ID: 1029294974

View in Genome Browser
Species Human (GRCh38)
Location 7:99533282-99533304
Sequence CCCCAACCTTCCTGGAAGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 5, 3: 74, 4: 355}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029294974_1029294982 1 Left 1029294974 7:99533282-99533304 CCTGCCTTCCAGGAAGGTTGGGG 0: 1
1: 0
2: 5
3: 74
4: 355
Right 1029294982 7:99533306-99533328 GGGAGTTTTGAGTGGGAAAGAGG 0: 1
1: 0
2: 1
3: 40
4: 376
1029294974_1029294980 -7 Left 1029294974 7:99533282-99533304 CCTGCCTTCCAGGAAGGTTGGGG 0: 1
1: 0
2: 5
3: 74
4: 355
Right 1029294980 7:99533298-99533320 GTTGGGGTGGGAGTTTTGAGTGG 0: 1
1: 0
2: 2
3: 31
4: 352
1029294974_1029294981 -6 Left 1029294974 7:99533282-99533304 CCTGCCTTCCAGGAAGGTTGGGG 0: 1
1: 0
2: 5
3: 74
4: 355
Right 1029294981 7:99533299-99533321 TTGGGGTGGGAGTTTTGAGTGGG 0: 1
1: 0
2: 1
3: 32
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029294974 Original CRISPR CCCCAACCTTCCTGGAAGGC AGG (reversed) Exonic
900034700 1:397355-397377 CCCCCAGATTCCTTGAAGGCAGG + Intergenic
900037538 1:429959-429981 CACAAACCTTCATGGAAGGCTGG + Intergenic
900055531 1:627237-627259 CCCCCAGATTCCTTGAAGGCAGG + Intergenic
900059166 1:665700-665722 CACAAACCTTCATGGAAGGCTGG + Intergenic
900097581 1:946278-946300 CCCCAACCCCCCAGGAAGCCTGG - Exonic
900366165 1:2312801-2312823 CCCCATCATTTCTGGAGGGCAGG - Intergenic
900372057 1:2336541-2336563 GCCCAATCTTTCTAGAAGGCAGG - Exonic
900590189 1:3456010-3456032 CCCCAGTCTTGCTGGAAGGGAGG + Intronic
900880592 1:5378350-5378372 CCCCTTGCTTCCTGGATGGCAGG + Intergenic
902719095 1:18292226-18292248 CTCCAACAGTCCTGGAAGGTGGG + Intronic
902861631 1:19251157-19251179 CCCAAGCATTCCTGGATGGCAGG + Intronic
902895672 1:19478255-19478277 TCCCAACCAGCCTGGAAGGCAGG - Intronic
903410756 1:23141189-23141211 GCCCCACATTCCTGGAAGGTGGG + Intronic
903410759 1:23141191-23141213 CCCCCACCTTCCAGGAATGTGGG - Intronic
904672015 1:32173089-32173111 TCCCAATCTCCCAGGAAGGCAGG + Exonic
904831944 1:33311059-33311081 CCCCATCCTTCCTGAATGGGAGG + Intronic
904969527 1:34408221-34408243 CCACAGCCTTCCTGGAAGTCTGG + Intergenic
905148813 1:35910203-35910225 CACCATCCCTCCTGGGAGGCTGG + Intronic
905243971 1:36599611-36599633 CCCCAACCTAACTGCAAGGAAGG - Intergenic
907190007 1:52640561-52640583 CCTCAGCCTCCCTGGTAGGCGGG - Intronic
907285501 1:53377006-53377028 TCCCATCCTTGCTTGAAGGCAGG - Intergenic
907931399 1:59004238-59004260 CCTCTCCCTTCCTGGCAGGCAGG + Intergenic
909240096 1:73202147-73202169 CACAAACCTTCTTGGAAGGCCGG + Intergenic
910831683 1:91467790-91467812 CACAAACCTTCTTGGAAGCCCGG + Intergenic
911076030 1:93876069-93876091 CCTCAACCTCCCTGGGTGGCTGG + Intronic
911175433 1:94812898-94812920 CACAAACCCTCCTGGAAGGCTGG + Intergenic
911220692 1:95242059-95242081 CACAAACCTTCTTAGAAGGCTGG - Intronic
911339738 1:96621888-96621910 CCCCAATCTTTCTGGCAGGGAGG - Intergenic
911577895 1:99599867-99599889 CTCCAACCGGCCTGGGAGGCTGG - Intergenic
912370809 1:109172660-109172682 CCCCAATGTCCCTGGAGGGCAGG + Intronic
912625782 1:111203992-111204014 CCACAAGCTTCCTGGATGGAAGG + Intronic
913691540 1:121284427-121284449 CCCCAACCATCCTATGAGGCAGG - Intronic
914146006 1:144995554-144995576 CCCCAACCATCCTATGAGGCAGG + Intronic
915064402 1:153212753-153212775 CTCCAATCTTGCTGGAGGGCTGG + Intergenic
915143863 1:153783143-153783165 CCCAAACCTGCCTCAAAGGCAGG + Intergenic
915480951 1:156184558-156184580 CACAAACCTTCTTGGAAGGCCGG - Intergenic
915481572 1:156189647-156189669 CACAAACGTTCTTGGAAGGCTGG - Intergenic
915489814 1:156244785-156244807 CTCCCACCTGCCTGAAAGGCTGG - Exonic
915814004 1:158947973-158947995 CACAAATCTTCTTGGAAGGCTGG - Intronic
916170340 1:161997231-161997253 CCCCAGCCTTCCTGGCAGCCAGG + Intronic
916522697 1:165579453-165579475 ACCCAACCTTCTTAGCAGGCTGG - Intergenic
916962176 1:169899959-169899981 CTCAAACCTTCCTGCAAGGAAGG - Intergenic
918074537 1:181160339-181160361 CACAAATCTTCTTGGAAGGCTGG + Intergenic
918536553 1:185581444-185581466 CACAAACCTTCTTAGAAGGCCGG - Intergenic
919108990 1:193193013-193193035 AGCAAACCTTCTTGGAAGGCCGG - Intronic
919112410 1:193237398-193237420 TGCAAACCTTCTTGGAAGGCTGG + Intronic
920176242 1:204103767-204103789 CCCCAACAGTGCTAGAAGGCAGG - Intronic
920208058 1:204307496-204307518 CCAGAGTCTTCCTGGAAGGCTGG - Intronic
920478867 1:206302905-206302927 CCCCAACCATCCTATGAGGCAGG - Intronic
920799504 1:209173680-209173702 CCTCAACCTTCCTGGCAGATGGG - Intergenic
921238132 1:213151885-213151907 CCCCAACCTCCCTCCAAGACGGG + Intronic
922226116 1:223647185-223647207 GCCCAGCATTCCTGTAAGGCAGG + Intronic
922398750 1:225228842-225228864 TGCAAACCTTCTTGGAAGGCCGG + Intronic
922764203 1:228149156-228149178 TCCCAACCCACCTGGCAGGCTGG + Intergenic
923489476 1:234471520-234471542 CCTCAACTGTCCTGGCAGGCAGG + Intronic
924259049 1:242211246-242211268 CACAAACCTTCTTGGAAGGCCGG + Intronic
924338423 1:243005721-243005743 CCCCCAAATTCCTTGAAGGCAGG + Intergenic
1062792568 10:318298-318320 TCCCAGCCTTCCTGGAAGCTAGG + Intronic
1062792571 10:318300-318322 ACCCTAGCTTCCAGGAAGGCTGG - Intronic
1063384403 10:5607033-5607055 CCCGCTCCTTCCTGAAAGGCAGG + Intergenic
1063647429 10:7899040-7899062 CCCCAATCTACCTGGAAGGGAGG + Intronic
1063785605 10:9379691-9379713 TGCAAACCTTCTTGGAAGGCTGG - Intergenic
1067781919 10:49213962-49213984 CACCAACCTGCCTGAAAAGCTGG + Intergenic
1067809905 10:49418252-49418274 CCCCACCCTCCCTGGAAAGGAGG + Intergenic
1069205284 10:65675230-65675252 CACAAACCTTCTTTGAAGGCTGG + Intergenic
1069661387 10:70125958-70125980 CCCAAGCCAGCCTGGAAGGCTGG + Intronic
1069798052 10:71065808-71065830 CTCCAAGCTTCCTGGATGACTGG + Intergenic
1071572947 10:86708063-86708085 CCCCAACCCTGCTCAAAGGCAGG + Intronic
1072555007 10:96508159-96508181 CGCCAACCTTCATGGCAGGGCGG - Intronic
1073138091 10:101230470-101230492 CCCCAGCCTAACTGGAAGCCTGG - Intergenic
1073216600 10:101840041-101840063 CCCCAAAGTTCCTGGACGGGGGG + Intronic
1073257132 10:102159954-102159976 CCACAGCCTTCTTGGGAGGCTGG - Exonic
1073451368 10:103611389-103611411 TCCCAGCCTTCCTGGAGGCCTGG - Intronic
1073751681 10:106535717-106535739 CACAAACCTTCTTGGAAGCCTGG - Intergenic
1073932994 10:108598292-108598314 CAAAAACCTTCTTGGAAGGCTGG + Intergenic
1074587220 10:114779942-114779964 CCACAGCCTCCCTGGAAGGCAGG - Intergenic
1075173673 10:120139709-120139731 CTCCAACCTCCCTGGAAGGTAGG + Intergenic
1076109877 10:127852080-127852102 CCCCACCCTTCATGACAGGCCGG - Intergenic
1076182973 10:128424957-128424979 CCTCAGCCTTCCTGGGAAGCAGG + Intergenic
1076597683 10:131635908-131635930 CCCAATCCTTTCTGGAGGGCTGG + Intergenic
1076627887 10:131833111-131833133 TCCCAACCTCCTTGGATGGCAGG + Intergenic
1076914951 10:133418753-133418775 TCCCAACCTTCCTGACAGCCAGG - Intronic
1076964264 11:67882-67904 CACAAACCTTCATGGAAGGCTGG + Intergenic
1077372756 11:2191185-2191207 CCCCGACCTTCCCGCCAGGCAGG - Intergenic
1077532349 11:3103209-3103231 CCCCACCCTCCCTGGCTGGCAGG + Intronic
1078099834 11:8323526-8323548 CCACTACCTCCCTGGAAGGGAGG + Intergenic
1081017390 11:37899884-37899906 TGCAAACCTTCTTGGAAGGCCGG + Intergenic
1081619048 11:44608016-44608038 CACCATCTTTTCTGGAAGGCAGG + Intronic
1081928563 11:46851257-46851279 CACAAATCTTCTTGGAAGGCCGG - Intergenic
1081973324 11:47214917-47214939 CCCGCCCCTTCCTGGAAGGCGGG - Intronic
1083622845 11:64057476-64057498 CCCCAGCCAGCCAGGAAGGCTGG + Intronic
1083622847 11:64057478-64057500 CGCCAGCCTTCCTGGCTGGCTGG - Intronic
1083661108 11:64252117-64252139 CCCCAGCCAGCCTGGAAGTCAGG - Intronic
1084064620 11:66696530-66696552 TCTCGCCCTTCCTGGAAGGCAGG + Exonic
1084563273 11:69915811-69915833 CCCCCACCTCACTGGAAGCCTGG - Intergenic
1084610593 11:70200201-70200223 CACAAACTTTCTTGGAAGGCCGG + Intergenic
1084739225 11:71128177-71128199 CTCCCACCTTCCTGGGAGACAGG - Intronic
1085628339 11:78090938-78090960 CGCAAACCTTCTTGGAAGGCCGG - Intergenic
1085640479 11:78189642-78189664 CCCCAAGCTTTCTGGAAGGAAGG - Intronic
1085826130 11:79849548-79849570 CCTCAACCTCCCTAGTAGGCGGG - Intergenic
1085926724 11:81032686-81032708 TGCAAACCTTCTTGGAAGGCTGG + Intergenic
1088106182 11:106209179-106209201 TACAAACCTTCCTGGAAGGCTGG - Intergenic
1089253418 11:117181000-117181022 CCTCAACCTTCCTGTGAGCCAGG - Intronic
1089683144 11:120130615-120130637 CCACAGCTTCCCTGGAAGGCAGG - Intronic
1089842975 11:121434880-121434902 CCCATAACTACCTGGAAGGCAGG + Intergenic
1093287617 12:17284093-17284115 TGCAAACCTTCTTGGAAGGCTGG - Intergenic
1094054600 12:26256266-26256288 TGCAAACCTTCTTGGAAGGCTGG + Intronic
1095460736 12:42442243-42442265 CGCAAACCTTCTTGGAAGGCTGG + Intronic
1095598035 12:43981092-43981114 CACTAACTTTCTTGGAAGGCCGG - Intronic
1098258956 12:68647593-68647615 CCCCAACCTTGCTAGACTGCTGG + Intronic
1098790871 12:74820292-74820314 CACAAACCTTCTTGGAAGGCTGG + Intergenic
1099015341 12:77337414-77337436 CCCCAACCATCCTAGAAGGAAGG - Intergenic
1102045756 12:109829258-109829280 CCACAACCTCCCAGCAAGGCAGG + Intronic
1102470621 12:113157953-113157975 CCCCAACCACCCTGGCAGGGAGG - Exonic
1104389225 12:128377415-128377437 TCCCAACCTACGTGGTAGGCAGG - Intronic
1105349739 13:19604252-19604274 CACAAACCTTCTTGGAAGGCCGG + Intergenic
1105918291 13:24937820-24937842 CACAAAACTTCTTGGAAGGCTGG + Intergenic
1106142231 13:27020924-27020946 CCCCAACCTTTTTGGAAGCAGGG - Intergenic
1106921366 13:34567547-34567569 CACAAACCTTCTAGGAAGGCTGG + Intergenic
1108355536 13:49625813-49625835 CCCCAATCTTCCTGCAAATCGGG + Intergenic
1109017080 13:57030545-57030567 CACAGACCTTCTTGGAAGGCCGG + Intergenic
1110146308 13:72194885-72194907 CTCAAACCTTGCAGGAAGGCTGG - Intergenic
1110913462 13:80991978-80992000 CACAAACCTTCTTGGAAGGCCGG - Intergenic
1111112572 13:83733634-83733656 CCCTCATGTTCCTGGAAGGCTGG - Intergenic
1111358187 13:87138899-87138921 CGCAAACTTTCTTGGAAGGCTGG + Intergenic
1112041692 13:95553367-95553389 CCCCTACGTTCCCCGAAGGCTGG + Intronic
1112676077 13:101703832-101703854 TGCAAACCTTCTTGGAAGGCTGG + Intronic
1112758553 13:102668278-102668300 TGCAAACCTTCTTGGAAGGCTGG - Intronic
1115536543 14:34378693-34378715 ACCCAACATTCTTTGAAGGCTGG - Intronic
1116080448 14:40164045-40164067 CACAAACTTTCTTGGAAGGCTGG + Intergenic
1117814913 14:59587530-59587552 CTGTAACCTTCATGGAAGGCTGG + Intergenic
1118276148 14:64387883-64387905 CCCAAAACTCCCTGGAAGCCAGG + Intergenic
1118764637 14:68901654-68901676 CCCAGACCTCCCTGGTAGGCAGG - Intronic
1119024972 14:71145361-71145383 ACCCAAGCTTCCTGGAAGAGTGG - Intergenic
1120103815 14:80472594-80472616 CACAAACCTTCTTGGAAGGCTGG + Intergenic
1122550208 14:102545243-102545265 CCCCAACCCACCCGGACGGCCGG + Intergenic
1125374773 15:39016732-39016754 AGCAAACCTTCTTGGAAGGCAGG + Intergenic
1125378642 15:39061944-39061966 CAAAAACCTTCTTGGAAGGCTGG + Intergenic
1126002532 15:44224535-44224557 CCTCAACCTTCCTGGTAGCTGGG + Intergenic
1128251242 15:66165685-66165707 CCCCCACCTGCCTGGGAGACAGG - Intronic
1128312559 15:66640409-66640431 CTCCAACCTTCATGAAAGGATGG - Intronic
1129242483 15:74259722-74259744 TCCCAACCCTCCTGGGAGGGTGG - Intronic
1129404687 15:75308187-75308209 CTCCAGCCTTCCTGGAAACCCGG - Intergenic
1129465584 15:75722594-75722616 CCCCCACCTTCCTGGTGAGCGGG - Intergenic
1132444286 15:101897301-101897323 CACAAACCTTCATGGAAGGCTGG - Intergenic
1132845709 16:1999940-1999962 TCCCAGCCTTCCTGGTGGGCTGG + Exonic
1134680601 16:16122281-16122303 CTCCATCCTTTCTGCAAGGCCGG - Intronic
1135750879 16:25058012-25058034 GCCCAACCTTACTGCAAGCCTGG - Intergenic
1136169071 16:28477395-28477417 CCCAGACCTGCCGGGAAGGCTGG + Exonic
1137066806 16:35855305-35855327 TGCAAACCTTCTTGGAAGGCTGG + Intergenic
1138899174 16:61247688-61247710 TGCAAACCTTCTTGGAAGGCCGG + Intergenic
1138899350 16:61250306-61250328 CCCCATCCTTTCTGGAAGCAAGG + Intergenic
1139953282 16:70681954-70681976 CCCCATCCTACATGGAAGGGAGG - Intronic
1141463494 16:84191899-84191921 CCTTAACCTCCCTGGAAGTCAGG - Intronic
1141890814 16:86925434-86925456 CCCCTGCCTCCCTGGAAGCCAGG - Intergenic
1142020251 16:87777830-87777852 AACCATACTTCCTGGAAGGCGGG - Intergenic
1142349731 16:89574677-89574699 AGCCAACCTCCCGGGAAGGCAGG + Intergenic
1142579058 17:929530-929552 TCCCAATATTCCAGGAAGGCTGG + Intronic
1142689674 17:1597926-1597948 CTGCAACCTACCTGGGAGGCAGG - Intronic
1142991282 17:3732816-3732838 CCACAGCCTGGCTGGAAGGCCGG + Intronic
1143022241 17:3922897-3922919 GCCCTACCTTCCTGGAAGCCGGG - Intergenic
1143125422 17:4638680-4638702 CCCCATCCTGCCCTGAAGGCTGG - Exonic
1143259080 17:5584804-5584826 CCCCACCCATCCTGAGAGGCTGG - Intronic
1143392193 17:6566019-6566041 CCACAACCCTCCCAGAAGGCAGG + Intergenic
1144414010 17:15029265-15029287 CCCCAGGCTTCCTTGATGGCAGG + Intergenic
1144956560 17:19021633-19021655 CCTCAACCTTCCTGGCAGATGGG + Exonic
1145069955 17:19796422-19796444 TGCAAACCTTCTTGGAAGGCCGG + Intronic
1145251969 17:21301687-21301709 TCCCAACCTTCCTGTCAGGAGGG + Intronic
1146903125 17:36601111-36601133 CCCCAGCGATCCAGGAAGGCAGG - Intergenic
1146935388 17:36809746-36809768 CTCCAAACTTCCTGGAAAACTGG + Intergenic
1147585270 17:41651024-41651046 CATCACCCTGCCTGGAAGGCCGG - Intergenic
1147893372 17:43733319-43733341 CTCTAACCTCCCTGGAAGTCAGG - Intergenic
1151357994 17:73571723-73571745 GCTCACCTTTCCTGGAAGGCAGG - Intronic
1151581348 17:74981041-74981063 CCTCAACCTCCCTGGTAGGTGGG + Intergenic
1152541694 17:80979890-80979912 CCCCCATCCTCCTGGAAGGCTGG + Intergenic
1154481094 18:14825625-14825647 CACAAACCTTCTTGGAAGGCCGG - Intronic
1155542805 18:26885319-26885341 CCACAACCCCCCTGGATGGCAGG + Intergenic
1155751206 18:29423894-29423916 TACAAACCTTCTTGGAAGGCCGG - Intergenic
1156281029 18:35638654-35638676 TGCAAACCTTCTTGGAAGGCCGG - Intronic
1157319902 18:46625996-46626018 ACCCAGCCTTCCTGGAGGGCAGG + Intronic
1157491051 18:48124102-48124124 CCCCAACTCTCCAGGCAGGCTGG + Intronic
1157863187 18:51159949-51159971 ACCCACCCTTCTTAGAAGGCAGG - Intergenic
1157971668 18:52276834-52276856 CCCCAAGCTTGCTTGAAGGTAGG + Intergenic
1159798208 18:72868151-72868173 CCACGACCCTCCTGGAAGCCCGG + Intergenic
1160021348 18:75184220-75184242 CCCCATCGTCACTGGAAGGCTGG + Intergenic
1160531153 18:79565492-79565514 CTCCAAGCTTCCTCGGAGGCTGG - Intergenic
1160641067 19:137514-137536 CACAAACCTTCATGGAAGGCTGG + Intergenic
1160918997 19:1511066-1511088 CCTCAACTTTCCTGTAAGGGAGG - Exonic
1161409223 19:4107589-4107611 CCTCAACCTTCCAGGTAGCCGGG - Intronic
1161826286 19:6568330-6568352 CACAAACTTTCTTGGAAGGCCGG - Intergenic
1161949852 19:7462001-7462023 CCCCTACCTCCCAGGAATGCAGG + Intronic
1163262516 19:16199698-16199720 CCCCCGCCTTCTTGGAAGGAGGG + Intronic
1165110779 19:33500836-33500858 CCACAACCTTGCTGGATGTCAGG - Intronic
1166427876 19:42696124-42696146 CACAAACCTTCTTGGAAGGCCGG + Intronic
1168138635 19:54369337-54369359 CCCCAACCTTCCTGGGCACCTGG - Intronic
1168258436 19:55179685-55179707 CCCCAATTTTGCTGGAGGGCGGG + Intronic
1168465958 19:56601291-56601313 TTCCAACCATCCTGGAAGGTAGG - Intronic
925029552 2:638903-638925 CCCCAACCTTCTTGGAACCAGGG + Intergenic
925610142 2:5695922-5695944 CCCCACCCATCCTGGCGGGCGGG + Exonic
926165899 2:10522071-10522093 CCCCAGGCTTCGTGGGAGGCCGG - Intergenic
927132208 2:20070318-20070340 CCCCAACCTTCCTGGCACCAAGG + Intergenic
927507462 2:23623649-23623671 CCCCAGCCTTCTTGGACTGCGGG - Intronic
927527421 2:23758451-23758473 CCCCAAACTTTCTGGCAGCCTGG - Intronic
929980215 2:46671391-46671413 CCCCAGCCCTCTTTGAAGGCAGG - Intergenic
930938585 2:56985338-56985360 TGCAAACCTTCTTGGAAGGCTGG - Intergenic
931826771 2:66008388-66008410 CCTCAACCTTCACTGAAGGCAGG - Intergenic
932140767 2:69275673-69275695 CCCCCACCTTCCTGACAGGAAGG + Intergenic
932419902 2:71595559-71595581 CTCCAACCTTCCTGGAGCTCCGG - Intronic
932490301 2:72115910-72115932 CCCCACCCTCACTGGAGGGCCGG - Intergenic
932750107 2:74366112-74366134 CACCATCCTGCCTAGAAGGCAGG - Intronic
933026178 2:77262340-77262362 CCCCAACCTTTCTGGCAGCAAGG - Intronic
933104349 2:78304078-78304100 CCTCAGCCTTCCTGGTAGGTGGG - Intergenic
935534220 2:104274146-104274168 CCCCATCCTGGCTGGAAGCCCGG + Intergenic
936597701 2:113865036-113865058 CACAAACCTTCTTGTAAGGCTGG + Intergenic
938087964 2:128413833-128413855 CCCTAATCATCCTGGAAGTCTGG - Intergenic
938299613 2:130200839-130200861 CCTCAGCCTTCCTTGTAGGCTGG + Intergenic
938364806 2:130726561-130726583 CCTCCACCTTCCTAGAGGGCAGG + Intergenic
941504899 2:166330586-166330608 CCCCAACCTTCTTGGAACCAAGG + Intronic
943480410 2:188410827-188410849 CACAGACCTTCATGGAAGGCTGG + Intronic
944037102 2:195308127-195308149 CACAAATCTTCTTGGAAGGCCGG - Intergenic
945232566 2:207608012-207608034 CACCAACATTCCTGGAAGCTGGG - Intronic
945362712 2:208910929-208910951 AGCAAACCTTCTTGGAAGGCCGG + Intergenic
945963399 2:216160188-216160210 CCCCAACCTTCCTGCAAAGGGGG - Intronic
946359908 2:219213061-219213083 CCCCACCTTTCCTTGCAGGCGGG - Exonic
947110334 2:226711252-226711274 CCCCAGCCTTCTTCAAAGGCTGG - Intergenic
947556951 2:231101347-231101369 TGCAAACCTTTCTGGAAGGCCGG - Intronic
947715461 2:232336857-232336879 CCCCAGTCCTCCTGGGAGGCTGG + Exonic
948282584 2:236759265-236759287 CCTCAGCCTTCCAGGAAGGTGGG + Intergenic
949003896 2:241634450-241634472 TCCCAACTTGCCTGGAAGGTAGG + Intronic
1168851951 20:983022-983044 TCCCACCCTTCCTGGAATCCTGG - Intronic
1169645635 20:7806590-7806612 TACAAACCTTCTTGGAAGGCCGG + Intergenic
1170572631 20:17641078-17641100 CCCCAGCCTTCCTGGAGGAAGGG - Intronic
1170817068 20:19722339-19722361 CCCCTCCCTTCCTGGAGGGATGG + Exonic
1171231916 20:23493611-23493633 CCCCAACCTTCCTGGAAACCTGG - Intronic
1172270525 20:33653329-33653351 CCCCAAGCCTCTTGGAAGGAAGG - Intergenic
1174262226 20:49304912-49304934 CACCAACCATCCAGGATGGCAGG - Intergenic
1174425856 20:50431085-50431107 CCCCAGCCTTCTAGGATGGCAGG + Intergenic
1176058759 20:63162587-63162609 GCTCACCCTTCCTGGCAGGCAGG - Intergenic
1176799510 21:13410990-13411012 CACAAACCTTCTTGGAAGGCCGG + Intergenic
1177532184 21:22374536-22374558 CACAAACCTTCCAGGAAGGCCGG + Intergenic
1178938425 21:36884230-36884252 TGCAAACCTTCTTGGAAGGCTGG - Intronic
1180564686 22:16652861-16652883 CACAAAACTTCTTGGAAGGCTGG - Intergenic
1181427103 22:22850809-22850831 TCACAACCTGCCTGGAGGGCTGG - Intronic
1183228096 22:36563776-36563798 CCCCAATCTCCCAGGGAGGCAGG + Intergenic
1183303855 22:37071557-37071579 CTCCAATCTTCCTACAAGGCAGG + Intronic
1184652919 22:45927298-45927320 CCCCAAGCTCCCTGGGGGGCGGG - Intronic
949120504 3:378369-378391 CTCCATCCTTCCTGGAACCCTGG - Intronic
953414831 3:42709649-42709671 CCCTACCCTTTCAGGAAGGCGGG + Intronic
953451231 3:43008204-43008226 CTGCAACCTCCCTGGAAGGGAGG - Intronic
953687916 3:45092776-45092798 ACCCGACCCTCCTGGGAGGCTGG - Intronic
953727330 3:45411499-45411521 CACAAATCTTCTTGGAAGGCTGG - Intronic
953800382 3:46018297-46018319 ACCCACCCTTCTTAGAAGGCAGG - Exonic
954244608 3:49320952-49320974 TCCCAGCCTTCCTGAAAGCCAGG + Intronic
954539457 3:51384320-51384342 CCGCATCCTGCCTTGAAGGCAGG + Intergenic
955410661 3:58653502-58653524 CTCCACCCTTCCTGGTAGTCTGG + Intronic
956359434 3:68431136-68431158 CCCCAGATTTCATGGAAGGCTGG - Intronic
956731163 3:72197966-72197988 TCCCAACATCCCTGGAAGGTGGG + Intergenic
957027018 3:75193445-75193467 CCCCAACCTTCTGGGAAGAAAGG - Intergenic
957693511 3:83602195-83602217 CCCCAAATTTCCTGGAGGTCTGG + Intergenic
960946692 3:122971725-122971747 CCCAAGGCTTTCTGGAAGGCAGG + Intronic
961223626 3:125219591-125219613 CCCCAACTTCCCTGGGAGCCAGG - Intergenic
961320051 3:126066679-126066701 CACAAACCTTCTTGGAAGGCCGG + Intronic
962736872 3:138333248-138333270 CCACAACATTCCTGAAAGGTAGG - Intergenic
962911716 3:139857768-139857790 CACCCAACTTCCAGGAAGGCTGG + Intergenic
962911718 3:139857770-139857792 TCCCAGCCTTCCTGGAAGTTGGG - Intergenic
963084019 3:141420157-141420179 CCCCACCCTGCCTGGAATTCAGG - Intronic
965478147 3:169183680-169183702 TCCCTGCCTTCTTGGAAGGCAGG - Intronic
965818285 3:172659199-172659221 CAAAAACCTTCTTGGAAGGCTGG + Intronic
966187434 3:177240673-177240695 ACACAACCTTCCTGGACCGCAGG - Intergenic
966941829 3:184752753-184752775 TGCCAACCTTGTTGGAAGGCTGG + Intergenic
966958643 3:184910711-184910733 CCCTAACCTTCCTGGCACGGCGG - Intronic
967180813 3:186902346-186902368 CCTCAACCTTCCTGGTAGTTGGG - Intergenic
967626334 3:191689152-191689174 TACAAACCTTCTTGGAAGGCTGG - Intergenic
967876043 3:194269124-194269146 CCTTAACTTTCCTGGAAGGCAGG - Intergenic
967876141 3:194269763-194269785 CCCCACCCTTCCTGGCAGCCAGG + Intergenic
968282533 3:197488007-197488029 CCCAGACCTGCCTGGGAGGCAGG + Intergenic
968389101 4:174187-174209 CACAAACCTTCTTGGAAGGCCGG - Intergenic
968472125 4:787014-787036 CCGGAGGCTTCCTGGAAGGCAGG - Intronic
968861343 4:3173306-3173328 CCACACACTTCTTGGAAGGCCGG - Intronic
969273018 4:6115820-6115842 CCCCATCCTGCCTGCGAGGCCGG - Intronic
969342535 4:6551181-6551203 CTCCAATCCCCCTGGAAGGCAGG - Intronic
969468145 4:7369920-7369942 CCCCTTCCCTTCTGGAAGGCAGG + Intronic
969666097 4:8558329-8558351 CCCGTGACTTCCTGGAAGGCCGG - Intergenic
972209179 4:36815938-36815960 CACACACCTTCTTGGAAGGCTGG - Intergenic
972279735 4:37590453-37590475 CTCAACCCTTCCTGGAAGGAGGG + Exonic
972565001 4:40261744-40261766 CACAAACCTTCTTAGAAGGCAGG - Intergenic
972744660 4:41921461-41921483 CACAAACCTTCTTGGAATGCTGG + Intergenic
973041483 4:45474985-45475007 AACAAACCTTCTTGGAAGGCTGG - Intergenic
973802401 4:54492178-54492200 TCCCAACCTACCTAGAAGACAGG - Intergenic
974175409 4:58316070-58316092 TGCAAACCTTCTTGGAAGGCCGG - Intergenic
975085799 4:70338024-70338046 CTCCAGCCTTTCTGGAAGGCTGG + Intergenic
976445850 4:85129167-85129189 TACAAACCTTCTTGGAAGGCTGG - Intergenic
977306022 4:95324544-95324566 CCCCAACCTTTTTGGCAGGAGGG - Intronic
977609634 4:99018826-99018848 ACCCGATCTCCCTGGAAGGCCGG - Intronic
978209157 4:106114231-106114253 TGCAAACCTTCTTGGAAGGCGGG + Intronic
979341964 4:119535381-119535403 TGCAAACCTTCTTGGAAGGCTGG - Intronic
979630794 4:122900236-122900258 TGCAAACCTTCTTGGAAGGCTGG - Intronic
979630810 4:122900389-122900411 TGCAAACCTTCTTGGAAGGCTGG - Intronic
979681752 4:123467551-123467573 GCCCCGCCTTCCTGCAAGGCAGG + Intergenic
980480149 4:133377286-133377308 CCCCAGCCTTCCTGGTAGCTGGG + Intergenic
980579370 4:134729865-134729887 CCCCAACCTTCTTGGCAGCAGGG - Intergenic
982031512 4:151306386-151306408 TCCTAACAATCCTGGAAGGCAGG - Intronic
982117413 4:152109121-152109143 CCCCACCCTTTCTGGATGCCAGG - Intergenic
982388263 4:154836400-154836422 CACAAACCTTCTTGGAAGGCTGG - Intergenic
982440268 4:155426969-155426991 CACAAACCTTCTTGGAAGGCCGG + Intergenic
982668376 4:158292828-158292850 TGCCAACCTTCTTGGAAGGGTGG + Intergenic
982832175 4:160076179-160076201 TGCAAACCTTCCTGGAAGGCCGG - Intergenic
983899652 4:173120268-173120290 CCCTATTATTCCTGGAAGGCAGG - Intergenic
988325410 5:29759415-29759437 CACAAACCTTCTTGGAAGTCTGG - Intergenic
988800977 5:34696511-34696533 CCCCAACCTAGCTGCAAGGAAGG + Intronic
990468847 5:56094829-56094851 CCCCAACCTTCCTGGCACCAGGG + Intergenic
990970939 5:61505433-61505455 GCCCAACCTCACTGGAAGCCAGG - Intronic
991678224 5:69110217-69110239 AGCAAACCTTCTTGGAAGGCTGG - Intronic
992012041 5:72538359-72538381 CCCAAGCCTTCCTGGAAATCTGG + Intergenic
992228217 5:74639882-74639904 CCCCAACTTTCCTCCAAGCCGGG + Intronic
993574642 5:89586576-89586598 CCCCAATGTGCCTGGAAGACAGG - Intergenic
994553043 5:101261213-101261235 CGCAAACCCTCTTGGAAGGCCGG - Intergenic
995206094 5:109483095-109483117 CACAAACCTTCTTGGAAGGCCGG - Intergenic
995708237 5:115007643-115007665 ACCAAACCTGCCTGGAAGGGAGG + Intergenic
997340685 5:133142299-133142321 CCCTAACGTTCCAGGGAGGCAGG - Intergenic
999354638 5:150914648-150914670 CACAAACCTTCTTGGAAGGCTGG - Intergenic
999354838 5:150916281-150916303 CACAAACCTTCTTGGAAGGCCGG - Intergenic
999822910 5:155246772-155246794 CCCCAACCCACCAGGAATGCGGG + Intergenic
1001289938 5:170449913-170449935 CTCAAACCTTCTTGGAAGGCCGG + Intronic
1001422133 5:171596233-171596255 CCCCTACCTTCCTGGGAAGGAGG - Intergenic
1002736283 5:181388907-181388929 CACAAACCTTCATGGAAGGCTGG - Intergenic
1002739119 5:181421516-181421538 CCCCCAGATTCCTTGAAGGCAGG - Intergenic
1002748414 6:85917-85939 CACAAACCTTCATGGAAGGCTGG + Intergenic
1004001775 6:11602813-11602835 CCTCAGCCTTCCTGGATGCCTGG + Intergenic
1004093945 6:12534227-12534249 CTCCAGCCTTTCTGGAAGGGAGG - Intergenic
1005616013 6:27574141-27574163 ACCCAACCTTTCTGGAAGCCAGG + Intergenic
1005673652 6:28132474-28132496 CCCCAACCTTTCTGGAACCAGGG + Intergenic
1006031614 6:31180503-31180525 CCTCAACCTCCCCGGAGGGCTGG + Intronic
1006280492 6:33049284-33049306 CACAAACCTTCTTGGAAGGCCGG + Intergenic
1006389959 6:33752377-33752399 CCCCCTCGTGCCTGGAAGGCAGG - Intergenic
1007992210 6:46268842-46268864 CCCCATTATTTCTGGAAGGCAGG + Intronic
1008943730 6:57074340-57074362 CACAAACTTTCTTGGAAGGCTGG + Intergenic
1009491562 6:64299043-64299065 CACAAACCTTCTTGGAAGGCCGG + Intronic
1010211353 6:73364614-73364636 CCACGACCTTCGTGGAAGGTGGG - Intergenic
1010914706 6:81601616-81601638 CCCCTACCTTCCTGAATGACAGG + Intronic
1012573659 6:100763502-100763524 CTCAAAACTTCTTGGAAGGCAGG + Intronic
1012588627 6:100951930-100951952 CGCAAACCTTCTTGGAAGGCTGG + Intergenic
1013059787 6:106622358-106622380 CACAAACCTACTTGGAAGGCCGG + Intronic
1015023102 6:128500891-128500913 TCCCAGCCTACCTGGGAGGCAGG - Intronic
1015835147 6:137412787-137412809 CCCCAGCCAGCCTGGAAGCCTGG - Intergenic
1016572520 6:145531112-145531134 CACAAATCTTCTTGGAAGGCTGG + Intronic
1016909711 6:149185856-149185878 TACAAACCTTCCTGGAAGGCCGG + Intergenic
1017627972 6:156367738-156367760 CTCCAACCTACCTGGTAGGTGGG - Intergenic
1018262876 6:161988119-161988141 CCCCAACAGTGATGGAAGGCCGG - Intronic
1019058548 6:169239955-169239977 CTCCAAGCTTCCTGGAAGGAGGG + Intronic
1019241381 6:170664435-170664457 CACAAACCTTCATGGAAGGCTGG - Intergenic
1019244229 6:170697068-170697090 CCCCCAGATTCCTTGAAGGCAGG - Intergenic
1019523215 7:1469688-1469710 CCCCAACCTGGCTGGGAGGGAGG + Intergenic
1020589552 7:10117427-10117449 CCTCAACCTCCCTGGTAGCCAGG + Intergenic
1020992643 7:15220016-15220038 TCCCACCCGTCCTTGAAGGCAGG + Intronic
1021313033 7:19116502-19116524 CCCCAGCGTCCCCGGAAGGCCGG - Intronic
1022467850 7:30663467-30663489 CTTCAACCACCCTGGAAGGCAGG - Intronic
1023397193 7:39762237-39762259 CACAAACCTTCTTGGAAAGCTGG - Intergenic
1023410183 7:39882449-39882471 CACAAACCTTCTTGGAAAGCTGG + Intergenic
1025124653 7:56335060-56335082 CCCAGACCTTCCTGCAAGGTTGG - Intergenic
1028408029 7:90497599-90497621 CCCCACCCTTCCTAGTAGCCTGG - Intronic
1028546728 7:92010168-92010190 CACAAACCTTCTTGGGAGGCCGG + Intronic
1029294974 7:99533282-99533304 CCCCAACCTTCCTGGAAGGCAGG - Exonic
1030502940 7:110383138-110383160 AGCAAACCTTCTTGGAAGGCTGG - Intergenic
1030604192 7:111621916-111621938 TCTAAACCTACCTGGAAGGCAGG - Intergenic
1031156955 7:118121420-118121442 AGCAAACCTTCTTGGAAGGCTGG + Intergenic
1032587801 7:133163789-133163811 CCCCAACCTTCCTGGCACTGGGG + Intergenic
1033223078 7:139541673-139541695 CCCCAAGCTTCCTGCAAATCAGG + Intronic
1033985674 7:147222886-147222908 ACCCAACTTTCCTGGAAGAAAGG - Intronic
1035506736 8:143660-143682 CACAAACCTTCATGGAAGGCTGG + Intergenic
1036107080 8:5852921-5852943 CCCAAACCTTCTTGGAAGGCTGG - Intergenic
1036107611 8:5857494-5857516 CACAAACCTTCTTGGAAGGCTGG - Intergenic
1036548946 8:9799885-9799907 CACAAACCTTCTTGGAAGGCTGG + Intergenic
1036550580 8:9811963-9811985 CACAAACCTTCTTGGAAGGCTGG + Intergenic
1037922542 8:22817540-22817562 CTCCAACCTTCCTGGATGAGAGG + Intronic
1038090908 8:24251971-24251993 TGCAAACCTTCTTGGAAGGCCGG - Intergenic
1038732446 8:30139348-30139370 CCCTGACCGTCCTGGAAGTCTGG + Intronic
1039656086 8:39409318-39409340 CGCAAACCTTCTTGGAAGGCTGG - Intergenic
1039952309 8:42181808-42181830 CCCCACCCAGCCTGGAAGTCTGG + Intronic
1048001515 8:130383179-130383201 GCCAAACCTCCCTGCAAGGCAGG + Intronic
1048302488 8:133261711-133261733 CGCCAGCCTTGCAGGAAGGCTGG + Intronic
1048302490 8:133261713-133261735 CCCCAGCCTTCCTGCAAGGCTGG - Intronic
1048350150 8:133609355-133609377 TGCAAACCTTCTTGGAAGGCTGG - Intergenic
1050398730 9:5228658-5228680 TGCAAACCTTCTTGGAAGGCTGG + Intergenic
1050557748 9:6804382-6804404 CCTCCACCTTTCTGGAAAGCTGG + Intronic
1050925076 9:11254800-11254822 CGCAAACATTCTTGGAAGGCAGG - Intergenic
1050925746 9:11260529-11260551 CGCAAACCTTCTTGGAAGGCTGG - Intergenic
1052116924 9:24660113-24660135 CACAAACCTTCTTGGAAGGCCGG - Intergenic
1052618695 9:30877245-30877267 CACAAACCTACCTTGAAGGCCGG + Intergenic
1052644024 9:31208798-31208820 CCACAACAATCCTGCAAGGCAGG - Intergenic
1053468124 9:38325068-38325090 CCACCACCCTCCTGGAAGGGCGG - Intergenic
1056940274 9:90949595-90949617 CAGTTACCTTCCTGGAAGGCTGG + Intergenic
1057164381 9:92914532-92914554 CCCCAACCTTCCTTGAAGCCTGG + Intergenic
1057938194 9:99258116-99258138 CCCAAGCCCTCCTGGAAGGCAGG + Intergenic
1058046638 9:100364410-100364432 CACAAACCTTCTTGGAAGGCCGG - Intergenic
1058047187 9:100369146-100369168 CACAAACCTTCTTGGAAGGCTGG - Intergenic
1059250105 9:112880581-112880603 CCCCAACCTCCCTGGTAGGTGGG + Intronic
1060156874 9:121326339-121326361 CTCCACCCTTCCTGGAATTCTGG + Intronic
1060818476 9:126648314-126648336 CCCTAGCCTCCCTCGAAGGCAGG + Intronic
1061593201 9:131612169-131612191 CACAAACCTTCTTGGAAGGCTGG - Intronic
1061669996 9:132183242-132183264 CCCCCTCCTTCCAGGAAGACAGG - Intronic
1061670642 9:132186317-132186339 CCCAAACATTCCTGGAAATCTGG + Intronic
1061720430 9:132547741-132547763 CACCAACCTTGCTTGAAGGGCGG + Intronic
1062368306 9:136222723-136222745 CCCCTACCTGCCTGGCATGCTGG - Intronic
1203601573 Un_KI270748v1:13669-13691 CACAAACCTTCATGGAAGGCTGG - Intergenic
1185579299 X:1198174-1198196 CTCCCACCTCCCAGGAAGGCAGG + Intronic
1185579320 X:1198234-1198256 CTCCCACCTCCCAGGAAGGCAGG + Intronic
1185579332 X:1198266-1198288 CTCCCACCTCCCAGGAAGGCAGG + Intronic
1185579344 X:1198298-1198320 CTCCCACCTCCCAGGAAGGCAGG + Intronic
1185579385 X:1198418-1198440 CTCCCACCTCCCAGGAAGGCAGG + Intronic
1186009805 X:5116700-5116722 CCCCCACCATCCTGGAGGCCAGG - Intergenic
1189155487 X:38752217-38752239 GCTCAACCTTCCCGGAAGCCAGG + Intergenic
1189249311 X:39587706-39587728 TCCCAGCCTTCCTGGAATACAGG + Intergenic
1189273516 X:39768393-39768415 TCCCAACCTTCCTTGAAGTTAGG - Intergenic
1189634441 X:42990831-42990853 CCTCTACCTTGCTGGAAGTCAGG + Intergenic
1190629933 X:52376546-52376568 CCCCAACCTTCCCTGAAGTTTGG - Intergenic
1191634886 X:63364549-63364571 AGCAAACCTTCCTGGAAGGCTGG - Intergenic
1191688996 X:63920896-63920918 CTCCTACCTTCCTGGAACGCTGG + Intergenic
1192147626 X:68692562-68692584 CCACACCATTCCTAGAAGGCAGG - Intronic
1193251012 X:79290643-79290665 TCCCCATCTTCCTGAAAGGCTGG - Intergenic
1194765306 X:97842105-97842127 CCCCAACCTTCCTTGAAGCGCGG - Intergenic
1195161430 X:102175583-102175605 CACAAACCTTCTTGGAAGGCCGG - Intergenic
1195162176 X:102181582-102181604 CACAAACCTTCTTGGAAGGCCGG - Intergenic
1196387412 X:115173576-115173598 CACAAACCTTCTTGGAAGGCTGG - Intronic
1198638966 X:138734793-138734815 CCTGTGCCTTCCTGGAAGGCAGG + Intronic
1198683156 X:139203448-139203470 CCCCAACCCTCCGGGAAGGCAGG - Intronic
1199053995 X:143270770-143270792 TGCAAACCTTCTTGGAAGGCCGG - Intergenic
1199345613 X:146735057-146735079 TGCAAACCTTCTTGGAAGGCTGG - Intergenic
1199360146 X:146907692-146907714 CCCCACCCTCCTTGGCAGGCTGG - Intergenic
1199366653 X:146993979-146994001 CCCAAACCTTCCTGGCTGTCTGG - Intergenic
1199776352 X:151015333-151015355 CGGCTACCTCCCTGGAAGGCAGG + Intergenic
1200849434 Y:7867704-7867726 CGCAAACCTTCTTGGAAGGCTGG - Intergenic
1201326628 Y:12767337-12767359 TGCAAACCTTCTTGGAAGGCTGG - Intronic
1201537173 Y:15063260-15063282 CCCCCACCTCCCTGACAGGCCGG + Intergenic
1202601097 Y:26593817-26593839 CACAAAACTTCTTGGAAGGCTGG - Intergenic