTGGG - Exonic
1013014145 6:106145840-106145862 GGTTTCCTGGCCCTTCACCTTGG + Intergenic
1013677930 6:112487970-112487992 GGCTTCCTGAGCCTACTCCTAGG - Intergenic
1017410613 6:154163753-154163775 GATTTCCTCAGACTCCAAATAGG - Intronic
1019556371 7:1633516-1633538 GCCTGCCTGTGCCTCCACATGGG - Intergenic
1020131256 7:5559817-5559839 GGCACCCTGAGTCTCCACATCGG + Intronic
1021846735 7:24770230-24770252 GGTTCACAGAGCTTCCACATTGG + Intergenic
1023708325 7:42965505-42965527 GGTTTGGGGAGCTTCCACATAGG + Intergenic
1023907861 7:44534809-44534831 GGTTTCCTGGACCTCCCCTTGGG - Intronic
1026561712 7:71455901-71455923 TGTATCCTGAGCCTTCTCATAGG - Intronic
1028267614 7:88746845-88746867 GGATTCCTGGGCAACCACATTGG - Intergenic
1029076479 7:97938707-97938729 CGCTCCGTGAGCCTCCACATCGG + Intergenic
1029283473 7:99451145-99451167 GGTTTCCTGAGCCTCCACATGGG - Intronic
1031273988 7:119694378-119694400 GGATTTCTGAGCCTCCAAAAGGG + Intergenic
1033392312 7:140939790-140939812 GGTTTGGTGAGCATTCACATGGG - Intergenic
1034422924 7:150998713-150998735 GGTTTCCTCATTCTCCACCTTGG - Intronic
1036056106 8:5255878-5255900 TGTTTCCAGAGCCCCCACAAAGG - Intergenic
1042444940 8:68872627-68872649 TGTTCCCAGAGCCTCCAGATAGG + Intergenic
1048397052 8:134023746-134023768 GGATTTCTGACCCTCCTCATGGG - Intergenic
1048588895 8:135802830-135802852 GGGTTGCAGAGCCTCCACAAAGG - Intergenic
1049623811 8:143611285-143611307 CCTTTCCTGAACCCCCACATGGG + Intergenic
1050961668 9:11741124-11741146 GGTTTCCTGTGCATACACTTAGG - Intergenic
1051833877 9:21312123-21312145 GCTTTTGTGTGCCTCCACATTGG - Intergenic
1052323121 9:27189733-27189755 GGTCTCCTAAGCCTCCAGAAAGG + Intronic
1059401508 9:114073218-114073240 GGTCTCCTGAGTCCCCACAAAGG + Intronic
1060231406 9:121827941-121827963 CTTTTCCAGAGCCTCCACAATGG + Intronic
1060583340 9:124770957-124770979 GGCTTCCTGAGCCTCCGCCAGGG - Intronic
1061718047 9:132533301-132533323 GGGTTCCTCAGCCTACACACTGG - Intronic
1062304034 9:135892140-135892162 GGCTTCCTGAGCCTGTAAATTGG - Intronic
1186091073 X:6049458-6049480 TATTTCTTTAGCCTCCACATAGG + Intronic
1186180352 X:6967584-6967606 TGTTTTCTGAGCCCCAACATGGG - Intergenic
1196392730 X:115225363-115225385 TGTTTTCTGAGCCCCAACATAGG + Intronic
1197014801 X:121610720-121610742 AGTTTCCTGAACCTACAGATGGG + Intergenic
1198851425 X:140968666-140968688 GGTTTTCTGAGCCCCCATAACGG + Intergenic
1199922681 X:152425845-152425867 AGTTTTCTGGGCCTACACATGGG - Intronic
1201561790 Y:15324988-15325010 GGTTTCCTGAGTCTAGAAATAGG + Intergenic