ID: 1029291381

View in Genome Browser
Species Human (GRCh38)
Location 7:99504705-99504727
Sequence ACCACCGCAGTCGGCTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 63}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029291381_1029291387 4 Left 1029291381 7:99504705-99504727 CCTTCTGAGCCGACTGCGGTGGT 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1029291387 7:99504732-99504754 AGGTGGGTTTGTTTGGAAAGTGG 0: 1
1: 1
2: 4
3: 32
4: 353
1029291381_1029291391 28 Left 1029291381 7:99504705-99504727 CCTTCTGAGCCGACTGCGGTGGT 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1029291391 7:99504756-99504778 TGGTGAGAGTAGCGAGGATGCGG 0: 1
1: 0
2: 1
3: 15
4: 261
1029291381_1029291386 -3 Left 1029291381 7:99504705-99504727 CCTTCTGAGCCGACTGCGGTGGT 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1029291386 7:99504725-99504747 GGTCAAGAGGTGGGTTTGTTTGG 0: 1
1: 0
2: 1
3: 6
4: 147
1029291381_1029291390 22 Left 1029291381 7:99504705-99504727 CCTTCTGAGCCGACTGCGGTGGT 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1029291390 7:99504750-99504772 AGTGGGTGGTGAGAGTAGCGAGG 0: 1
1: 0
2: 0
3: 15
4: 255
1029291381_1029291392 29 Left 1029291381 7:99504705-99504727 CCTTCTGAGCCGACTGCGGTGGT 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1029291392 7:99504757-99504779 GGTGAGAGTAGCGAGGATGCGGG 0: 1
1: 0
2: 0
3: 19
4: 222
1029291381_1029291389 8 Left 1029291381 7:99504705-99504727 CCTTCTGAGCCGACTGCGGTGGT 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1029291389 7:99504736-99504758 GGGTTTGTTTGGAAAGTGGGTGG 0: 1
1: 0
2: 1
3: 21
4: 303
1029291381_1029291388 5 Left 1029291381 7:99504705-99504727 CCTTCTGAGCCGACTGCGGTGGT 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1029291388 7:99504733-99504755 GGTGGGTTTGTTTGGAAAGTGGG 0: 1
1: 0
2: 3
3: 23
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029291381 Original CRISPR ACCACCGCAGTCGGCTCAGA AGG (reversed) Intronic