ID: 1029288573

View in Genome Browser
Species Human (GRCh38)
Location 7:99484167-99484189
Sequence GAGTGGAATCAGGAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 799
Summary {0: 1, 1: 0, 2: 3, 3: 70, 4: 725}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029288566_1029288573 4 Left 1029288566 7:99484140-99484162 CCAGGTGGGTGAGGAAGAGACCC 0: 1
1: 0
2: 0
3: 15
4: 251
Right 1029288573 7:99484167-99484189 GAGTGGAATCAGGAAGAGGAAGG 0: 1
1: 0
2: 3
3: 70
4: 725
1029288562_1029288573 18 Left 1029288562 7:99484126-99484148 CCGGTAGTGCTTGCCCAGGTGGG 0: 1
1: 0
2: 1
3: 5
4: 104
Right 1029288573 7:99484167-99484189 GAGTGGAATCAGGAAGAGGAAGG 0: 1
1: 0
2: 3
3: 70
4: 725
1029288565_1029288573 5 Left 1029288565 7:99484139-99484161 CCCAGGTGGGTGAGGAAGAGACC 0: 1
1: 0
2: 0
3: 26
4: 259
Right 1029288573 7:99484167-99484189 GAGTGGAATCAGGAAGAGGAAGG 0: 1
1: 0
2: 3
3: 70
4: 725

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029288573 Original CRISPR GAGTGGAATCAGGAAGAGGA AGG Intronic
900290632 1:1922168-1922190 TATTGGAATCTGGCAGAGGATGG + Exonic
900508657 1:3044878-3044900 GAGTGGAAGGAGGGAGAGGATGG - Intergenic
901264919 1:7903041-7903063 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264928 1:7903068-7903090 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264937 1:7903095-7903117 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264946 1:7903122-7903144 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264951 1:7903140-7903162 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264960 1:7903167-7903189 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264965 1:7903185-7903207 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264974 1:7903212-7903234 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264983 1:7903239-7903261 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264988 1:7903257-7903279 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264997 1:7903284-7903306 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265006 1:7903311-7903333 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265011 1:7903329-7903351 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901447913 1:9319418-9319440 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
901679797 1:10906397-10906419 CAGTGGGCTCAGGGAGAGGAAGG - Intergenic
902563365 1:17292898-17292920 GAGGGGAATGGGGAAGGGGAGGG + Intergenic
902687699 1:18089592-18089614 CAGTGGGATCAGGACCAGGAAGG + Intergenic
902750580 1:18506802-18506824 AAGTGGAATGAGGAAGAGGGAGG - Intergenic
902769468 1:18637262-18637284 GAGGGCAATGAGGAAGGGGAGGG - Intronic
902886385 1:19407832-19407854 GCAAGCAATCAGGAAGAGGAGGG + Intronic
903137078 1:21316562-21316584 AACTGGAATCAGGCCGAGGATGG - Intronic
903491845 1:23735003-23735025 GAGTGGAATAAGAAAGGGGAAGG - Intergenic
903572391 1:24315892-24315914 GAATGGAATCAGAAAGATGTGGG + Intergenic
903679794 1:25089229-25089251 GAGTGGGAGCAGGATGGGGAGGG + Intergenic
904801501 1:33096258-33096280 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
904920131 1:34000958-34000980 GAGTAGAAAGAGGAGGAGGAAGG + Intronic
905791009 1:40789533-40789555 GAGTGCAAGGAGGAGGAGGAAGG - Intronic
906026799 1:42681337-42681359 GAGTGGAAGCAGGGAGAAGGTGG - Intergenic
906700884 1:47857274-47857296 GAGTGGCTTCAGGAAGGGGGAGG - Intronic
906938746 1:50237250-50237272 GGTTGGCAGCAGGAAGAGGATGG - Intergenic
907164067 1:52394580-52394602 GAGTTGAAAGAGGAAGAAGAGGG + Intronic
907359747 1:53904894-53904916 AGGTGGAAGGAGGAAGAGGAGGG + Intronic
908590664 1:65629624-65629646 GAATGGAGGGAGGAAGAGGAAGG - Intronic
909179101 1:72398005-72398027 GAGTGGTATCAGGGACAGTATGG - Intergenic
909897327 1:81089055-81089077 GAGATGAATCATGAAGAGGAGGG - Intergenic
910479350 1:87641462-87641484 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
910484787 1:87701244-87701266 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
910918596 1:92318676-92318698 AAGTGGAATCAGTAAGATAAAGG - Intronic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
911809708 1:102260424-102260446 GAGAGGAAGTACGAAGAGGAGGG + Intergenic
911991280 1:104699738-104699760 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
912285589 1:108365157-108365179 GAGTGGGAGCAGAAAGAGGAAGG - Intergenic
912795768 1:112692714-112692736 GAGTGGGGGCAGGAACAGGATGG - Intronic
912953772 1:114138171-114138193 AAGTGGGGTCAAGAAGAGGAAGG - Intronic
912977900 1:114346391-114346413 GAGAGGAATCTGGAAGAAGGAGG - Intergenic
913045749 1:115072324-115072346 GAGAAGAATGAGGGAGAGGAGGG - Intronic
913072330 1:115310900-115310922 GAGTGGGAGGAGGAGGAGGAAGG + Intronic
913148655 1:116017788-116017810 GAAGGGGACCAGGAAGAGGAAGG + Intronic
915945064 1:160143823-160143845 GGGTGGGATCAGCATGAGGAAGG - Intergenic
916126882 1:161579625-161579647 GAGGGGAAAGAGGAAGAGTATGG - Intergenic
916136801 1:161661429-161661451 GAGGGGAAAGAGGAAGAGTATGG - Intronic
916875463 1:168963991-168964013 GAGGAGAAACAGGAAAAGGAAGG - Intergenic
916924866 1:169507549-169507571 GAGTGCATTGAGGAGGAGGATGG + Intergenic
917452885 1:175161862-175161884 AAGGGTAATGAGGAAGAGGAAGG - Intronic
917654747 1:177115017-177115039 GAGAGGTAGAAGGAAGAGGAAGG + Intronic
918289316 1:183091492-183091514 GAGGGGAAGGAGGAAGAGGAAGG - Intronic
918460308 1:184769730-184769752 AAGTGGAAAGAGAAAGAGGAAGG + Intergenic
919883847 1:201918491-201918513 GAGTGCAGGCAGGAAGGGGAGGG - Intronic
919997096 1:202762245-202762267 GAAAGGAAGAAGGAAGAGGAAGG - Intronic
920233927 1:204490193-204490215 GAGAGTTCTCAGGAAGAGGAAGG + Exonic
921310313 1:213835788-213835810 GAGTGAGAAGAGGAAGAGGAGGG + Intergenic
921310365 1:213836480-213836502 GAGTGGGAAGAAGAAGAGGAAGG - Intergenic
921619723 1:217312230-217312252 GAGTTGAATGAGGATGTGGAGGG - Intergenic
922574886 1:226654937-226654959 GAGGGGGAGGAGGAAGAGGAGGG + Intronic
922990889 1:229910175-229910197 GTGTGGAAACAGCAAGAAGAAGG + Intergenic
923355137 1:233147463-233147485 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
924198823 1:241639669-241639691 GAGGGGACGGAGGAAGAGGAAGG + Intronic
924658870 1:245997962-245997984 CAGTGGGATCAGAAAGAGGTTGG - Intronic
924852601 1:247845322-247845344 CAGTGGATCCAGGAAGAGGGAGG - Intergenic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1063901505 10:10737619-10737641 AAGGGGATTCAGGCAGAGGATGG - Intergenic
1064227475 10:13500257-13500279 GAGAGGCACCAGGAATAGGATGG - Intronic
1064621820 10:17224962-17224984 GAGTGGATCCAGGAAGAGCGGGG + Intergenic
1064729154 10:18311690-18311712 GAGTGGGCTAAGGAAGAGGAGGG + Intronic
1064753969 10:18558328-18558350 GAATGGAATGAGGAATGGGATGG + Intronic
1065098703 10:22311116-22311138 GGGGGGAAAGAGGAAGAGGAAGG - Intergenic
1065506363 10:26433853-26433875 GAGTAGGAGGAGGAAGAGGAGGG - Intergenic
1065704901 10:28463833-28463855 GAGTGGAATGAGGAAGCTGGGGG + Intergenic
1066321016 10:34303987-34304009 GGGTGGGAACAGGAAGAGGCAGG + Intronic
1066351711 10:34642367-34642389 GGGTGGATCAAGGAAGAGGAGGG - Intronic
1066547481 10:36516479-36516501 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1067262304 10:44704745-44704767 GACTGGAAACTGGAAGAAGAGGG + Intergenic
1067462869 10:46470748-46470770 GGGTGGGAGCAGGAAGAGAAAGG + Intergenic
1067511483 10:46898505-46898527 CAGTGGGATTAAGAAGAGGACGG + Intergenic
1067624325 10:47913890-47913912 GGGTGGGAGCAGGAAGAGAAAGG - Intergenic
1067650763 10:48153359-48153381 CAGTGGGATTAAGAAGAGGACGG - Intergenic
1068515417 10:58019894-58019916 GAGGGCAATCAGGAAGATGAGGG - Intergenic
1068564058 10:58551627-58551649 GTGTGGAATTAGGAAGATGTTGG - Intronic
1068874790 10:61984580-61984602 GAGTGAAAGGAGGAAGATGAAGG + Intronic
1068956571 10:62823889-62823911 GAGAGGAGTCAGGAAGGAGAGGG - Intronic
1069618053 10:69818767-69818789 GAGTAGAACAAGGTAGAGGAAGG - Intronic
1069718521 10:70535600-70535622 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1070366520 10:75742298-75742320 GAGTTGAAGCAGGCAAAGGAAGG + Intronic
1070813423 10:79309663-79309685 TAGGAGAAACAGGAAGAGGAAGG + Intronic
1070972570 10:80579600-80579622 GAGTAAAACCAGGAAGAGGTGGG - Intronic
1071411361 10:85400032-85400054 AAGTGGACTGAGGAAGGGGAAGG + Intergenic
1072009172 10:91288497-91288519 GAATTGGATCTGGAAGAGGAGGG - Intergenic
1072026375 10:91463355-91463377 GAGTAGGCTGAGGAAGAGGAGGG + Intronic
1072624844 10:97104677-97104699 GTGTGGATTCAGGGAGAGGGAGG - Intronic
1072911808 10:99508872-99508894 GAGTGGGAGAAGGAGGAGGATGG - Intergenic
1073112827 10:101072731-101072753 GAGGGGAGTCAGGAAAGGGAGGG + Intergenic
1073173549 10:101534527-101534549 GAGTGGGAGAAGGAAGGGGATGG - Intronic
1073249943 10:102115059-102115081 GAGAGGAAAGAGGAAGAGCAAGG + Intronic
1073327496 10:102651101-102651123 GAGTGAGAGCAGGAAGAGGAAGG - Intronic
1073758963 10:106610219-106610241 CCTTGGAATAAGGAAGAGGATGG + Intronic
1074614545 10:115054103-115054125 GAGGGCAAAGAGGAAGAGGAGGG - Intergenic
1076293198 10:129363555-129363577 GGGAGGAATCAGGAAGGGGATGG - Intergenic
1076897907 10:133323142-133323164 GAGAGGAAGCAGGAGAAGGATGG - Intronic
1077951714 11:6966335-6966357 GGGTGGTATGAGGATGAGGATGG + Intronic
1078713981 11:13822001-13822023 CAGGGGAATCAGGCAGAAGAAGG - Intergenic
1078715716 11:13837180-13837202 GATTGGAATCAGGAAGATAAGGG + Intergenic
1078744353 11:14097014-14097036 GAGTGGGATGGGGGAGAGGAAGG - Intronic
1079182155 11:18203507-18203529 AAGTGGAAGGAGGAAGAAGAAGG + Intronic
1080360277 11:31505730-31505752 GAGCAGAAGGAGGAAGAGGAGGG - Intronic
1080475821 11:32590029-32590051 GAGTGTGATAAGCAAGAGGAAGG - Intronic
1081790131 11:45776572-45776594 GACTGGTATAAGGAAAAGGAAGG - Intergenic
1082198705 11:49335914-49335936 GAGGGGAAGGAGGCAGAGGAGGG + Intergenic
1083061436 11:59876948-59876970 GAGTGGGGTTAGCAAGAGGAAGG - Intergenic
1083621943 11:64053582-64053604 GAGTGGGAGCAGGAAGTGGGAGG + Intronic
1084341561 11:68506716-68506738 GAGAGGAATGGGGAAGATGATGG - Intronic
1084742715 11:71149938-71149960 GAGGGGAAGGAGGGAGAGGAGGG + Intronic
1085177669 11:74505040-74505062 GACAGGAAGCAGGGAGAGGAGGG + Intronic
1085794722 11:79528559-79528581 GAGTGGAAGCTGGTGGAGGAAGG - Intergenic
1085842071 11:80023587-80023609 GTGTGTCATCAGGAGGAGGATGG - Intergenic
1085919714 11:80938178-80938200 CAGGGGAATCAGTGAGAGGAGGG - Intergenic
1086302936 11:85448923-85448945 GAGTGGAAGGAAGAGGAGGAGGG - Intronic
1086322620 11:85666082-85666104 GTGTGTATTCAGGAAGACGAAGG - Intronic
1086872021 11:92049249-92049271 AAGTGGAGTAAGGGAGAGGAGGG - Intergenic
1088645476 11:111913320-111913342 GAGGGGAGTCAGGAGGAGTAGGG - Intronic
1089057138 11:115594835-115594857 GACTGGAATCATGAGGATGAGGG - Intergenic
1089067293 11:115671410-115671432 GAGGGGAAGAAGGAAGAGGATGG - Intergenic
1089175153 11:116543334-116543356 GGATGGATTCAGAAAGAGGAGGG + Intergenic
1089451608 11:118601975-118601997 GAGTGCAGTCTGGAAGAGGGAGG - Exonic
1090668740 11:128931324-128931346 TAGTGGAAAGAGGAAGAGGCGGG + Intergenic
1090798636 11:130156739-130156761 TCCTGGAACCAGGAAGAGGATGG + Intergenic
1091033412 11:132211736-132211758 GAGTGGATACAGGAAGAGGGTGG + Intronic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1091635624 12:2194372-2194394 GAGGGGGAGCAGGAAGGGGAAGG - Intronic
1091635631 12:2194390-2194412 GGGGACAATCAGGAAGAGGAGGG - Intronic
1091636289 12:2199340-2199362 GAGTAGACTGAGGAGGAGGAAGG - Intronic
1091676862 12:2497641-2497663 GGGTGGTGTCAGGAAGAGGGTGG - Intronic
1092168842 12:6360686-6360708 GAGTGGAGCCAGGCAGAGGCAGG + Intronic
1092395428 12:8121789-8121811 GAGTGCAAGCAGGGTGAGGAGGG + Intergenic
1092728134 12:11504450-11504472 GAAGGGCAGCAGGAAGAGGAAGG + Intergenic
1092786737 12:12033256-12033278 GTGTGGAATCAGGACGTGGCTGG - Intergenic
1092882889 12:12901487-12901509 AAGGGGAGTCAGGAGGAGGACGG - Intronic
1092967530 12:13658931-13658953 GAGTGGAATCAGCAAAGGAAAGG - Intronic
1094172316 12:27506433-27506455 GAGTGGAATATGAAAAAGGAAGG - Intergenic
1095440838 12:42237878-42237900 GAAGGGAGTCAGGAAGAGGCAGG + Intronic
1095769892 12:45941938-45941960 GAGTGGGCTAAGGAAGAGAAGGG - Intronic
1096322524 12:50627835-50627857 GTGTGGCATCAGGAAGTTGAAGG - Intronic
1096648974 12:53052774-53052796 GAGGAGAATGAGGAGGAGGAAGG + Intronic
1096665165 12:53159715-53159737 GAGAGGAATGAGAAAGAGGAAGG + Intronic
1096896106 12:54821822-54821844 GAGTGGGCACAGGGAGAGGAGGG + Intergenic
1097008598 12:55936618-55936640 GGGTGTAATGAGGAGGAGGAGGG - Intronic
1097170365 12:57109595-57109617 GAGAGAACTAAGGAAGAGGATGG + Intronic
1097904376 12:64905032-64905054 GTGTGCATGCAGGAAGAGGAGGG - Intergenic
1098285137 12:68899162-68899184 GTGTGGATTCAGAAAGTGGAAGG + Intronic
1098544810 12:71700005-71700027 GATTGACATCAGGAAGAGGTTGG + Intronic
1098568227 12:71959078-71959100 CAGTATAAGCAGGAAGAGGAGGG - Intronic
1098986075 12:77013735-77013757 GAGTAGGCTGAGGAAGAGGAAGG - Intergenic
1099169758 12:79349404-79349426 GAGTGGAATAACCAAGTGGATGG + Intronic
1099727783 12:86456070-86456092 GAGAAGAATGAGGAATAGGAAGG - Intronic
1100365322 12:93915176-93915198 GAGAGGGCTCAGGATGAGGAAGG + Intergenic
1100384715 12:94095133-94095155 GAGCGGGAGGAGGAAGAGGAAGG + Intergenic
1101725884 12:107387902-107387924 GAGGGGAAGCAGGAAGATGAGGG - Intronic
1101870382 12:108560973-108560995 GCGTGGGATCAGCAGGAGGAAGG - Exonic
1102555005 12:113720947-113720969 GAGTGGGAGAAGGGAGAGGAGGG + Intergenic
1103160334 12:118723865-118723887 GAGGAGGATGAGGAAGAGGAGGG - Intergenic
1103929203 12:124440274-124440296 CATTGGAAACAGGAAAAGGAGGG + Intronic
1103990410 12:124795328-124795350 GACTGGGACCAGGGAGAGGAGGG - Intronic
1104023873 12:125012184-125012206 TAGAGAAATCAGGCAGAGGAAGG + Intronic
1104294651 12:127500881-127500903 GAGTTTAATCAGGAATAGCAGGG - Intergenic
1104325186 12:127789144-127789166 GAGTTTCATCAGGTAGAGGAGGG + Intergenic
1104379736 12:128296713-128296735 GAGTGTCATGAGGAAGAAGATGG + Intronic
1104499060 12:129267090-129267112 GAGTATAATGAGGAAGAGAAGGG - Intronic
1104541685 12:129671702-129671724 GAGTGGGAGCACGGAGAGGAAGG + Intronic
1104733010 12:131119003-131119025 CAGTTGTGTCAGGAAGAGGATGG + Intronic
1104815569 12:131643740-131643762 GAGGGGACTCAGGCAGAGCATGG + Intergenic
1104982213 12:132578447-132578469 GAGTGGGCTGAGGAGGAGGAGGG + Intronic
1105738332 13:23295708-23295730 GAGAGGAAGAAGGAGGAGGAAGG - Intronic
1105853388 13:24355300-24355322 GGGTGGACACAGGAAGAGGACGG + Intergenic
1105967724 13:25399723-25399745 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1106108743 13:26759192-26759214 GAGCGCAAACATGAAGAGGAAGG + Exonic
1106250946 13:27981084-27981106 GTGAGGAATCAGGTAGAGGATGG + Intronic
1106323423 13:28663818-28663840 CAGTCCAATCAGGAAGAAGAAGG - Intronic
1107021961 13:35761095-35761117 GTGTGGAATGATGAAGTGGAAGG + Intergenic
1107050399 13:36041460-36041482 GAGTGAAATCTGTAAGATGAAGG - Intronic
1107796307 13:44055628-44055650 GAGTGGAAAGAGGAAGGGGATGG + Intergenic
1108045174 13:46377044-46377066 GAGTGGAACTAGTAAGAGAAAGG - Intronic
1110168434 13:72471549-72471571 GAGTGGCAATTGGAAGAGGATGG - Intergenic
1110306332 13:73991673-73991695 AAGTGGAATCAAAAAGAGGCAGG - Intronic
1110504297 13:76267558-76267580 AGGTGGAAGCAGGAAGAGCAAGG - Intergenic
1111233275 13:85372761-85372783 GAGAGGAAACAAGAGGAGGAGGG - Intergenic
1112103602 13:96216948-96216970 GAGGGAAATCAGGAATCGGAAGG - Intronic
1112164729 13:96906148-96906170 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1112311071 13:98317982-98318004 GAGGAGGATGAGGAAGAGGAAGG - Intronic
1112416426 13:99206882-99206904 GAGAGGGAGCAGGAAGCGGAAGG - Intronic
1112542282 13:100326671-100326693 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1112884510 13:104152082-104152104 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1113088881 13:106596695-106596717 GAGTGGGCTGAGGAAGAGGCTGG + Intergenic
1113163936 13:107416428-107416450 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1113909876 13:113836721-113836743 GAGGGGAATGAGGAGGAGGAGGG + Intronic
1114482441 14:23044188-23044210 GAGTGGGAGCAGGGACAGGAGGG - Exonic
1114640389 14:24215789-24215811 GAGTGTAATCTGCGAGAGGAAGG + Exonic
1115126313 14:29998710-29998732 GAGTGTAGTCAGCAAGTGGAGGG + Intronic
1115353797 14:32425626-32425648 GAGAGGAATGAAGGAGAGGAAGG + Intronic
1115758724 14:36556590-36556612 GGGTGGGATGAGGAAGAGCAAGG + Intergenic
1116529769 14:45955805-45955827 AAGTGGACTGAGGACGAGGATGG - Intergenic
1117636895 14:57753734-57753756 GTGGAGAATCAGGAAGAGGTTGG - Intronic
1117978144 14:61318585-61318607 GAAGGGAATGAGGAAGAGGACGG - Intronic
1118331377 14:64818399-64818421 GAGTGGAAGGAGGGAGGGGAGGG + Intronic
1118348957 14:64960051-64960073 GAGTCACAGCAGGAAGAGGATGG - Intronic
1118655625 14:67945102-67945124 GATAAGAATCAGGAAGAGTAAGG + Intronic
1118805828 14:69236216-69236238 GAGTGAGATAAGGAAGAGGGAGG + Intronic
1118981835 14:70723379-70723401 GAGAGGAAACAGGGCGAGGAAGG + Intronic
1119421877 14:74512068-74512090 GAGTGGCAACAGGAAGAGGAGGG + Intronic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1120106589 14:80502279-80502301 GAGTGAAACAAGAAAGAGGAAGG + Intronic
1120177222 14:81307669-81307691 GAGTAGGCTGAGGAAGAGGAGGG - Intronic
1120527581 14:85595044-85595066 GAGGGGGAGGAGGAAGAGGAGGG + Intronic
1120790772 14:88579542-88579564 GAGTGGAATCAGATGGAGCAGGG + Intronic
1120932170 14:89859767-89859789 CAGAGGAAACAGGCAGAGGAGGG + Intronic
1122085328 14:99296996-99297018 GAGTGGAGAGAGGAAGAGGAGGG - Intergenic
1122309615 14:100786213-100786235 GAGAGGAAACAGGAAGGGGCAGG + Intergenic
1122414436 14:101542104-101542126 GGGAGGCATTAGGAAGAGGAAGG - Intergenic
1122647933 14:103207386-103207408 GAGGGGAAGGAGGAAGGGGAAGG - Intergenic
1122678704 14:103439245-103439267 AAGGGGAATCAGGTTGAGGAGGG - Intronic
1122842160 14:104471254-104471276 GGGTGGATGCAGGAAGAGGAGGG + Intergenic
1122966036 14:105126494-105126516 GAGAGGAAGAAGGATGAGGAAGG + Intergenic
1123796768 15:23780506-23780528 GAGTGGAAGCAGGAACATGATGG + Intergenic
1124901327 15:33825701-33825723 GATTTTAATCAGGAAGAGAATGG - Intronic
1125337151 15:38638006-38638028 GAGTGAAGTCAAGGAGAGGAAGG - Intergenic
1125764338 15:42123251-42123273 GAGTGGGGGCAGGAAGAGGCAGG - Intergenic
1126212279 15:46113363-46113385 GAGTATAAGCAGGAAGAGGCTGG - Intergenic
1126280841 15:46947733-46947755 GAATGGAGGCAGGAAGAGGGTGG - Intergenic
1126378933 15:48026210-48026232 GAGTGGAAGTGGGAAGAGAAAGG - Intergenic
1127402372 15:58602334-58602356 GAGTGCAAGTAGGATGAGGAAGG - Intronic
1127960319 15:63885669-63885691 GAATGTAGTCAGGAAGAGGAGGG - Intergenic
1128105406 15:65040651-65040673 AAGAGGAATGAGGAAGTGGAGGG + Intergenic
1128113999 15:65094252-65094274 GAGGGAGATCAGGAAGAGGTGGG - Intronic
1128877210 15:71212150-71212172 GAGTAGAAACAGAAAGAGAAAGG - Intronic
1129524971 15:76208086-76208108 GTTTGGTGTCAGGAAGAGGATGG + Intronic
1130226001 15:82058842-82058864 GAGTAGAGAAAGGAAGAGGAGGG - Intergenic
1131014151 15:89043506-89043528 AAGAGGAAGGAGGAAGAGGAGGG + Intergenic
1131437826 15:92437394-92437416 GAGTGGGGTCAGGAAAGGGATGG - Intronic
1131456235 15:92584710-92584732 GAGTGGGATCTGAAAGACGATGG - Intergenic
1131597108 15:93809208-93809230 GAGTAGACTGAGGAAGAGGAGGG + Intergenic
1131935118 15:97495459-97495481 GTGTAAAATCAGGGAGAGGAAGG - Intergenic
1131967436 15:97859173-97859195 GAGTGGGGTGAGAAAGAGGAGGG - Intergenic
1132220293 15:100100256-100100278 GAGTCGAAGAAGCAAGAGGAGGG - Intronic
1132868227 16:2104220-2104242 GAGGGGGATGAGGAAGATGAGGG + Intronic
1135127694 16:19824748-19824770 AAGATGAACCAGGAAGAGGAAGG + Intronic
1137545286 16:49398663-49398685 GAATGGCATTAGGAAGAAGATGG - Intronic
1137720406 16:50624539-50624561 AATTGGAAACAGGAAGTGGAGGG - Intronic
1138065331 16:53935160-53935182 GAGAGGAATCAGGAAGCGTATGG + Intronic
1138157863 16:54722524-54722546 GAGTGGACACATGAAGAGGTGGG + Intergenic
1138173327 16:54873556-54873578 CAGTGGGATCACGAAGGGGAAGG - Intergenic
1138217239 16:55214833-55214855 GGGAGGAATGAGGAAGAGGAAGG + Intergenic
1139277159 16:65738626-65738648 GAGTTGAATTTGGAAGAGCAGGG + Intergenic
1139941695 16:70610248-70610270 GAGAGGGATCTGGGAGAGGAGGG + Intronic
1139946325 16:70644890-70644912 AAGAGGAAGGAGGAAGAGGAGGG + Intronic
1140731212 16:77858287-77858309 GATTGGAAGAAGAAAGAGGAAGG + Intronic
1140751067 16:78024390-78024412 GAGTGGGAGGAGGAAGGGGAGGG - Intronic
1140874409 16:79137711-79137733 GAGTGGGGGCAGGAAGGGGATGG - Intronic
1141046998 16:80724209-80724231 GAGAAGAAAGAGGAAGAGGAGGG + Intronic
1141226446 16:82120668-82120690 GAGTGGTATGAGGGTGAGGATGG + Intergenic
1141535267 16:84674942-84674964 GAGGAGAAGAAGGAAGAGGAGGG - Intergenic
1141814177 16:86398160-86398182 GAGTGGATACAGGAAGGAGAGGG + Intergenic
1141891803 16:86930998-86931020 GAGTGGGATGAAGAGGAGGAGGG - Intergenic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1142310792 16:89312371-89312393 GAGAGGAATCACGCAGGGGAGGG + Intronic
1142368548 16:89664416-89664438 GGGTGGAATGAGGAAGAGGGAGG + Intronic
1142521374 17:507249-507271 GAGTGGCATCAGGAAAAGCAGGG + Intergenic
1143391349 17:6561031-6561053 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391375 17:6561128-6561150 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143391467 17:6561436-6561458 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143570619 17:7755707-7755729 GAGTGGCAGCTGGAACAGGAAGG + Intronic
1143772641 17:9178457-9178479 GAGGAGAATTAGGAAGAGGAGGG - Intronic
1143963429 17:10739000-10739022 GAGTGGAAGAGAGAAGAGGAAGG - Intergenic
1144047321 17:11465671-11465693 GAGTGAGATCAGGCAGAGGAGGG - Intronic
1144126806 17:12210497-12210519 GAGAGGAAGAAGGAAGAGGAAGG - Intergenic
1144133905 17:12274476-12274498 GAGTAGGCTGAGGAAGAGGAGGG - Intergenic
1144187672 17:12811420-12811442 GAGAGGGAGAAGGAAGAGGATGG + Intronic
1144783341 17:17818662-17818684 CAGAGAAAGCAGGAAGAGGATGG - Intronic
1145980393 17:29007706-29007728 GTGTGGAATTAGGAAGACGCTGG + Intronic
1146606310 17:34260909-34260931 GAGTGGCTTCAGGAAGAGAGTGG + Intergenic
1147544282 17:41388200-41388222 GAGTGACATCAGCAAGATGAGGG - Intronic
1147999054 17:44377042-44377064 GTGGGGAATCTGGAAGAGGCTGG - Exonic
1148734215 17:49855665-49855687 GATTGGGAGGAGGAAGAGGAAGG + Intergenic
1148735798 17:49864267-49864289 GAGTGGGGTCAGGGAGAAGAAGG + Intergenic
1148877687 17:50700571-50700593 GAGAGAAATCAGGAAGATTATGG - Exonic
1149267661 17:54945064-54945086 CATTGGAATCTGGAAGAGGCAGG - Intronic
1150023354 17:61644193-61644215 GAGAGGAAAAAGGAAAAGGAAGG - Intergenic
1150517572 17:65830140-65830162 GAGTGGCATCAGCAAGATGGTGG + Intronic
1150794706 17:68228229-68228251 GAGTGGCATCAGGAAAGGGTAGG - Intergenic
1151499835 17:74481593-74481615 GGGTGGAGGCAGGAAGGGGAAGG + Intronic
1151765340 17:76130811-76130833 GAGAGGGAAGAGGAAGAGGATGG - Intergenic
1152336879 17:79703703-79703725 GAGAGGGGTCAGGAGGAGGAAGG + Intergenic
1152382066 17:79947229-79947251 GAGTGCAGACAGGAAGAGGAGGG - Intronic
1152631125 17:81411115-81411137 GAATGGACTCACGCAGAGGACGG - Intronic
1153530430 18:6040778-6040800 GAGTGGAGCCAAGAATAGGATGG - Intronic
1153576546 18:6527513-6527535 GAAGGGAAGCAGGAATAGGAGGG + Intronic
1153860369 18:9197764-9197786 GAGTAGACTGAGGAAGAGGAGGG + Intronic
1153919878 18:9779033-9779055 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
1153973580 18:10247615-10247637 GAGAGGAATATGGAAGAGGCTGG + Intergenic
1154299277 18:13178795-13178817 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1155497161 18:26454064-26454086 GTCTGGAATGAGGAAGAGGAGGG + Intergenic
1155529992 18:26757379-26757401 TTGTTGAACCAGGAAGAGGAAGG + Intergenic
1155923450 18:31628985-31629007 GAGTAGGCTAAGGAAGAGGAGGG - Intronic
1156463242 18:37333362-37333384 GAGGGGAAGAAGGGAGAGGAGGG - Intronic
1156502537 18:37568594-37568616 GGGTGGTGGCAGGAAGAGGAGGG - Intergenic
1156511630 18:37641601-37641623 GCCTGGAAAGAGGAAGAGGAAGG - Intergenic
1157095284 18:44680820-44680842 GAGTGGACTCGGGAGGGGGAGGG + Intronic
1157107369 18:44787167-44787189 GAGTGGAACTAGGATGAGAAAGG + Intronic
1157824691 18:50802284-50802306 GACTGGAAGCAGGGAGAGGTGGG - Intronic
1158471303 18:57739364-57739386 CAGTGGTAGCAGGAAGAGGAGGG - Intronic
1158666543 18:59437999-59438021 GAGTGGCATCAGGAAGGGGCGGG + Intronic
1158946639 18:62452658-62452680 GAAAGGAATCTGTAAGAGGAGGG - Intergenic
1159422954 18:68247099-68247121 GAGGCGAATCATGAATAGGAGGG + Intergenic
1160173994 18:76578676-76578698 GAGGGGAAGGAGGAAGACGAGGG - Intergenic
1160174003 18:76578712-76578734 GCGGGGAAGGAGGAAGAGGAGGG - Intergenic
1160174569 18:76582189-76582211 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1160174579 18:76582225-76582247 GAGGGGAAGGAGGAAGACGAGGG - Intergenic
1160274884 18:77421995-77422017 GAATTGAATAAGGATGAGGAAGG - Intergenic
1160585707 18:79912130-79912152 GAGTGGGAGCAGGGAGGGGACGG + Intronic
1160667888 19:341710-341732 AAGTGGAAGCAGGAAAAAGAGGG + Intronic
1161635894 19:5388692-5388714 GAGGGGAATCGGGCAGGGGAGGG + Intergenic
1161725144 19:5924303-5924325 GGGTGGAATCAGGAAGAAAAAGG + Intronic
1161993705 19:7699516-7699538 GTGTTGAATCAGAAAAAGGAGGG + Intronic
1161998469 19:7729156-7729178 GAGTGGAGTTAGGATGAGGTCGG + Exonic
1162080490 19:8214966-8214988 GAGGAGAAAAAGGAAGAGGAGGG + Intronic
1162080503 19:8215008-8215030 GAGGAGAAAAAGGAAGAGGAGGG + Intronic
1162607777 19:11724456-11724478 GAGTGGGCTGAGGAAGGGGAGGG - Intronic
1162838145 19:13335222-13335244 GAAGGGAAACAGGAAGAGGTGGG - Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163667259 19:18609117-18609139 GGGCGGAATGAGGGAGAGGAGGG - Intronic
1163673343 19:18642235-18642257 GAGTGGAAGGATGAAGAGGAAGG - Intronic
1163717374 19:18880001-18880023 GGGTGGATCCAGGAAGGGGAGGG - Intronic
1163775619 19:19215586-19215608 GTGTGAAGTCAGGAGGAGGATGG + Intronic
1163779630 19:19239632-19239654 GAGTGGAAGGAGGAGGGGGAGGG - Intronic
1164714834 19:30383958-30383980 GAGTGGAAGAAGGAAGGGAAGGG - Intronic
1164737917 19:30555552-30555574 GCCTGGTATCAGGAAGAGAATGG - Intronic
1165792446 19:38500293-38500315 GAGAGGACTCAGGATGGGGATGG + Intronic
1166235093 19:41449945-41449967 GAGTGGTGTCAGGAAGGGGCTGG + Intergenic
1166648253 19:44549032-44549054 GAGGTGATTCAGGAAGGGGATGG - Intergenic
1167053945 19:47096967-47096989 GAGTGGCATCAGGACAGGGAAGG - Intronic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167455226 19:49594350-49594372 AAGTTGGATCAGGAAAAGGAGGG - Intronic
1167565345 19:50252614-50252636 GAATGAAGTCAGGTAGAGGAGGG - Intronic
1168006707 19:53495832-53495854 GAGAGGAGACAGGAAGAGAAGGG - Exonic
1168543542 19:57231801-57231823 GATTGGTATCTGGAAAAGGAAGG + Intronic
925308007 2:2863763-2863785 GAGTGGATACTGGGAGAGGATGG + Intergenic
925930080 2:8699914-8699936 GAATGGAATCAGGACCAGGCCGG + Intergenic
926321215 2:11749445-11749467 CTGTGGAAAGAGGAAGAGGAAGG - Intronic
927207500 2:20619380-20619402 GAGTGGAATGGGGCAGAGCAGGG - Intronic
927692846 2:25220490-25220512 GATGGGAAGCAGGCAGAGGAGGG + Intergenic
927758176 2:25725483-25725505 CAGTGGTCTCAGGAGGAGGAAGG - Intergenic
928266132 2:29813407-29813429 GAGGGGAATTAGGGAGTGGATGG + Intronic
929034720 2:37679754-37679776 AGGAGGACTCAGGAAGAGGAAGG - Intronic
929846579 2:45535881-45535903 GGGGGGAAGCAGGAAAAGGAGGG + Intronic
930073445 2:47387958-47387980 GAGTAGGCTGAGGAAGAGGAAGG + Intergenic
930084053 2:47480196-47480218 GAAGGGAAGGAGGAAGAGGAGGG - Intronic
930674346 2:54184257-54184279 GAGTGGTATTAGCAAGAGAATGG + Intronic
930790948 2:55328027-55328049 GGGTGGAATGAGGAAGAGGCAGG - Intronic
931459215 2:62435656-62435678 GAGTAGACTCAGAAAGAGTATGG - Intergenic
932213804 2:69953238-69953260 GGGTGGTCTCAGGAAGAGTAAGG + Intergenic
932275870 2:70451883-70451905 CAGTGGTCTTAGGAAGAGGATGG - Intronic
932594245 2:73084257-73084279 GTGTGGAGCAAGGAAGAGGAAGG - Intronic
932682019 2:73834534-73834556 GAGTAGGCTGAGGAAGAGGAGGG + Intronic
932752031 2:74377371-74377393 GAGGGGAAGGAGAAAGAGGAGGG - Intronic
932809278 2:74810701-74810723 GAGTCGAATCAGAGAGAGCATGG + Intergenic
932864107 2:75323672-75323694 GAGTAGGCTAAGGAAGAGGAGGG - Intergenic
933023721 2:77226844-77226866 GAGTGACTTTAGGAAGAGGATGG + Intronic
933229471 2:79789711-79789733 GAGTGGAAATGGGAAGTGGAAGG + Intronic
933238091 2:79887248-79887270 GAGTAGAATTAGGAAGAAGTGGG + Intronic
933792055 2:85890708-85890730 AAGGGGAATCTGGAAGAGAAGGG - Intergenic
933810943 2:86032351-86032373 GAGGGTGATGAGGAAGAGGAGGG - Exonic
934746470 2:96762744-96762766 GGGTGGAGTCAGGAAGGGGCTGG + Intronic
935184464 2:100719162-100719184 GAATTGAGTCAGGAAGTGGAGGG - Intergenic
935244746 2:101208199-101208221 GAGTGGAATCGGGAACACCAGGG + Intronic
936081111 2:109432905-109432927 GAATGGGATCAGGAGGAGCAGGG + Intronic
936844494 2:116814206-116814228 TCCTGGTATCAGGAAGAGGAAGG + Intergenic
936855119 2:116948358-116948380 GAGGGGAAGGAGGGAGAGGAGGG + Intergenic
937528390 2:122798986-122799008 GAGGGGAAGGAGAAAGAGGAGGG - Intergenic
940279360 2:151973613-151973635 TAGTGGGAGGAGGAAGAGGAGGG + Intronic
941037288 2:160582173-160582195 GAGTGGAGTGGGGAAGGGGAAGG + Intergenic
941396474 2:164980257-164980279 GTGGGGAAGAAGGAAGAGGAAGG - Intergenic
941801502 2:169664789-169664811 GAGCTGACTCAGGAAGAGCAAGG - Intronic
942344318 2:174986637-174986659 GAGTAGACTGAAGAAGAGGAGGG - Intronic
942954278 2:181756172-181756194 CAGTGGAATAAGGAAATGGAAGG + Intergenic
943239701 2:185366669-185366691 GAGGAGGATAAGGAAGAGGAAGG - Intergenic
943361689 2:186926987-186927009 TAGTGGAATAATGAAGAGGTTGG + Intergenic
943795468 2:191987245-191987267 GAGGGAAATGAGGAGGAGGAAGG + Intronic
944646481 2:201785585-201785607 GAGGGGAATCAGGAACAAGAGGG + Intergenic
945256315 2:207806345-207806367 GAGTGGTGGCAGGAAGATGAGGG + Intergenic
945303415 2:208235485-208235507 CAGTGGCACCAGGAAGAGAACGG - Intergenic
946219125 2:218211351-218211373 GAGAGGGATCAGGACCAGGAAGG + Intergenic
946312712 2:218891860-218891882 GAGTGGACTGAGGGAAAGGAGGG + Intronic
947042331 2:225937459-225937481 GAGTGGAGACAGGAAGAAGTTGG - Intergenic
947117114 2:226783391-226783413 ATGTGGCATGAGGAAGAGGAAGG - Intronic
947500668 2:230668645-230668667 AAGTGGCATCAAGAAGAAGATGG + Intergenic
947956497 2:234196603-234196625 GAGGGGAATCAGGAAGGGAAGGG + Intergenic
948483311 2:238263979-238264001 GAGGGGGAGGAGGAAGAGGAGGG + Intronic
1168769605 20:407222-407244 GAGTGGAATGAGGCAGGGGCAGG + Intergenic
1169765619 20:9144764-9144786 GAGGGGAATGAGGGGGAGGAGGG + Intronic
1170408968 20:16067886-16067908 GAGTGGAGGGGGGAAGAGGATGG - Intergenic
1171316908 20:24203273-24203295 GTGTGGAGCCAGGAAGGGGAAGG - Intergenic
1171442460 20:25176382-25176404 GTGTGAAGCCAGGAAGAGGAGGG + Intergenic
1172049853 20:32109184-32109206 GATGGGAATGAGGAAGAGCAAGG + Intergenic
1172428330 20:34871439-34871461 GAGTGGAATCAGGAGGTAGCAGG - Intronic
1172648479 20:36486531-36486553 GAATGGAATTAGGGAGGGGAGGG + Intronic
1172942116 20:38661220-38661242 GTGTGCACTCAGGAAGTGGAAGG + Intergenic
1172955384 20:38754347-38754369 GAGTGGATTCAGGGATTGGATGG + Intronic
1173065419 20:39706200-39706222 GAGTGGGATCAGGGAAAGAAAGG - Intergenic
1173112287 20:40203229-40203251 GAGGGGAAGAAGGAAGAGGAGGG + Intergenic
1174059531 20:47822769-47822791 GAGTAGGAGGAGGAAGAGGAGGG - Intergenic
1174287537 20:49483492-49483514 GAGGGGGAGAAGGAAGAGGAGGG - Intergenic
1174983912 20:55428201-55428223 GAGGGGAGACAGGAAGAGGAAGG + Intergenic
1175295316 20:57904287-57904309 GAGTAGGCTCAGGAGGAGGAGGG - Intergenic
1175366425 20:58459511-58459533 GATAGGGATCAGGAGGAGGAAGG + Exonic
1175452103 20:59077955-59077977 GAGGGGGAGGAGGAAGAGGAAGG + Intergenic
1175569037 20:60005044-60005066 GAGTAGAATGAAGAGGAGGAGGG - Intronic
1175925914 20:62471259-62471281 GAGTGGATACAGCCAGAGGAGGG + Intronic
1175928330 20:62481494-62481516 GACTGGAGTCAGGCAGAGGGGGG - Intergenic
1177138660 21:17334078-17334100 GAGTGGGAAGAGGAAGAGAAAGG - Intergenic
1177758288 21:25373643-25373665 GAGTGGGAGGAGGAGGAGGAGGG - Intergenic
1177758314 21:25373705-25373727 GAGGGGGAGTAGGAAGAGGATGG - Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1178147482 21:29756569-29756591 TTGTGGGATCAGGGAGAGGATGG - Intronic
1178413787 21:32387443-32387465 GAGTGGAACCAGAGAGAGGCAGG - Intronic
1178470816 21:32891135-32891157 AGATGGGATCAGGAAGAGGAGGG + Intergenic
1178790281 21:35693381-35693403 GTGTGGAATGAGCACGAGGAAGG - Intronic
1179345881 21:40556927-40556949 GAGTAGGCTGAGGAAGAGGAGGG + Intronic
1179373310 21:40826967-40826989 GAGAGGAATTAGAGAGAGGAAGG + Intronic
1180215555 21:46321782-46321804 GAGTGCAATAAAGAAAAGGAGGG - Intronic
1182482263 22:30616822-30616844 GAGTGGAGCCAAGAAGAGGCAGG + Intronic
1182506686 22:30788239-30788261 GAGTAGGAAGAGGAAGAGGACGG + Intronic
1182662233 22:31933279-31933301 GAGAGGTATCAGAGAGAGGATGG - Intergenic
1182754589 22:32668547-32668569 GAGTGGAGGAAGGAGGAGGAAGG - Intronic
1182931456 22:34178253-34178275 GAGGGGGATAAGGAGGAGGAAGG - Intergenic
1183016587 22:34993269-34993291 GAGTAGAAAGAGGAAGAAGAGGG + Intergenic
1183616460 22:38948744-38948766 GGGTGGGATCAGGAAGGGGTGGG - Intergenic
1183616662 22:38950056-38950078 GGGTGGAATCCGGAAGGGGTGGG - Intergenic
1184240036 22:43207118-43207140 GGCTGGAAGCAGGAAGAGGAGGG + Intronic
1184375827 22:44112027-44112049 GAGTGGAAGCAGGCAGAGGAGGG + Intronic
1185047157 22:48534299-48534321 GAGGGGAGTCAGGCAGATGAGGG + Intronic
1185075037 22:48678427-48678449 CAGAGGAACCAGGAAGAGGTCGG + Intronic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
1203312785 22_KI270736v1_random:154463-154485 GAGTGGAATCGAGAAGAGTGGGG + Intergenic
949214769 3:1552508-1552530 GAGAGGAAGAAGGGAGAGGAGGG + Intergenic
949259688 3:2091143-2091165 GAAAGCAATTAGGAAGAGGATGG - Intergenic
949493420 3:4610282-4610304 GAGTGTCATCAGGGAGAGGGAGG - Intronic
949505066 3:4719811-4719833 GTTTGAAACCAGGAAGAGGAGGG + Intronic
950107351 3:10396708-10396730 GAGTTGGATGATGAAGAGGAAGG + Intronic
950156948 3:10728591-10728613 GAGTAGCCTGAGGAAGAGGAAGG - Intergenic
950387934 3:12674550-12674572 GAGGAGAATTAGTAAGAGGAAGG + Intergenic
951558556 3:23945012-23945034 GAGAGGAAAGAGGAGGAGGAGGG + Intronic
951771903 3:26267630-26267652 TTGTGGAATCAGGAAGAGACAGG - Intergenic
952114362 3:30161392-30161414 GCGAGGAATGGGGAAGAGGAGGG - Intergenic
954441526 3:50524887-50524909 GAGAGGACTCCAGAAGAGGAAGG + Intergenic
954815997 3:53280988-53281010 CACTGGAATCTGGAAGAGGGTGG + Intergenic
955112183 3:55960098-55960120 GAGTGGAAGCAGGGAGACCAGGG - Intronic
955119223 3:56039076-56039098 GAGTGGTATGAGGGTGAGGATGG - Intronic
955418905 3:58717858-58717880 GAGTTGCATTAGGAAGATGAAGG + Intronic
955666641 3:61356024-61356046 GAGTGGAAACAGGCAGATGATGG + Intergenic
956160418 3:66345607-66345629 GAGAGGGAGCAGGAAGAGAAGGG - Intronic
956347637 3:68298479-68298501 GAGTGGAATCCATAAAAGGAGGG + Intronic
956485596 3:69718949-69718971 AACTGGGATCAGGAAGAGGGGGG + Intergenic
956657967 3:71570443-71570465 GAGTGGAGGCTGAAAGAGGATGG - Intronic
956952401 3:74297475-74297497 GAGTGGAAAGAGGAAGGGTATGG + Intronic
957629096 3:82695335-82695357 GAGTTTAATCAAGAAGAGGAAGG + Intergenic
958479320 3:94626647-94626669 GAGTGCAAGCAGAAAAAGGAGGG - Intergenic
958886194 3:99730083-99730105 AAGAGGAATCAGGAAAAGAAAGG - Intronic
958906602 3:99948621-99948643 GAGAGGAAGGAGGAGGAGGAGGG + Intronic
959069551 3:101689698-101689720 GAGTGGAAATTGGAAGAGCAAGG - Intergenic
960004974 3:112772514-112772536 GTCAGGAATGAGGAAGAGGATGG - Intronic
960039525 3:113135740-113135762 GAGTGGGAGAAGGAAGAGAAAGG + Intergenic
960101509 3:113747155-113747177 GGGTGGAAGGAGGCAGAGGAAGG + Intronic
960216658 3:115047345-115047367 CAGAGGAATCAGGAAGAAAAAGG + Intronic
960266384 3:115625140-115625162 GAGAAGGAGCAGGAAGAGGATGG + Intronic
960847033 3:122013606-122013628 GAGCGGAATCAAGGAGAAGAGGG + Intronic
961077702 3:123997260-123997282 CAGAGGTAGCAGGAAGAGGAGGG - Intergenic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961306865 3:125964022-125964044 CAGAGGTAGCAGGAAGAGGAGGG + Intergenic
961345539 3:126260957-126260979 GAGGGGGAGAAGGAAGAGGAGGG - Intergenic
961366514 3:126402969-126402991 GTGTGGAATGAGGGAGAAGAGGG + Intronic
961697433 3:128715275-128715297 GTGTGGCACAAGGAAGAGGAAGG + Intergenic
963084006 3:141420084-141420106 GGGAGGAGTCAGGATGAGGAAGG + Intronic
963128304 3:141835145-141835167 GAGTGGACCCATGAAGAGGCAGG + Intergenic
963592834 3:147285427-147285449 GAGAAGAAAGAGGAAGAGGAGGG - Intergenic
964175445 3:153822139-153822161 GAGTGGCATAAGGCAGAAGAAGG - Intergenic
964492208 3:157249037-157249059 GAGAGGAATCAGTAAGGGGCAGG + Intergenic
964908018 3:161742486-161742508 GATTGTAAGTAGGAAGAGGAGGG - Intergenic
966413456 3:179666233-179666255 AAGTGGAATGAGGAATAGGTGGG + Intronic
966430502 3:179827272-179827294 GAGTGTCCTCAGGAAGAGGTAGG - Intronic
966798255 3:183737190-183737212 GAGTAGGCTGAGGAAGAGGAGGG + Intronic
967014620 3:185470505-185470527 GAGTAGAAGCAGGAAGAGACGGG - Intronic
968148856 3:196321417-196321439 GAGCGGAATGAGGAAGATGCTGG - Intronic
968288170 3:197520160-197520182 GAGGGGAAGCAGGGAGAGGGAGG + Intronic
968614907 4:1573392-1573414 GAGAGAAACCAGGAAGAGGGAGG - Intergenic
968963694 4:3758683-3758705 GAGGGGGAAGAGGAAGAGGAGGG + Intergenic
969561194 4:7949531-7949553 AAGGGGAAAGAGGAAGAGGAAGG - Intergenic
969833141 4:9815034-9815056 GATTGGAAACTGGAAGAAGAGGG + Intronic
969918704 4:10515341-10515363 GAGAGAAATCAGGATGAGGATGG - Intronic
969932557 4:10645139-10645161 GAGTGGAATCCCAGAGAGGAAGG - Intronic
971504922 4:27356113-27356135 GAGTGAAAAGAGGAAGATGATGG - Intergenic
971796361 4:31233890-31233912 GAGTAGGAAGAGGAAGAGGAAGG + Intergenic
972054781 4:34786174-34786196 TAGTGGAATCAAGAAGAATATGG + Intergenic
972725281 4:41742039-41742061 GAGTGGAGAGAGGAAGAAGAGGG - Intergenic
973881451 4:55275382-55275404 GAGCAGAAGGAGGAAGAGGAGGG + Intergenic
973885611 4:55318020-55318042 GAGGGCAAGGAGGAAGAGGAAGG + Intergenic
974112201 4:57538051-57538073 GAGGAGGATCAGGAGGAGGAGGG - Intergenic
974207649 4:58726932-58726954 GTTTGGAATCAGGGATAGGATGG + Intergenic
974274369 4:59698187-59698209 AAGGAGAATGAGGAAGAGGAGGG + Intergenic
974682897 4:65186661-65186683 GAGGAGAAGAAGGAAGAGGAAGG + Intergenic
975031845 4:69630365-69630387 GAGTGTAACCGGGAAGAGGTGGG - Intronic
975421718 4:74172170-74172192 GAGTGGAATCTGGCAGAGACAGG + Intronic
975676466 4:76832289-76832311 GCGTGGATCCAGGAAGAGGCAGG - Intergenic
975756980 4:77580755-77580777 GAGGGGAAGGAGGGAGAGGAGGG - Intronic
975802335 4:78074165-78074187 GGGTGGGATCAGGGAGGGGAGGG + Intronic
975857922 4:78644140-78644162 GTATGGACTGAGGAAGAGGAAGG + Intergenic
976937201 4:90651109-90651131 GAGTGGATTAATGAAGAGAAAGG - Intronic
977790082 4:101089262-101089284 AAGAGGCATCAGGAAGAGAAGGG + Intronic
977989616 4:103425139-103425161 GATTGGAGTCTGGAAGAGGGAGG + Intergenic
978264754 4:106810353-106810375 GAGGGGGAGGAGGAAGAGGAGGG - Intergenic
978360162 4:107923267-107923289 GAGTGGAAAGAGGAAGGGAAAGG - Intergenic
978406422 4:108383767-108383789 AAGTGCATTCAGGAATAGGAAGG + Intergenic
978503524 4:109433780-109433802 GAGAGGAGAGAGGAAGAGGAAGG - Intronic
978530025 4:109703425-109703447 CTGTGGCTTCAGGAAGAGGAGGG - Exonic
978649175 4:110979803-110979825 GAGTGGAATCTGGAATATAATGG + Intergenic
978676115 4:111318268-111318290 GATTGGAATCATGAAGAAAATGG + Intergenic
978682765 4:111402368-111402390 GAGAAGGAGCAGGAAGAGGAGGG + Intergenic
978802592 4:112769782-112769804 GATTGGAAAAAGGCAGAGGAAGG + Intergenic
979304257 4:119124389-119124411 GGGTGGTATTAGTAAGAGGAAGG - Intergenic
979560826 4:122100213-122100235 TATTGGTATTAGGAAGAGGAAGG - Intergenic
980532841 4:134076520-134076542 GTGGGGAGTCAGGAAAAGGAAGG + Intergenic
981528839 4:145733306-145733328 GGGGGGAATCAGCAGGAGGAGGG - Intronic
981790901 4:148535666-148535688 GAATAGAGTCTGGAAGAGGAAGG - Intergenic
982205180 4:152992407-152992429 AAATGGAACCAGGCAGAGGATGG + Intergenic
982331879 4:154190213-154190235 GAATGGAATCAGGAAAAGAAAGG - Intergenic
982695828 4:158599269-158599291 GTGAGGGACCAGGAAGAGGAGGG - Intronic
983283304 4:165708267-165708289 GAGTAGGATGAGGAAGAGGAGGG - Intergenic
983379832 4:166978676-166978698 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
983655966 4:170084974-170084996 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
984551964 4:181171301-181171323 GAGGAGCACCAGGAAGAGGATGG - Intergenic
984765352 4:183396582-183396604 AAGTGGAAACAGAAACAGGAAGG - Intergenic
984864054 4:184266139-184266161 GTGAGGAATCAGGAACAGGCTGG + Intergenic
984937914 4:184905543-184905565 ATGTGGAATAAGGATGAGGATGG - Intergenic
985168343 4:187121810-187121832 AAGTAGAAGGAGGAAGAGGAGGG + Intergenic
985726251 5:1517282-1517304 CCCTGGAAACAGGAAGAGGAAGG + Intronic
985732750 5:1558888-1558910 GAGTGGAAGCTGGCAGAGGTGGG - Intergenic
985808646 5:2067382-2067404 GAGTGGAATTTGGATTAGGATGG + Intergenic
986609069 5:9548885-9548907 GAGGTGAATCAGGAAATGGATGG - Intergenic
986710762 5:10486535-10486557 TCGTGGAAGCTGGAAGAGGAAGG + Intergenic
987062367 5:14254644-14254666 GAGAAGAAACAGGAGGAGGAGGG - Intronic
987234786 5:15931804-15931826 GAGGGGCAGCAGGCAGAGGAGGG - Intronic
987734064 5:21816170-21816192 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
989264693 5:39459216-39459238 GAATGGAATCAGGCCAAGGATGG + Intronic
989715199 5:44454620-44454642 GAGAGGACACAGGAAGAGAAAGG + Intergenic
990385147 5:55253081-55253103 GTGTGGATGCAGGAAAAGGATGG - Intergenic
990570999 5:57078773-57078795 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
990695055 5:58407241-58407263 GTGTGGAATCAGCAAAAGGCAGG + Intergenic
991536829 5:67678498-67678520 GAGTAGAATAAGAAAGAGAATGG + Intergenic
992497148 5:77305294-77305316 GATTGGAAGCAGGAAGGAGAAGG + Intronic
992714869 5:79500537-79500559 GAGTAGGCTGAGGAAGAGGAGGG - Intronic
992833814 5:80620943-80620965 GAGTGGCATAAAGAAGAGCATGG + Intergenic
992956117 5:81910116-81910138 GAGGGGCAAGAGGAAGAGGAGGG - Intergenic
993033373 5:82729877-82729899 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
993484715 5:88468781-88468803 GACAGGAACCAGGAAGAGGAAGG - Intergenic
995026783 5:107432874-107432896 GAGTAGACTGAGGATGAGGAGGG - Intronic
995511856 5:112918510-112918532 GAGAGGAAACAGCAAGAGAAAGG + Intronic
995791002 5:115886398-115886420 GAGTAGACTAAGGAAGATGAGGG - Intronic
995827263 5:116314653-116314675 GAGAGGCATCCGAAAGAGGAAGG + Intronic
997830874 5:137148554-137148576 GAGTGGAAAGAGGAAGTAGAAGG + Intronic
997880958 5:137589251-137589273 GAGTGTTTCCAGGAAGAGGAAGG + Intronic
998440503 5:142157383-142157405 ATGTGGAATCAGGAAGCAGATGG - Intergenic
998507000 5:142680031-142680053 GAGTGGACATAGGAAGAAGATGG - Intronic
999120282 5:149204408-149204430 GAGTGAAAGGAGGAAGAAGAGGG + Intronic
999371234 5:151056572-151056594 GGGAGGGATGAGGAAGAGGAAGG - Intronic
999744407 5:154580765-154580787 AAGGGGAAACAGGAATAGGACGG + Intergenic
1001403834 5:171462091-171462113 GAGTGGAAACAGGGAGATGTGGG - Intergenic
1001549586 5:172593431-172593453 GTGTGGGGTGAGGAAGAGGAAGG + Intergenic
1001594287 5:172887894-172887916 GAGTGGAAACAGGAGGAGGCAGG + Intronic
1002374984 5:178782251-178782273 GCGTGGAATGAGGAAGGTGATGG - Intergenic
1002488054 5:179553148-179553170 GAGTGGGATCAGGGAGGGTAGGG - Intronic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1003344499 6:5254733-5254755 GAGTGGAATGAAGGAGAAGAGGG - Intronic
1003467680 6:6397083-6397105 GGGTGGAATCTGAAAGGGGAGGG - Intergenic
1003978916 6:11370961-11370983 GAGCTGAATGAGGAAGGGGACGG + Intronic
1004588257 6:17024319-17024341 GAGAGGAAGCAAGAAGAGGGAGG - Intergenic
1006088997 6:31616694-31616716 GGGTGGAAGGGGGAAGAGGAAGG - Intronic
1006520627 6:34568997-34569019 TAGTGGAAGCAGGAACAGGACGG + Intergenic
1006633830 6:35448289-35448311 GAGTAGAAGGACGAAGAGGAGGG + Intergenic
1006824328 6:36923321-36923343 GAGGGGAAATAGCAAGAGGAAGG - Intronic
1009542045 6:64972512-64972534 GAGTAGAGTGAGGAAGAGGAGGG - Intronic
1009979292 6:70708107-70708129 GAGAGGAAACAGGAAGAGGGAGG - Intronic
1010151008 6:72732303-72732325 GAGTAGCATTAGGAAGGGGAGGG + Intronic
1010951465 6:82041690-82041712 GAGTAGGCTGAGGAAGAGGAGGG - Intergenic
1011362325 6:86540642-86540664 GAGTGGAAACAGAAAATGGAAGG + Intergenic
1011765729 6:90617479-90617501 AAGAGGAATAGGGAAGAGGAAGG - Intergenic
1013069549 6:106716209-106716231 TAGAGGAAACAGGAAGAGAATGG - Intergenic
1013269577 6:108533654-108533676 GTGGGGAATAAGGAAGAGAAGGG + Intergenic
1013822818 6:114175595-114175617 GAATGGAGTCAGGTAGGGGAGGG + Intronic
1013972687 6:116039805-116039827 GGGTGTAAGAAGGAAGAGGATGG - Intronic
1014190636 6:118492547-118492569 GATTAAAATCTGGAAGAGGAAGG + Intronic
1015185957 6:130415680-130415702 TAGTGGCAGCAGGAAAAGGAGGG - Intronic
1015389922 6:132670105-132670127 GAGGGGAGGAAGGAAGAGGAGGG + Intergenic
1015602690 6:134925981-134926003 GAGTGGAATGAGGAAAGGGAAGG + Intronic
1016589675 6:145730369-145730391 TAGTGGAATAAGGGAGAAGAAGG - Intronic
1017664276 6:156704106-156704128 GCCTGGAAGCAGGAAGAAGATGG - Intergenic
1017984293 6:159429502-159429524 GAGTAGGCTGAGGAAGAGGAGGG + Intergenic
1018050224 6:160002503-160002525 GAGTAGGAGGAGGAAGAGGAGGG + Intronic
1018297503 6:162364746-162364768 AAGGGGAATCAGGAAGAGGGAGG + Intronic
1018308677 6:162486121-162486143 GAGTGGAATTAGGAGGGGGTTGG - Intronic
1018320924 6:162607757-162607779 GCTTGGTATCAGGAAGATGAGGG + Intronic
1018729401 6:166637404-166637426 GCCAGGAATGAGGAAGAGGAGGG - Intronic
1020026813 7:4905350-4905372 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1020169495 7:5833969-5833991 CAGTGAAAACAGGAAGAGAATGG + Intergenic
1020345580 7:7159416-7159438 GAAAGAAAACAGGAAGAGGAGGG + Intronic
1021566099 7:22017995-22018017 GGGTGGAATGATGAAGGGGAAGG - Intergenic
1021824552 7:24535913-24535935 GAGATGAAGGAGGAAGAGGAAGG - Intergenic
1022384657 7:29889990-29890012 CAATGAAATCAGGAGGAGGAGGG - Intronic
1023059296 7:36313182-36313204 GAGTAGGAACAGGTAGAGGAGGG + Intergenic
1023537169 7:41225731-41225753 GGCAGGAACCAGGAAGAGGAAGG + Intergenic
1023737625 7:43248766-43248788 GAGGGGAAACAGGAGGAGAACGG - Intronic
1024003594 7:45209001-45209023 GTGTGGAATCTGGGAGAGGGAGG - Intergenic
1024497504 7:50065201-50065223 TAGAGGAATTAGAAAGAGGAAGG + Intronic
1025757434 7:64357974-64357996 AATTGGAGTCAGGAAGAGAATGG - Intergenic
1026230249 7:68476609-68476631 GAGTGGAACCAAGAATCGGAGGG - Intergenic
1026546586 7:71328350-71328372 GAGAGAAAGCAGGAAGAGAATGG - Intronic
1027247170 7:76375066-76375088 GAGAGGGACCAGGAAGAGCAGGG + Intergenic
1027788924 7:82614791-82614813 GAGTTGAAGCAGGAAGATGGAGG + Intergenic
1027903430 7:84148733-84148755 GAGGAGGATCAGGAAGAGGAGGG - Intronic
1029288573 7:99484167-99484189 GAGTGGAATCAGGAAGAGGAAGG + Intronic
1029575606 7:101401489-101401511 GACTAGAAGAAGGAAGAGGAGGG + Intronic
1029611051 7:101626752-101626774 CTGGGGAATGAGGAAGAGGAGGG - Intronic
1029893153 7:103953076-103953098 GCGTGGGATGAGGAAGAGAACGG - Intronic
1029994401 7:104992922-104992944 GAGTAGGCTGAGGAAGAGGAGGG - Intergenic
1030047719 7:105512497-105512519 TTGTGGCATAAGGAAGAGGAAGG + Intronic
1030678438 7:112408902-112408924 GATTTGAATGTGGAAGAGGATGG + Intergenic
1030962064 7:115936817-115936839 GAGTTGAAAAAGGAAGAGGAAGG + Exonic
1031998527 7:128248796-128248818 AAGTGGAATCAGGAGTGGGAAGG - Intronic
1032362701 7:131271166-131271188 CAGTGGGACCAGGAAAAGGAGGG + Intronic
1032429988 7:131852859-131852881 GAATGAAAACAGGAAGAGCAAGG - Intergenic
1033499164 7:141930292-141930314 CTCTGGAATCAGGAAGAGGCTGG - Intronic
1034564028 7:151899332-151899354 GTGTGGCATCAGGAAGCGGAGGG - Intergenic
1034672099 7:152866714-152866736 GAAGGGAAACAGGAAGGGGAAGG - Intergenic
1035060539 7:156066256-156066278 ACGTGGAATGAGGATGAGGATGG - Intergenic
1035416888 7:158696726-158696748 GTGTGGACTTAGGAGGAGGAGGG - Intronic
1035657362 8:1320112-1320134 GAGTGAGGTGAGGAAGAGGAGGG + Intergenic
1037167365 8:15847154-15847176 GACTGGAAGCAGGGAGAGGCAGG + Intergenic
1038134257 8:24768647-24768669 AAGTGCAATGAGGAAGAGCATGG + Intergenic
1038349397 8:26762577-26762599 GAGTGGAATAATGGAGAGGATGG + Intronic
1038400003 8:27277387-27277409 GAGGGGAAAAAGAAAGAGGAGGG - Intergenic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038813817 8:30880497-30880519 GAGTAGGCTAAGGAAGAGGAGGG - Intronic
1039556936 8:38483267-38483289 AAGCAGAAACAGGAAGAGGAAGG - Intergenic
1039852274 8:41379378-41379400 GAGTGGAGTGAGGAAGTGGATGG + Intergenic
1040021391 8:42744534-42744556 GTGAGGACTCAGGGAGAGGAGGG - Intergenic
1040443900 8:47473804-47473826 GTGAGGAACCAGGAGGAGGATGG + Intronic
1040532187 8:48275116-48275138 GTGTGGAATAGGGGAGAGGAGGG + Intergenic
1040684674 8:49857348-49857370 GAGTGGAGGCAGGAAGAGGAAGG + Intergenic
1041465083 8:58150510-58150532 AAATGGAATGAGGAAGAGGCCGG - Intronic
1041875829 8:62685878-62685900 GAGAGAAAACAGGAAGGGGATGG - Intronic
1041916757 8:63146271-63146293 AGGTGGAATCAGGAGGAGGAGGG + Intergenic
1042054286 8:64747561-64747583 GAGGAGGATGAGGAAGAGGAGGG + Intronic
1042060879 8:64816026-64816048 GAGTGGAGTAAGGAAAAGGTGGG + Intergenic
1042076670 8:65003246-65003268 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1042129592 8:65574313-65574335 GACAGGAAGCAAGAAGAGGAGGG - Intergenic
1042390889 8:68232173-68232195 GAGGGGAACCAGGATGAAGAAGG + Exonic
1042416517 8:68526883-68526905 GACAGGAGTCAGGAGGAGGAGGG + Intronic
1042716466 8:71778508-71778530 GAGAGGAATGAGGAAGGGGTAGG + Intergenic
1043045257 8:75314999-75315021 GAGTGAAAGCAAAAAGAGGATGG + Intergenic
1043115602 8:76250045-76250067 GAGAAGAAGGAGGAAGAGGAAGG - Intergenic
1044958846 8:97509637-97509659 AAGTGGAATGAGGACAAGGATGG + Intergenic
1045056406 8:98371970-98371992 GAGTGGGATCAGGGGGAGGGGGG + Intergenic
1045416517 8:101973039-101973061 GAGTGGTATGAGGAAGAGAAGGG + Intronic
1045558317 8:103236526-103236548 GAGTAGAATCAGAAAGACGGGGG - Intergenic
1046461178 8:114538333-114538355 CAGTAGATGCAGGAAGAGGAGGG + Intergenic
1046838794 8:118833379-118833401 GAGGAGAAGAAGGAAGAGGAGGG + Intergenic
1048083495 8:131153626-131153648 TAATGGAACCAGTAAGAGGAAGG - Intergenic
1048259052 8:132930274-132930296 GTGAGGAATCAGCATGAGGATGG + Intronic
1048483036 8:134819239-134819261 GAGTGGGAAGGGGAAGAGGAAGG + Intergenic
1048671380 8:136726551-136726573 GAGGGGAATGAGGAAGAGTCTGG - Intergenic
1048794389 8:138136349-138136371 GATTGGATTCTGGAAGAGAAAGG + Intronic
1049215590 8:141406412-141406434 GGGTGGCAGCAGAAAGAGGACGG - Intronic
1049278185 8:141730384-141730406 GAGAGGAAGGAGGAGGAGGAGGG - Intergenic
1049687179 8:143943678-143943700 GCTTGGAAACAGGAAGGGGAGGG + Intronic
1049932522 9:470558-470580 GAAAGGAAGCAGGAGGAGGAGGG + Intronic
1050094169 9:2047060-2047082 GAGGGCAAGAAGGAAGAGGAGGG - Intronic
1050302206 9:4271034-4271056 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1050836672 9:10089492-10089514 GAGTGGGATTAGCAACAGGAAGG + Intronic
1051136438 9:13927029-13927051 GAGAGGAGACAGGAGGAGGAGGG - Intergenic
1052027619 9:23591242-23591264 GAGTGGAAGCAGGGAGGGGCAGG + Intergenic
1052513167 9:29447471-29447493 GAGTGAGAACAGGAAGAAGAGGG + Intergenic
1052761878 9:32601043-32601065 GGGTGGAAGCAGGCAGAGCAGGG + Intergenic
1053377849 9:37623286-37623308 GAATGGGATATGGAAGAGGATGG + Intronic
1053462133 9:38279228-38279250 GAGTGGAAGCAGGAGAGGGAGGG - Intergenic
1053472233 9:38355123-38355145 GAGAGGAAGAAGGAAGGGGAGGG + Intergenic
1053523225 9:38803182-38803204 GAGTGGAAGCAGCATGAGGGAGG - Intergenic
1054195453 9:62027601-62027623 GAGTGGAAGCAGCATGAGGGAGG - Intergenic
1054642954 9:67561088-67561110 GAGTGGAAGCAGCATGAGGGAGG + Intergenic
1054874807 9:70084583-70084605 GAAAGGAATCAGGCAGAGGGAGG - Intronic
1055033598 9:71794681-71794703 GAGTGCAAGCTGGAAGTGGATGG - Intronic
1055280496 9:74668744-74668766 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1056298773 9:85220812-85220834 GAGTGGAAACAGGTGGATGAAGG + Intergenic
1056786385 9:89595288-89595310 AAGTTCAATGAGGAAGAGGATGG - Intergenic
1056890658 9:90488791-90488813 GGGAGGAAACAGTAAGAGGAGGG + Intergenic
1056965185 9:91159452-91159474 GAGAGGAAAGAGAAAGAGGAGGG + Intergenic
1057695408 9:97319468-97319490 GGGTGGAAGGAGGGAGAGGATGG - Intronic
1057736439 9:97665983-97666005 GAGTAGGCTGAGGAAGAGGAGGG + Intronic
1058579687 9:106441415-106441437 GAGAGGAAGTAGGAGGAGGAAGG + Intergenic
1058939427 9:109799368-109799390 GAGTGGAGGCAGGATGAGGCAGG + Intronic
1059277652 9:113109350-113109372 GAGGGGGATCAGGAACAGGAAGG + Intergenic
1059278599 9:113115201-113115223 GAGGGGGATCAGGAACAGGAAGG - Intergenic
1059285101 9:113165720-113165742 CACTGGATTCAGGTAGAGGAGGG + Exonic
1059663096 9:116420812-116420834 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1059764054 9:117366617-117366639 GAGTCTAATCAGGAAGATGCAGG - Intronic
1059875937 9:118634826-118634848 GAGTAGGCTGAGGAAGAGGAGGG + Intergenic
1059933602 9:119285333-119285355 GAGGGGAATCAAGAAAATGAGGG + Intronic
1059999684 9:119946977-119946999 GGGAGGAATCAGGAAGGGGTGGG + Intergenic
1060367526 9:123033589-123033611 GAGGGGAAACAGGGAGAAGAGGG - Intronic
1060484704 9:124039746-124039768 GAAAGTCATCAGGAAGAGGAAGG + Intergenic
1060576400 9:124699580-124699602 GGCTGGAAGCAGGAAAAGGAAGG - Intronic
1061348573 9:130045504-130045526 GAGGAGAAAGAGGAAGAGGAAGG + Intergenic
1061498256 9:130987931-130987953 GAGCGGAGGCAGGAAGCGGAGGG + Intergenic
1061538446 9:131264232-131264254 GGCTGGGGTCAGGAAGAGGAGGG - Intronic
1061670559 9:132185872-132185894 GAGTGGGAGGAGGAGGAGGAGGG + Intronic
1061899681 9:133666509-133666531 GAGAGGAAGGAGGAGGAGGAGGG - Intronic
1061961791 9:133992427-133992449 GAGTAGGAGGAGGAAGAGGAGGG - Intronic
1061997943 9:134197120-134197142 GGGTTGCATGAGGAAGAGGAGGG - Intergenic
1062291527 9:135797428-135797450 GGGTGGGGTGAGGAAGAGGACGG - Intergenic
1062536439 9:137023105-137023127 GAGAGGAATCCAGAAGGGGAGGG + Intronic
1203774287 EBV:64052-64074 GGGAGGAAACAGGAGGAGGAGGG + Intergenic
1185504972 X:625227-625249 GAGTAGAAGGAGGAGGAGGAGGG - Intronic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185948692 X:4406311-4406333 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1185989429 X:4876462-4876484 CAGTGGAAAGAGGAAGAGGGTGG + Intergenic
1186071482 X:5826014-5826036 GAGTAGGAGGAGGAAGAGGAGGG + Intergenic
1186072930 X:5842254-5842276 GAGGGGAAGGAGGAAGAGGAGGG + Intronic
1186240920 X:7565431-7565453 GAGTGGAAATAGGAAGAGTTGGG + Intergenic
1186561570 X:10618925-10618947 AAGTGGGATGAGGAAAAGGAAGG - Intronic
1186631640 X:11355768-11355790 GAGTGATATGAGGAAGAGGGAGG + Intronic
1186645430 X:11501838-11501860 GAGAAGGAGCAGGAAGAGGAGGG + Intronic
1188423697 X:30021937-30021959 GAATGCATTCAGGAAGAAGAAGG - Intergenic
1188874549 X:35414065-35414087 GAGTGGAGTGAAAAAGAGGAAGG - Intergenic
1188997423 X:36903265-36903287 GAGTGCAATCAGCACCAGGAAGG + Intergenic
1189323122 X:40098002-40098024 GAGGGGGAGGAGGAAGAGGAGGG - Intronic
1189566724 X:42249415-42249437 GAGTGGGATCAGGGGGAGCACGG - Intergenic
1189602195 X:42639191-42639213 GAGGAGAAAGAGGAAGAGGAAGG - Intergenic
1189604714 X:42664510-42664532 GAGAGGAATAAGAAACAGGAAGG + Intergenic
1189624394 X:42880325-42880347 GAGTAGAATTAGGAAGAGCCTGG - Intergenic
1190311768 X:49122075-49122097 AAGTGGAATGAGTAAGGGGAAGG - Intronic
1190714645 X:53093333-53093355 GAGTGGTAGCGGGAAGAGGCAGG + Intergenic
1190714826 X:53094316-53094338 GAGTGGCAGCGGGAAGAGGCCGG + Intergenic
1191976503 X:66877762-66877784 GAGTGGGAGAAGGGAGAGGAGGG - Intergenic
1192264949 X:69531590-69531612 GAGTGAAACCAAGAAGCGGATGG + Exonic
1192436444 X:71146106-71146128 GAGAAGAAAAAGGAAGAGGAGGG - Intronic
1192456823 X:71283242-71283264 AAGTGGAAAGAGGGAGAGGAAGG - Intronic
1192747169 X:73950772-73950794 GAGTAGGCTGAGGAAGAGGAGGG + Intergenic
1192942101 X:75923282-75923304 CAGGGCAATCAGGAAGAAGAAGG + Intergenic
1193039144 X:76986564-76986586 GAGAGAAAAGAGGAAGAGGAGGG - Intergenic
1193205090 X:78738929-78738951 GAGAGGCATCAAGAGGAGGAAGG + Intergenic
1193748578 X:85314122-85314144 GGGTGGAATGGAGAAGAGGAAGG + Intronic
1194318474 X:92411949-92411971 GAGTGGGAGGAGGAGGAGGAGGG + Intronic
1194737610 X:97531232-97531254 GACTGGAAGAAGGAAGGGGAAGG - Intronic
1194986856 X:100499856-100499878 GAGTGGAAGTGGGGAGAGGAGGG + Intergenic
1195457564 X:105085988-105086010 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1195517526 X:105794390-105794412 GAGGGGGAGGAGGAAGAGGAGGG + Intergenic
1195581508 X:106509190-106509212 GAGGGAAAACAGGAAGAGTATGG - Intergenic
1196058017 X:111377096-111377118 AAGTGGAGGCAGGAGGAGGAGGG - Intronic
1196478233 X:116113424-116113446 TTGTGGAATCTGGAAGAGGGTGG + Intergenic
1196747235 X:119082015-119082037 GAGTGGAATTAGGAATAGGGAGG - Intronic
1196906304 X:120439858-120439880 AAGTGGAAACAGGATCAGGAAGG + Intronic
1197129225 X:122985121-122985143 GAGTAGACTAAGGAGGAGGAGGG + Intergenic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1197870666 X:131059491-131059513 GAGGGGAAGCAGGGAAAGGAGGG + Intronic
1198614986 X:138447285-138447307 GAGAGGAATCAGGGAGACGTTGG - Intergenic
1198623296 X:138538163-138538185 AAGTGGTATCAGAAAGGGGAGGG - Intergenic
1198791088 X:140347088-140347110 AAATGGAATCAGGAAGAGTTAGG - Intergenic
1199403131 X:147424066-147424088 GAGTGGTATAAGCAAGAGGATGG + Intergenic
1199701887 X:150385632-150385654 GAGGAGAAGGAGGAAGAGGAAGG + Intronic
1199748693 X:150793954-150793976 GAGTGGAACCATGGATAGGATGG + Intronic
1200254368 X:154572103-154572125 GGAAGGAATAAGGAAGAGGAAGG - Intergenic
1200263401 X:154632305-154632327 GGAAGGAATAAGGAAGAGGAAGG + Intergenic
1200375474 X:155775211-155775233 GAGAGGAATAAAGAAGAGAAGGG - Exonic
1200537996 Y:4422770-4422792 CAGTGCAATCAGGCAGAAGAAGG + Intergenic
1200795749 Y:7339751-7339773 GAGTGCAATTAGCAAGAGCAAGG + Intergenic
1201146526 Y:11067855-11067877 GAATGGAAGGAGGGAGAGGAAGG + Intergenic
1201645531 Y:16225815-16225837 GAGTGGACTGAGGAGGAAGAAGG + Intergenic
1201657282 Y:16359499-16359521 GAGTGGACTGAGGAGGAAGAAGG - Intergenic
1202266842 Y:23028520-23028542 AATTGGAAGCAGGAAGAGAATGG - Intergenic
1202419835 Y:24662265-24662287 AATTGGAAGCAGGAAGAGAATGG - Intergenic
1202450951 Y:25007819-25007841 AATTGGAAGCAGGAAGAGAATGG + Intergenic