ID: 1029288050

View in Genome Browser
Species Human (GRCh38)
Location 7:99479657-99479679
Sequence CCAGGAGCTGCTCTCGTTTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029288047_1029288050 -5 Left 1029288047 7:99479639-99479661 CCTTTATCAGCTACTTTTCCAGG 0: 1
1: 0
2: 1
3: 16
4: 228
Right 1029288050 7:99479657-99479679 CCAGGAGCTGCTCTCGTTTGAGG 0: 1
1: 0
2: 0
3: 10
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029288050 Original CRISPR CCAGGAGCTGCTCTCGTTTG AGG Exonic
900878413 1:5363003-5363025 CCAAAAGCTACTCTCCTTTGGGG + Intergenic
902269009 1:15289608-15289630 CAAGGAGATGTTCTCGTTCGTGG + Exonic
907045251 1:51296648-51296670 CCAGGCCCTGCTCACGTTTCTGG - Intronic
907790561 1:57659456-57659478 CCAGGAGCAGCTGGGGTTTGTGG + Intronic
908563098 1:65326627-65326649 CCAGGAGGTGCTCACTTCTGGGG - Intronic
909136684 1:71810045-71810067 CCATAAGCTGCTCATGTTTGAGG + Intronic
915141431 1:153770938-153770960 CCAGGAGCTGCCCTCGGAGGTGG + Intronic
916446179 1:164874154-164874176 CAAGGAGCTATTCTCTTTTGGGG + Intronic
916683723 1:167126429-167126451 CCAGGCGCTGCTCTCGCTCAGGG - Exonic
920438099 1:205961195-205961217 CCAGGAGCTTCTCTGGGGTGAGG + Intergenic
1063552576 10:7047009-7047031 CAAGGAGGTGCTCATGTTTGTGG + Intergenic
1064247345 10:13679632-13679654 CGGGGAGCTGCTCTGTTTTGAGG - Intronic
1068765068 10:60753866-60753888 CCAGGTGCTGAGCTAGTTTGCGG + Intergenic
1068776717 10:60875180-60875202 CCAGAAGCTGCTCTGATGTGTGG + Intronic
1072735141 10:97874093-97874115 CCTGGAGCTGAGCTCTTTTGAGG + Intronic
1073404430 10:103284866-103284888 CCAGTAGCTGCTCTGGCTTAAGG + Intronic
1073424782 10:103449815-103449837 CCAGGAGCTGTTCTCTGTGGTGG - Exonic
1074745203 10:116525139-116525161 CCAGGAGCTCCTCTATTTGGGGG - Intergenic
1076340996 10:129744721-129744743 CCAGGAGCTCCTGTGGTCTGTGG - Intronic
1077089606 11:772454-772476 CCAGGATCTGTCCTCGTTGGTGG + Exonic
1081703990 11:45169909-45169931 CCAGGCACTGCTCTAGTTTCAGG + Intronic
1084555495 11:69873527-69873549 CCTGGAGCTGCTGTCTATTGTGG - Intergenic
1089053145 11:115563379-115563401 CCAGGAGCTCCTCTATTTGGGGG + Intergenic
1090350889 11:126107094-126107116 CCAGGGGCTGCGCTCCTTTCTGG - Intergenic
1091206324 11:133823658-133823680 CCAGGAGCTGCTCTGGAAGGTGG + Intergenic
1092269594 12:7012768-7012790 CCAGGAAATGATCTGGTTTGGGG - Intronic
1093038938 12:14357543-14357565 CCTGAAGCTGCTCTTGGTTGGGG - Intergenic
1101292919 12:103389382-103389404 TCAGGATCTGCTCTCCTCTGAGG + Intronic
1101740507 12:107496299-107496321 GAAGGAGCTGGTCTGGTTTGAGG - Intronic
1104661129 12:130612160-130612182 CAAGCAGCTGCTCTCCTTGGAGG - Intronic
1105599077 13:21869727-21869749 CCTGAAGCTGCTGTCCTTTGAGG + Intergenic
1109111801 13:58330159-58330181 CCACAATCTGCTCTCATTTGAGG - Intergenic
1112176879 13:97034571-97034593 CCAGGGGCTGCAGTCCTTTGTGG - Intergenic
1114418078 14:22557317-22557339 CCAGGCCCTCCTCTCCTTTGGGG - Intronic
1116981630 14:51176968-51176990 CCAAGAGCTGCCCTCGTGGGAGG - Intergenic
1119259961 14:73232190-73232212 CCAGGAGCTGCTCTCCCCTTTGG + Intergenic
1124453560 15:29821574-29821596 CCGGGAGCTGCTGTCTTTGGAGG - Intronic
1128321034 15:66694545-66694567 CCAGGAGGTGCTCTCTTTTAGGG - Intergenic
1128865308 15:71110660-71110682 CCTGTATCTGCTCTCTTTTGTGG + Exonic
1131565627 15:93483087-93483109 CCAGGATTTGCTCTCTTTTGAGG + Intergenic
1135863236 16:26076697-26076719 CCAGAAGCTGCTATCAATTGAGG - Intronic
1136230146 16:28880911-28880933 CCAGGTGCTGGCCTGGTTTGAGG + Exonic
1137588858 16:49681258-49681280 ACTGCAGCTGCTCTAGTTTGGGG + Intronic
1139667779 16:68470493-68470515 CCTGCAGCTGCTCCCCTTTGTGG - Intergenic
1140424366 16:74848534-74848556 CCAGGAGCTGCTCAAATTTGTGG + Intergenic
1141286990 16:82681783-82681805 CCAGGAGCAGCACTCGGGTGAGG + Intronic
1141675312 16:85514433-85514455 CCAGGAGCTGCCCTGGGGTGGGG - Intergenic
1143029226 17:3958350-3958372 CCAGGAGCTGCTCTGGGTGCTGG - Intronic
1146494615 17:33310421-33310443 GCTGGAGCTGCTCTAGTTTGAGG - Intronic
1147968948 17:44209498-44209520 CCAGGAGCTGCTGTCCAATGGGG - Exonic
1149457002 17:56796521-56796543 CAAGGAGCTGCTTTCTGTTGTGG - Intronic
1156474086 18:37394791-37394813 TCAGGAGCTGCCCTGGTCTGGGG - Intronic
1158335360 18:56410728-56410750 GAAGGAGCTGCTGTCTTTTGGGG + Intergenic
1159608584 18:70499964-70499986 GCCGGAGCTGCTCTTGTCTGAGG + Intergenic
1160672930 19:374804-374826 GCAGGAGCCGCTCTCTTTAGAGG - Intronic
1161373431 19:3926673-3926695 GCAGGAGCTGCTGGCTTTTGGGG - Exonic
1162085073 19:8243786-8243808 GCAGGAGCTACTCAGGTTTGGGG - Intronic
1162105869 19:8369235-8369257 CCAGGAGCTGTTCCAGGTTGGGG + Exonic
1162956678 19:14102706-14102728 TCAGTGGCTGCTCTCTTTTGTGG - Intronic
1163822706 19:19505405-19505427 CCAGGAGGTACTCTCGCTGGCGG - Exonic
1165069361 19:33246935-33246957 CCAGGAGCTGCTCTGGGCAGAGG + Intergenic
1166269325 19:41704297-41704319 CCAGGAGCCGCTCTTCCTTGAGG + Intronic
1166935830 19:46331974-46331996 CCAAGACCTGTTCTAGTTTGGGG - Intronic
1167322449 19:48805545-48805567 CCAGGCTCTACTCCCGTTTGGGG + Intronic
1168172817 19:54600556-54600578 TGAGGAGATGCTCTCGTTTACGG + Intronic
925132422 2:1503247-1503269 CCAGGAGCTGCTCTGTCTGGAGG - Intronic
925891229 2:8436792-8436814 CCAGGTGCGGCTCTGGTTTGGGG - Intergenic
926210188 2:10863476-10863498 CCTGCAGGTGCTCTCCTTTGGGG + Intergenic
927811546 2:26183189-26183211 CCAGGAGCCGCTCTCCTTCTTGG - Intronic
930199077 2:48535428-48535450 CCAGGAGCTGCTTGCCTGTGAGG - Intronic
933165825 2:79073529-79073551 CCAGCAGCTGTTTTCCTTTGTGG + Intergenic
934745703 2:96758179-96758201 CGAGGAGCCTCTCTCCTTTGGGG - Intergenic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
938906470 2:135841517-135841539 CTAGGAGCTCTTCTCATTTGTGG - Intronic
941768343 2:169323820-169323842 CCAGGAGCCTCTCTGGTTTGGGG + Intronic
943706385 2:191039286-191039308 CAATGAGCTGGTCTGGTTTGGGG + Exonic
944354442 2:198769177-198769199 CCATGAGCTGGTCTTGTTTGTGG - Intergenic
1170036542 20:11995871-11995893 CCAGGAGCACCTCTCCTCTGGGG - Intergenic
1175781303 20:61683989-61684011 CCAGGAGCTCCTCGTGTCTGGGG + Intronic
1180149032 21:45938338-45938360 CCAGGAGCTGCTCTCCCTCCTGG + Intronic
1181639071 22:24187422-24187444 CCAGGAGCTGTTCCTGTTTGGGG + Exonic
1181803264 22:25360657-25360679 CCTGAAGCTGCCCTCGTTGGTGG - Exonic
1183455190 22:37918725-37918747 CCAGGAGCTGCCTTCCTTTGGGG + Intronic
1183785029 22:40024295-40024317 CCAGGAGCTCCTCTCCTAAGAGG + Intronic
1184240858 22:43210624-43210646 CCAGGCCCTGCTCTAGTTTCTGG - Intronic
1184643496 22:45884319-45884341 CCAGGCGCTGCTCTCGACTTGGG - Intergenic
1185235048 22:49707345-49707367 CCAGGGGCTGCTCCAGTGTGGGG - Intergenic
951311392 3:21130177-21130199 CAAGGAGCTGCTATCATGTGAGG - Intergenic
952933622 3:38378474-38378496 CCACCAGCTGCTTTCCTTTGCGG - Intronic
953481449 3:43255904-43255926 GCAGGAGCTGCTGTCCTTTTGGG - Intergenic
954410767 3:50369962-50369984 GCAGCTGCTGCTCTGGTTTGTGG - Intronic
954801928 3:53192236-53192258 CCAGGAGGTGCTCGAATTTGGGG - Exonic
958811024 3:98859825-98859847 CGAGGAGCTGCGTTCCTTTGTGG - Intronic
960039418 3:113134478-113134500 CCAAGAGCTGATCCCATTTGAGG - Intergenic
961213697 3:125143839-125143861 GCAGGAGCTGCTCTTGTTATGGG - Intronic
969203299 4:5622736-5622758 CCAGGAGCTGCTCAAGCGTGGGG - Exonic
970243588 4:14035076-14035098 CCAGGAGCTGCTTGTGGTTGGGG + Intergenic
970847830 4:20563613-20563635 CTAGGAGCTGCTCAAATTTGGGG - Intronic
972533305 4:39979253-39979275 CCAAAAGCTGCTCTCTTTTTAGG + Intergenic
973050161 4:45586102-45586124 CCAGGAGGAGCTCTCCATTGTGG - Intergenic
975801056 4:78059091-78059113 CCAGCCGCGGCTCTGGTTTGCGG - Intronic
985468456 5:20611-20633 CGAGGTGCTGCTGTCCTTTGTGG - Intergenic
985506458 5:284351-284373 GGAGGAGCTGTTCTGGTTTGAGG + Intronic
985570189 5:640666-640688 CAAGGAGCTGCCCTCGTTCCTGG - Intronic
986481563 5:8193996-8194018 AGAGGAGCTGCTCTCCTGTGGGG - Intergenic
992781523 5:80132493-80132515 CCAGGAGGTGCTCCAGGTTGGGG - Intronic
997239264 5:132294780-132294802 CCAGGCGCTGCTCAGGTTCGCGG - Exonic
997248332 5:132370136-132370158 CCAGGCGCTGCTCAGGTTCGCGG - Exonic
999282976 5:150376881-150376903 CCAGGTGCTGCCCTTGTCTGGGG + Intronic
999284615 5:150386814-150386836 CCTGGAGATGCCCTCGTGTGCGG + Intronic
1000026484 5:157363344-157363366 CCAGGAGCAGTTCTAGGTTGTGG + Intronic
1006404783 6:33838623-33838645 CCAGGAGCTGCTCGGCCTTGTGG - Intergenic
1006405143 6:33840709-33840731 CCAGGAGCTGTTCCCGTTCTAGG - Intergenic
1009436973 6:63630153-63630175 CCAGCACCTCCTCTAGTTTGAGG + Intergenic
1010747353 6:79578744-79578766 CGAGGAGCTGCAATCCTTTGTGG - Intergenic
1015791036 6:136964739-136964761 CCAGAAGGTGCTCTCTTTTAAGG + Intergenic
1018174982 6:161170736-161170758 ACAGGAGCTGCTTCCATTTGAGG + Intronic
1019999520 7:4747390-4747412 ACAGGAGCTGCTCTCATGTTAGG - Intronic
1022090641 7:27105959-27105981 CGAGGAACTGCTTTCGTCTGGGG - Intergenic
1023583804 7:41708161-41708183 CCAGGTGTTGCTCTCCTGTGAGG + Intergenic
1029288050 7:99479657-99479679 CCAGGAGCTGCTCTCGTTTGAGG + Exonic
1029405799 7:100373489-100373511 CCTGGAGGTGCACTGGTTTGGGG + Exonic
1036160452 8:6382746-6382768 CAAGGAGCTGCGTTCCTTTGGGG - Intergenic
1038035584 8:23683248-23683270 CCAGGAGCTTCTCTCTGTTGCGG - Intergenic
1038834428 8:31103409-31103431 CAAGGCACTGCTCACGTTTGTGG - Intronic
1039403899 8:37296392-37296414 CCAGGAGCAGCTCTGGCTTCTGG - Intergenic
1045998677 8:108393991-108394013 GTAGCAGCTGCTCTAGTTTGAGG + Intronic
1047803882 8:128338582-128338604 CAAGGAGTTGGTCTGGTTTGGGG - Intergenic
1049041660 8:140116686-140116708 CCAGGCGCTGCCCACGTCTGGGG + Intronic
1049360107 8:142208447-142208469 CCAGGAGATCCTCTGGGTTGTGG - Intergenic
1049644123 8:143728473-143728495 ACAGGAGGTGCGCTCGTTTAGGG + Exonic
1051842858 9:21417984-21418006 CCAGGAGTTGCTCTTCTGTGAGG + Intronic
1056831090 9:89918142-89918164 CCAGGTGCTGCTCTGGGATGGGG - Intergenic
1058653368 9:107197677-107197699 TCAGGGGCTGCTCTAGTGTGGGG - Intergenic
1059925082 9:119201513-119201535 TAAAGAGCTGCTCTCGTTTAAGG + Intronic
1061419986 9:130467890-130467912 CCAGAAGCTGCTTTTGTCTGGGG - Intronic
1061779491 9:132987358-132987380 CCAGCTCCGGCTCTCGTTTGAGG - Exonic
1062457707 9:136647230-136647252 CCAGGAGCTGCCCTTGGCTGAGG + Intergenic
1203442781 Un_GL000219v1:27005-27027 CCAGGAGCTTCACTTGTGTGAGG + Intergenic
1203513589 Un_KI270741v1:145914-145936 CCAGGAGCTTCACTTGTGTGAGG + Intergenic
1186486457 X:9937599-9937621 CCAGGAGGTGCTCGTCTTTGGGG - Exonic
1189134215 X:38532428-38532450 CCAGGAGCTGCTGTCCAATGGGG - Intronic
1195857590 X:109347860-109347882 CCAACAGCTTCTCTCTTTTGAGG + Intergenic
1197345535 X:125322714-125322736 CCAGGAGGTGGTCTCCTTGGGGG + Intergenic
1197489776 X:127102555-127102577 CCAGGAGATTCTCTCCTGTGTGG + Intergenic
1198102910 X:133437397-133437419 CCAGACCCTGCTCTCGTATGTGG + Intergenic