ID: 1029283918

View in Genome Browser
Species Human (GRCh38)
Location 7:99453371-99453393
Sequence GGCACGGCTGCACCTACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 119}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029283918_1029283925 0 Left 1029283918 7:99453371-99453393 CCAGGTGTAGGTGCAGCCGTGCC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1029283925 7:99453394-99453416 AACCTGGGGGTTTTCTAGCTCGG No data
1029283918_1029283930 27 Left 1029283918 7:99453371-99453393 CCAGGTGTAGGTGCAGCCGTGCC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1029283930 7:99453421-99453443 TGCACTTACGGGCCAGAGCCAGG 0: 1
1: 0
2: 1
3: 5
4: 80
1029283918_1029283929 16 Left 1029283918 7:99453371-99453393 CCAGGTGTAGGTGCAGCCGTGCC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1029283929 7:99453410-99453432 AGCTCGGGTTCTGCACTTACGGG 0: 1
1: 0
2: 0
3: 5
4: 53
1029283918_1029283926 1 Left 1029283918 7:99453371-99453393 CCAGGTGTAGGTGCAGCCGTGCC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1029283926 7:99453395-99453417 ACCTGGGGGTTTTCTAGCTCGGG 0: 1
1: 0
2: 0
3: 19
4: 186
1029283918_1029283928 15 Left 1029283918 7:99453371-99453393 CCAGGTGTAGGTGCAGCCGTGCC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1029283928 7:99453409-99453431 TAGCTCGGGTTCTGCACTTACGG 0: 1
1: 0
2: 0
3: 1
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029283918 Original CRISPR GGCACGGCTGCACCTACACC TGG (reversed) Intronic
900895685 1:5481423-5481445 GGCAGGGCTGCACACACACAGGG + Intergenic
901145169 1:7059997-7060019 GCCACAGCTGCCCCTAGACCAGG + Intronic
903133596 1:21294549-21294571 GGCACTGTTGCACCTTCATCTGG - Intronic
903290368 1:22309611-22309633 GGCACCGCTGCACTCCCACCTGG + Intergenic
904824027 1:33263195-33263217 TTCACACCTGCACCTACACCTGG + Intronic
905199539 1:36306746-36306768 GGCTCGGCCTCACCTGCACCAGG - Exonic
906132339 1:43468193-43468215 TGCAAGGCTGCAGCTAGACCAGG + Intergenic
910374446 1:86553198-86553220 GGCAAAGCTGCAGCTTCACCAGG + Intronic
913968029 1:143392977-143392999 TGCATGGCTGCAGCCACACCTGG + Intergenic
914062410 1:144218567-144218589 TGCATGGCTGCAGCCACACCTGG + Intergenic
914116740 1:144747787-144747809 TGCATGGCTGCAGCCACACCTGG - Intergenic
916679749 1:167093544-167093566 GGCACCACTGCACTTTCACCAGG + Intergenic
918060072 1:181053336-181053358 GGCACCACTGCACTTCCACCTGG + Intronic
918187991 1:182144459-182144481 GGCAAGGCTGCTACTACTCCGGG + Intergenic
919464104 1:197911123-197911145 GGCAGGGCGGCACCATCACCGGG + Intergenic
924514058 1:244751647-244751669 GGCACTGCTCCATCTGCACCTGG - Intergenic
1065976359 10:30846276-30846298 GTCCCGGCTGCACCTTCAGCTGG - Intronic
1072679874 10:97498893-97498915 GGCACCGCCGCAGCTACTCCCGG - Exonic
1075871880 10:125777144-125777166 GGCACGCATGCCACTACACCTGG - Intergenic
1076327442 10:129637261-129637283 GGCCCATCTGCACTTACACCAGG - Intronic
1077012719 11:385989-386011 GGCTGGGCTGCAACAACACCCGG - Intergenic
1077389680 11:2294450-2294472 GGCACCGCTGCGCTTTCACCAGG - Intergenic
1080233408 11:30043196-30043218 GGCCCTGTTGCACTTACACCTGG + Intergenic
1081606657 11:44531373-44531395 GGCACAGCTGCAACTCCATCTGG + Intergenic
1096530181 12:52237470-52237492 GGCAAAGCTGCATCAACACCAGG + Intronic
1102698678 12:114819796-114819818 GGCACCACTGCACTTTCACCTGG + Intergenic
1103908133 12:124337778-124337800 GGCACAGCTGCCCCTGCACAGGG + Intronic
1115859608 14:37669347-37669369 GGCACGTGTGCACCTGCCCCAGG + Intronic
1122249284 14:100426839-100426861 GGCAGGGCAGCACCCATACCAGG - Intronic
1122719975 14:103716274-103716296 GGCAGGGCCGCACCCACCCCCGG - Intronic
1122977514 14:105176969-105176991 GGAACTGCTTCACCAACACCAGG + Exonic
1124650327 15:31469329-31469351 GGGAGGGCTGCAGCTGCACCTGG + Intergenic
1125718266 15:41832085-41832107 TGCAAGGCTGCAGCTAGACCAGG - Intronic
1127774675 15:62255538-62255560 GGCACAGCTGGAAGTACACCTGG - Intergenic
1133106096 16:3510561-3510583 CGCACGGCTGCCCCAAGACCCGG - Intronic
1135112288 16:19699620-19699642 GGCACGGCTGTGCAGACACCAGG + Exonic
1135490352 16:22904173-22904195 GTGAGGGCTGCACCTAAACCTGG - Intronic
1136672903 16:31874032-31874054 GGCCCGGGTGCCCCTACAGCGGG - Intronic
1137002822 16:35246162-35246184 GGACCTGCTGCACCAACACCTGG + Intergenic
1138282577 16:55783466-55783488 GCCACGGCTGCACATACTCAGGG - Intergenic
1140194505 16:72845465-72845487 GGCAGGGCTGCAGCCACGCCCGG + Intronic
1142024747 16:87806498-87806520 GGCCCGGCTGCAGCTTTACCTGG - Intergenic
1142113710 16:88345578-88345600 GGCATGGCAGAACCCACACCTGG + Intergenic
1142680345 17:1544029-1544051 GGCACTGCTGCCCCCACTCCAGG - Intronic
1143635609 17:8162502-8162524 GGCAGGGCTGGACCGAGACCAGG - Intronic
1144023127 17:11254610-11254632 GGCAGGGCTGCCCCTACCTCTGG + Intronic
1148168670 17:45501762-45501784 GGCAGGACTGCACCTTCACAGGG - Intergenic
1148225709 17:45896590-45896612 GGCGCGGCTCCCCCTACCCCAGG - Intronic
1148242348 17:46008842-46008864 GGCACGGCTGGTCCTTCACTGGG + Intronic
1148280141 17:46341179-46341201 GGCAGGACTGCACCTTCACAGGG + Intronic
1148302369 17:46559116-46559138 GGCAGGACTGCACCTTCACAGGG + Intronic
1148713651 17:49700100-49700122 GGCAGGGCTGCAGCGACACCTGG + Intergenic
1149328920 17:55561395-55561417 AGCGCTACTGCACCTACACCGGG - Intergenic
1150380843 17:64718172-64718194 AGCACTGCTGCACCTGCTCCAGG - Intergenic
1151266144 17:72956922-72956944 GGCATGGCTGCTCATCCACCTGG + Intronic
1151457218 17:74233193-74233215 GGCAAGGCAGCAGCTACACCTGG - Intronic
1151802713 17:76387214-76387236 GGCACTGCTGCACTCGCACCTGG + Exonic
1157681853 18:49613559-49613581 GCCAGGGCTCCACCTACACCTGG - Intergenic
1160835694 19:1123505-1123527 GGCCCGGCTGCACCCAGCCCTGG - Intronic
1168094775 19:54108207-54108229 GGCACGGATGCCCCCACCCCAGG - Exonic
1202701818 1_KI270712v1_random:170445-170467 TGCATGGCTGCAGCCACACCTGG + Intergenic
933384987 2:81598657-81598679 TGCTGGGCTGCACCTACACCAGG + Intergenic
934172728 2:89553892-89553914 TGCATGGCTGCAGCCACACCTGG + Intergenic
934283043 2:91628244-91628266 TGCATGGCTGCAGCCACACCTGG + Intergenic
934735342 2:96687164-96687186 GGCAAGGCGGCACCTTCTCCAGG - Intergenic
938195013 2:129319328-129319350 TCCACGGCTGCAGCTGCACCTGG + Intergenic
942054834 2:172172706-172172728 GGCACGGCTGCAGTTGCGCCCGG - Intergenic
947767588 2:232647466-232647488 GGCACTGCTGGAACTGCACCAGG + Intronic
1171370686 20:24660464-24660486 GGCATGGCTGCACACACAGCAGG + Intronic
1176045580 20:63091007-63091029 GCCAAGGCTGCACTGACACCAGG + Intergenic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1176423686 21:6534824-6534846 GGCGCGGCTCCACCCACACCTGG - Intergenic
1179699179 21:43143139-43143161 GGCGCGGCTCCACCCACACCTGG - Intergenic
1182526856 22:30925960-30925982 GGCCCTGCTGCACCCACACATGG + Intronic
1183199456 22:36375734-36375756 GCCACCACTGCACCTACACCTGG - Intronic
1183463796 22:37968799-37968821 GGCCAGGCTGCACCTAGGCCTGG - Exonic
1184640728 22:45868609-45868631 GTCACGGCTGCACCTTCCCTGGG + Intergenic
1185028959 22:48431748-48431770 GGCACAGCTGGACCGGCACCTGG + Intergenic
1185096784 22:48811916-48811938 GGCACGTCTTCACCTGCTCCTGG + Intronic
951940533 3:28073431-28073453 GGCATCGCTGCACCCACACTTGG + Intergenic
954351366 3:50046828-50046850 GGCACAGCTGGACTTACATCTGG - Intronic
961466399 3:127084534-127084556 GGCAGGGCTGCAGGTAGACCTGG + Intergenic
968047821 3:195634049-195634071 GGCAGGGCTGCACCACCACAGGG + Intergenic
968099586 3:195955569-195955591 GGCAGGGCTGCACCACCACAGGG - Intergenic
968306793 3:197655875-197655897 GGCAGGGCTGCACCACCACAGGG - Intergenic
975395500 4:73869524-73869546 GGCACTGCTGCTCCTGCTCCTGG + Exonic
980846347 4:138329841-138329863 GGCAAGGCTGCTCCTCCAGCCGG + Intergenic
981889101 4:149715360-149715382 TGCAAGGCTGCAGCTATACCAGG + Intergenic
983885311 4:172974846-172974868 TGCAAGGCTGCAGCTGCACCAGG + Intronic
985504322 5:270497-270519 GGCAGGGCTGCACCACCACCGGG + Intergenic
985529979 5:428445-428467 GGCACAGCTGCCCCTCCAGCTGG + Intronic
985743774 5:1635026-1635048 GGCAGGGCTGCACCACCACCGGG - Intergenic
990510523 5:56485353-56485375 GGCAAGGCTGCACCAACAGTGGG - Intergenic
994692260 5:103033936-103033958 TGCAAGGCTGCAGCTGCACCAGG + Intergenic
1002879929 6:1242310-1242332 GGCAGAGCTGCACGGACACCTGG + Intergenic
1005686752 6:28260275-28260297 GCCATAGCTGCACCTTCACCGGG - Exonic
1006374579 6:33664890-33664912 GGCACCTCTGCACCAACACGTGG + Exonic
1007178806 6:39913761-39913783 GGCACGGCCTCACCTTCACAGGG + Exonic
1007791481 6:44311418-44311440 GGCAGGGCTGGACCCAGACCTGG - Exonic
1018965712 6:168487181-168487203 GGCAAAGCTGCACCTCCACAGGG + Intronic
1022516715 7:30979355-30979377 GGAAGGGCTGCACCTGCCCCGGG - Exonic
1029283918 7:99453371-99453393 GGCACGGCTGCACCTACACCTGG - Intronic
1032858518 7:135857371-135857393 TGCAAGGCTGCAGCTAGACCAGG + Intergenic
1034964712 7:155384003-155384025 GGCTAGGCTGGAACTACACCTGG - Intronic
1035221874 7:157411017-157411039 GGCACGGCAGCCCCTCCAGCCGG + Intronic
1038185711 8:25272932-25272954 TGTACGGCTCCACTTACACCTGG - Intronic
1039403624 8:37294246-37294268 TGCAGGGCTGCACCTAGCCCTGG + Intergenic
1039797751 8:40929674-40929696 GGTTCGGCTGCAGCCACACCAGG + Intergenic
1040834313 8:51716723-51716745 GGCAGCACTGGACCTACACCAGG + Intronic
1041335914 8:56783320-56783342 GGCACAGGTCCACTTACACCTGG + Intergenic
1048893965 8:138972068-138972090 GGTAAGGCTGCACACACACCAGG - Intergenic
1049558606 8:143296352-143296374 AGCACCGCCGCACCCACACCGGG + Exonic
1053128083 9:35599071-35599093 TGAGTGGCTGCACCTACACCTGG - Intergenic
1053346718 9:37383556-37383578 GGCAGGGATGCTCCTCCACCAGG + Intergenic
1053619079 9:39798050-39798072 TGCAAGGCTGCAGCTAGACCAGG + Intergenic
1053895431 9:42737294-42737316 TGCAAGGCTGCAGCTAGACCAGG - Intergenic
1054234454 9:62544323-62544345 TGCAAGGCTGCAGCTAGACCAGG - Intergenic
1054265077 9:62909379-62909401 TGCAAGGCTGCAGCTAGACCAGG - Intergenic
1062024143 9:134332668-134332690 GGCACCCATGCACCTACGCCCGG - Intronic
1062080294 9:134620124-134620146 GTCCAGGCTGCACCAACACCTGG + Intergenic
1062207666 9:135346294-135346316 GGCACTGCTGCAGGCACACCTGG - Exonic
1062429996 9:136522755-136522777 CCCAGGGCTGCCCCTACACCAGG + Intronic
1185867406 X:3636307-3636329 GGCACTGCTGCACATACAAGTGG - Intronic
1186466327 X:9786620-9786642 CGCTCAGCTGCACCTCCACCAGG - Exonic
1191117776 X:56869177-56869199 GGCAAGGCATCACCTTCACCTGG + Intergenic
1195310955 X:103631291-103631313 GGCACAGCTGCTCCTTCTCCTGG + Intergenic
1196849020 X:119919800-119919822 TGCACCACTGCACTTACACCTGG + Intronic
1196850151 X:119930124-119930146 GCCATAGCTGCACCTTCACCAGG + Exonic
1198312685 X:135436898-135436920 CGCACCGCTGCACCTCCACGCGG - Intergenic