ID: 1029296788

View in Genome Browser
Species Human (GRCh38)
Location 7:99546605-99546627
Sequence CAGCAGTGGGAGACCGAGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1569
Summary {0: 1, 1: 2, 2: 43, 3: 256, 4: 1267}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029296788_1029296796 6 Left 1029296788 7:99546605-99546627 CCCACCTCGGTCTCCCACTGCTG 0: 1
1: 2
2: 43
3: 256
4: 1267
Right 1029296796 7:99546634-99546656 CAGGCGTAAGCCACCACACCTGG 0: 224
1: 6834
2: 39826
3: 122873
4: 212164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029296788 Original CRISPR CAGCAGTGGGAGACCGAGGT GGG (reversed) Exonic
900231353 1:1560098-1560120 CAATACTGGGAGACCGAGGCAGG - Intronic
900231396 1:1560390-1560412 CAGCCTGGGGAGACCGAGGCAGG - Intronic
900268150 1:1770798-1770820 CAACACTGGGAGGCCGAGGTGGG + Intronic
900340531 1:2186625-2186647 CACCTGTGTGAGACCCAGGTCGG - Intronic
900860853 1:5229077-5229099 CAGGAGTTGGAGACCAAGCTGGG + Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901321629 1:8343682-8343704 CAGCACGGGGTGACCGAGCTCGG - Intronic
901470927 1:9455996-9456018 CAGCAGGGGGACACCCAGGCTGG - Intergenic
901568809 1:10142422-10142444 CAACACTGGGAGGCCGAGGTGGG + Intronic
901606175 1:10461154-10461176 CAGCACTGGGAGGCCGAGGGGGG - Exonic
901802965 1:11719761-11719783 TAGCAGTGGGAGATCAAGTTGGG + Exonic
901847743 1:11994993-11995015 CAGCACTGGGAGGCTGAGGCAGG + Intronic
902007078 1:13240699-13240721 CAACTTTGGGAGGCCGAGGTGGG + Intergenic
902026128 1:13384979-13385001 CAACTTTGGGAGGCCGAGGTGGG + Intergenic
902139150 1:14337645-14337667 CAGCACTGGAAGGCCGATGTGGG + Intergenic
902314620 1:15608764-15608786 CAGCACTGTGAGACTGAGGTGGG - Intergenic
902327819 1:15713882-15713904 CCGCTTTGGGAGGCCGAGGTGGG - Intronic
902554066 1:17236506-17236528 GTGCTGTGGGAGGCCGAGGTGGG + Intronic
903011409 1:20333225-20333247 CAGCTTTGGGAGGCCGAGGCAGG + Intronic
903063711 1:20686805-20686827 GAACTTTGGGAGACCGAGGTGGG - Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903121451 1:21219197-21219219 CAACAGTGGGAGCCCTAGCTGGG - Intronic
903203705 1:21764460-21764482 GCGCAGTGGGAGGCCGAGGCTGG + Intronic
903251742 1:22059069-22059091 CAGCTCTGGGAGGCCAAGGTGGG - Intronic
903533866 1:24053512-24053534 CAGCACTGGGAGGCTGAGGCGGG + Intergenic
903847732 1:26288469-26288491 CAGCACTGAGAGAATGAGGTGGG + Intronic
903883489 1:26528389-26528411 CAGCACTGGGAGGCCGAGGCGGG - Intergenic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904022600 1:27479038-27479060 GAGCTTTGGGAGGCCGAGGTGGG + Intronic
904168625 1:28575397-28575419 CAGCATTGGGAGGCAGAGGCGGG - Intronic
904189497 1:28732686-28732708 CAACACTGGGAGGCCAAGGTGGG - Intergenic
904202799 1:28832369-28832391 CTGCTTTGGGAGGCCGAGGTGGG + Intronic
904657329 1:32058908-32058930 GCGCTTTGGGAGACCGAGGTGGG + Intronic
904689127 1:32280699-32280721 CAACACTGGGAGGCCGAGGCAGG - Intronic
904700449 1:32354850-32354872 CAGCACTGGGAGGCCGAGGAGGG - Intronic
904715046 1:32461390-32461412 CAGCACTAGGAGAACGAGGCAGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905138856 1:35824550-35824572 GTGCTGTGGGAGATCGAGGTGGG + Intronic
905153857 1:35956892-35956914 CAACTTTGGGAGGCCGAGGTGGG - Intronic
905160661 1:36030725-36030747 CAGCATTGGGAGGCTGAGGCGGG - Intronic
905165271 1:36077975-36077997 CAACACTGGGAGGCCGAGGCGGG + Intergenic
905187295 1:36205602-36205624 CAGCACTGGGAGGCTGAGGTGGG + Intergenic
905304456 1:37007868-37007890 CAGCAGTGGGAGGTGGAAGTGGG + Intronic
905362852 1:37432169-37432191 CAGCACTGGGATGCCAAGGTGGG + Intergenic
906121060 1:43391066-43391088 CAACACTGGGAGGCCGAGGTGGG + Intronic
906273833 1:44501423-44501445 CAGCTGTGGGACACCCAGGCTGG + Intronic
906317370 1:44796816-44796838 CAGCACTGGGAGGCCGAGGCCGG - Intergenic
906421799 1:45675050-45675072 CTTCATTGGGAGGCCGAGGTGGG + Intronic
906421961 1:45676460-45676482 CAGCTTTGGGAGGCCGAGGTGGG + Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906467747 1:46098946-46098968 CAGCTCTGGGAGACTGAGGTGGG - Intronic
906625886 1:47325260-47325282 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
906670824 1:47653329-47653351 CAGCACTGGGAGGCCAAGGTGGG - Intergenic
906735721 1:48125151-48125173 CAACACTGGGAGGCCGAGCTGGG + Intergenic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907010070 1:50954650-50954672 CAGCTGTGGGAGGCTGAGGCAGG - Intronic
907084130 1:51653748-51653770 CAACACTGGGAGACCGAGCGAGG + Intronic
907362399 1:53929161-53929183 CACCAGGGGGAGACTGGGGTGGG + Intronic
907858714 1:58328848-58328870 CAGGATTGGGAGGCCGAGGCAGG - Intronic
907887951 1:58610997-58611019 CAGCTGTGGCAGACAGAGGTGGG - Intergenic
908076567 1:60525979-60526001 CAAAACTGGGAGGCCGAGGTGGG + Intergenic
908125529 1:61026471-61026493 CAACACTGGGAGACTGAGGCGGG + Intronic
908232505 1:62119691-62119713 CAGCACTGGGAGTTCGAGGCGGG + Intronic
908302591 1:62776965-62776987 CAAAATTGGGAGGCCGAGGTGGG - Intergenic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908696959 1:66854553-66854575 CAGCACTGGGAGGCGGAGGCAGG + Intronic
909031448 1:70545835-70545857 CAACACTGGGAGGCCAAGGTGGG - Intergenic
909101722 1:71357383-71357405 CACCAGAGGGAGACCCAGTTAGG - Intergenic
909446467 1:75754454-75754476 CAACACTGGGAGGCCAAGGTGGG - Intronic
909626052 1:77717111-77717133 CAGCACTGGGAGGCCAAGGCAGG - Intronic
909626834 1:77726396-77726418 CAACACTGGGAGGCCAAGGTGGG + Intronic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
909646413 1:77922012-77922034 CAACTTTGGGAGGCCGAGGTGGG - Intronic
910404961 1:86878431-86878453 CAGCATTGGGAGGCCAAGGCAGG + Intronic
910596324 1:88984456-88984478 CAACACTGGGAGGCCGAGGCAGG - Intronic
910666162 1:89727827-89727849 CAGCAGTGGGAAACTGGGGAAGG + Intronic
910689109 1:89948006-89948028 CAGCATTGGGAGGCTGAGGCGGG - Intergenic
910910163 1:92224985-92225007 GAGCTTTGGGAGGCCGAGGTGGG - Intronic
911317125 1:96369183-96369205 CAGCACTGGGAGACTGAGGCAGG + Intergenic
912094037 1:106117120-106117142 GAACTTTGGGAGACCGAGGTGGG - Intergenic
912343041 1:108936341-108936363 CAGCACTGGGAGGCCGAGGCAGG - Intronic
912495907 1:110091155-110091177 CAGCACTGGAAGGCCGAGGCAGG - Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
912835477 1:112992720-112992742 CAGGAGTTGGAGACCAAAGTGGG - Intergenic
912927071 1:113922621-113922643 CAGGACTGGGAGGCCGAGGTAGG - Intergenic
913244561 1:116860277-116860299 CAGCAAAGGGAGATAGAGGTGGG + Intergenic
913958952 1:143324552-143324574 CGGCATTGGGGGACGGAGGTGGG - Intergenic
914053269 1:144149932-144149954 CGGCATTGGGGGACGGAGGTGGG - Intergenic
914125928 1:144816609-144816631 CGGCATTGGGGGACGGAGGTGGG + Intergenic
914238335 1:145832773-145832795 CAGCACTTGGAGTCCGAGGCAGG + Intronic
914762984 1:150614092-150614114 CAGCAATGGCAGGCTGAGGTGGG - Intronic
914788987 1:150859761-150859783 GAGCTTTGGGAGACCAAGGTGGG + Intronic
914841476 1:151252612-151252634 CAGCACTGAGAGGCCGAGGTGGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915122199 1:153636308-153636330 CAACACTGGGAGGCCAAGGTGGG + Intronic
915175670 1:154012755-154012777 CAGCACTGGGAGGCCGAGGCGGG + Intronic
915198780 1:154210723-154210745 CAACACTGGGAGGCCGAGGCAGG - Intronic
915490755 1:156248852-156248874 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
915542549 1:156577412-156577434 CAACTTTGGGAGACTGAGGTGGG - Intergenic
915551957 1:156640663-156640685 CAGCATTGGAAGGCCAAGGTGGG - Intergenic
916413372 1:164569805-164569827 CAGCACTGGGAGGCCGAGGCAGG - Intronic
916730300 1:167560504-167560526 CAGCACTGGGAGGCCAAGGCAGG + Intergenic
917386052 1:174475657-174475679 CAGCTCTGGGAGGCTGAGGTGGG + Intronic
917863561 1:179171757-179171779 CAGCACTGGGAGGCCAAGGTGGG - Intronic
917867433 1:179210604-179210626 CAGCACTTTGAGGCCGAGGTGGG + Intronic
918827593 1:189345709-189345731 CAGGAGTTGGAGACCAAGCTGGG - Intergenic
919059524 1:192613955-192613977 CAGCACTGGGAGGCCAAGGCAGG + Intergenic
919528203 1:198680205-198680227 CAACATTGGGAGGCCGAGGCAGG + Intronic
919708943 1:200707034-200707056 CAGCAATGGGGGCCTGAGGTGGG + Intergenic
919824039 1:201491182-201491204 CAGCAGTGGGAAGCCAAGGCTGG + Intronic
920294502 1:204947556-204947578 CAGCAGTGGGAGCTGGAGGCTGG - Intronic
920342274 1:205282997-205283019 CTGCTTTGGGAGGCCGAGGTGGG - Intergenic
920379444 1:205527230-205527252 CAGCACTGGGAGGCCAAGGCAGG + Intronic
920495352 1:206450863-206450885 CAGCACTGGGAGGCCCAGGCGGG + Intronic
920519540 1:206612997-206613019 AAGAATTGGGAGGCCGAGGTGGG + Intergenic
920978259 1:210806721-210806743 AAGCTTTGGGAGACCGAGGCAGG + Intronic
921257149 1:213352791-213352813 CAGCATTGGGAGGCTGAGGCAGG + Intergenic
921427531 1:215021792-215021814 CAGGCGTGGGAGGCCGAGGCGGG - Intronic
921498506 1:215870539-215870561 CAGCAGTGGGAGGCCGAGGTGGG - Intronic
921706023 1:218323710-218323732 CATGAGAGGGAGGCCGAGGTGGG - Intronic
921724825 1:218512137-218512159 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
921726793 1:218533243-218533265 CAGCACTGGGAGGCTGAGGTGGG - Intergenic
921786029 1:219230355-219230377 GAACTTTGGGAGACCGAGGTAGG - Intergenic
921902066 1:220461904-220461926 AAGCAGTTGGAGACTGAGGTGGG + Intergenic
922339470 1:224643902-224643924 CAGCAGTGAGACAGCCAGGTAGG - Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922454459 1:225763571-225763593 CAGCTTTGGGAGGCCGAGGCAGG - Intergenic
922559957 1:226562220-226562242 GCACAGTGGGAGGCCGAGGTGGG + Intronic
922599408 1:226838280-226838302 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
922814778 1:228440770-228440792 CAGCGTTGGGAGGCAGAGGTGGG - Intergenic
922999729 1:229997027-229997049 CAGCACTGAGAGGCCGAGGCGGG - Intergenic
923385980 1:233465687-233465709 CATGAATGGGAGACTGAGGTGGG + Intergenic
923481189 1:234385744-234385766 TAGCATTGGGAGGCCGAGGTGGG - Intergenic
923587669 1:235289475-235289497 CAACACTGGGAGGCCGAGGTAGG + Intronic
923598110 1:235376725-235376747 CAGCACTTGGAGGCCGAGGTGGG + Intronic
923730379 1:236544197-236544219 CAGCACTGGGAGGGCGAAGTGGG - Intronic
923956759 1:239031139-239031161 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
924228636 1:241944466-241944488 CATCTTTGGGAGGCCGAGGTGGG + Intergenic
924360654 1:243238201-243238223 GAACACTGGGAGGCCGAGGTGGG + Intronic
924489888 1:244526159-244526181 CAGCATTGGGAGGCTGAGGTGGG + Intronic
924693390 1:246374724-246374746 CAGGAGTGTGAGGCCGAGGTTGG + Intronic
924743719 1:246813485-246813507 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
924762470 1:247001313-247001335 CAGCACTGGGAGGCCAAAGTGGG + Intronic
1062892699 10:1076431-1076453 GAGCTTTGGGAGACCGAGGTGGG + Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063291545 10:4754921-4754943 GAACATTGGGAGGCCGAGGTGGG + Intergenic
1063353883 10:5380548-5380570 GTGCTGTGGGAGACCGAGGTGGG - Intergenic
1063353891 10:5380583-5380605 GTGCTGTGGGAGACCGAGGTGGG - Intergenic
1063353899 10:5380618-5380640 GTGCTGTGGGAGACCGAGGTGGG - Intergenic
1063353907 10:5380653-5380675 GTGCTGTGGGAGACCGAGGTGGG - Intergenic
1063449590 10:6142604-6142626 CAGCACTGGGAGGCCGAGGTGGG - Intergenic
1063640390 10:7823877-7823899 CAGCACTGAGAGGCCGAGGTGGG - Intronic
1063807321 10:9660351-9660373 CAGCCTTGGGAGGCCGAGATGGG + Intergenic
1064067005 10:12190853-12190875 GTGCTGTGGGAGGCCGAGGTGGG - Intronic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064264241 10:13812125-13812147 CAACACTGGGAGGCCGAGGCAGG - Intronic
1064325037 10:14341898-14341920 CAGCACTGGGAGACTGAGGCAGG - Intronic
1064458749 10:15512777-15512799 CTGCTGTGGGAGGCCGAGGCGGG - Intergenic
1064515176 10:16139663-16139685 GTGCTTTGGGAGACCGAGGTGGG - Intergenic
1064544673 10:16438406-16438428 CACCTGTGGGAGACTGAGCTGGG - Intronic
1064587971 10:16858566-16858588 GAGCTTTGGGAGACCAAGGTGGG - Intronic
1064615709 10:17153273-17153295 CAGTAGTGGGTCACAGAGGTTGG - Intronic
1064709836 10:18111805-18111827 CCGCTTTGGGAGGCCGAGGTGGG + Intergenic
1065011235 10:21422749-21422771 CAGCACTGGGAGGCCGAAGCGGG + Intergenic
1065286623 10:24193163-24193185 CAGGAGGGGGAGGCCGAGGTGGG - Intronic
1065296118 10:24277003-24277025 GAGCTTTGGGAGGCCGAGGTGGG - Intronic
1065588288 10:27241018-27241040 CAGAAGGGGGAAACCGAGGCCGG + Intronic
1065596896 10:27322022-27322044 GAACCTTGGGAGACCGAGGTGGG + Intergenic
1065745051 10:28832676-28832698 AAGCAGTGGGAGGCCAAGGTGGG + Intergenic
1066682464 10:37947368-37947390 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1067105046 10:43361033-43361055 CAGCACTGGGAGGCCTAGGCAGG - Intergenic
1067151522 10:43738800-43738822 CAACAGTGGTAGACTGAGATTGG + Intergenic
1067526587 10:47042995-47043017 CAGCAGAGGGAGACTGCTGTCGG + Intergenic
1068016323 10:51521040-51521062 CAGCACTGGGAGGCCAAGGCGGG + Intronic
1068159107 10:53240879-53240901 GTGCTGTGGGAGCCCGAGGTGGG + Intergenic
1068586820 10:58809280-58809302 CAACACTGGGACACCGAGGCGGG - Intronic
1068890389 10:62142582-62142604 CAGCACTGGGAGGCCGAGGCAGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069046123 10:63745365-63745387 CACCTTTGGGAGGCCGAGGTAGG - Intergenic
1069291015 10:66779607-66779629 CAGCACTGGGAGGCCAAGGCAGG - Intronic
1069378978 10:67822739-67822761 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1069380533 10:67839680-67839702 CAGCACTGGGAGACCGAGGCGGG + Intergenic
1069489691 10:68850723-68850745 CAGCACTGGGAGGCCAAGGCAGG + Intronic
1069528185 10:69192957-69192979 CTGCTTTGGGAGACCTAGGTGGG - Intronic
1069667593 10:70173853-70173875 CAACACTGGGAGACCGAGGCAGG + Intergenic
1070121598 10:73582635-73582657 CAACTTTGGGAGGCCGAGGTGGG - Intronic
1070476490 10:76834314-76834336 CAGCAGTGGGAGTCAGAAGTGGG + Intergenic
1070868399 10:79725019-79725041 CAGGAGTTGGAGACCAGGGTGGG - Intergenic
1071187797 10:83063241-83063263 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
1071471224 10:85985383-85985405 CAGTTGGGGGAGACCGAGGTGGG - Intronic
1071599354 10:86949953-86949975 CAACACTGGGAGGCCGAGGCAGG + Intronic
1071635312 10:87247225-87247247 CAGGAGTTGGAGACCAGGGTGGG - Intergenic
1071659936 10:87490762-87490784 CAGGAGTTGGAGACCAGGGTGGG + Intergenic
1072081029 10:92032258-92032280 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1072162600 10:92782333-92782355 CAGCACTGGGAGGCTGAGGCCGG + Intergenic
1072211619 10:93251708-93251730 TTACACTGGGAGACCGAGGTGGG + Intergenic
1072219359 10:93314800-93314822 CAATATTGGGAGGCCGAGGTGGG + Intronic
1072232827 10:93427284-93427306 CAGCACTGGGAGGCCAAGGTGGG + Intronic
1072464912 10:95654407-95654429 CAATATTGGGAGGCCGAGGTGGG - Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072873960 10:99152063-99152085 CAGCTTTGGGAGGCCGAGGCGGG + Intronic
1072939307 10:99745610-99745632 CCACTTTGGGAGACCGAGGTGGG + Intronic
1072974915 10:100049203-100049225 CAGCACTGGGAGGCTGAGGCGGG - Intronic
1072978593 10:100080644-100080666 CAACACTGGGAGGCCAAGGTGGG + Intronic
1073021479 10:100448344-100448366 CAGCACTGGGAGGCCAAGGCGGG - Intergenic
1073134047 10:101209867-101209889 CAGCAGCTGGAGACCCAAGTGGG - Intergenic
1073567795 10:104550215-104550237 TAGCACTGGGAGGCTGAGGTGGG - Intergenic
1073759814 10:106617199-106617221 CAGCACTGGGAGGCCGAGGCGGG - Intronic
1074042970 10:109810419-109810441 CAGCATTGGGAGGCTGAGGAGGG + Intergenic
1074440680 10:113475042-113475064 CAGCAGTGGTGGAGGGAGGTGGG + Intergenic
1074874934 10:117606416-117606438 CAACTTTGGGAGGCCGAGGTGGG - Intergenic
1075370710 10:121932609-121932631 CAGGATTGGGAGGCCGAGGTGGG - Intergenic
1075844263 10:125532532-125532554 CAACACTGGGAGGCCGAGGTAGG - Intergenic
1075878853 10:125832284-125832306 CAACACTGGGAGGCCGAGGCAGG - Intronic
1075930815 10:126293765-126293787 AAGAAATGGGAGGCCGAGGTGGG - Intronic
1076638715 10:131900253-131900275 CAGGATTGGGAGACCGAGGCCGG + Intergenic
1076821754 10:132943152-132943174 CAGCAGGGGGTGGCCGAGGCGGG + Intergenic
1077020955 11:416977-416999 CAGGCTTGGGCGACCGAGGTGGG + Intronic
1077081152 11:725262-725284 CAGCACTGGGAGGCCAAGGCGGG + Intronic
1077418064 11:2435045-2435067 GTGCTGTGGGAGGCCGAGGTGGG - Intergenic
1077592804 11:3505677-3505699 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1078129643 11:8602674-8602696 CAGCTTTGGGAGGCCAAGGTAGG - Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078216717 11:9318007-9318029 CAGCACTGGGAGGCCGAGGTGGG - Intergenic
1078275383 11:9839986-9840008 CAGCACTGGGAGGCTGAGGTGGG + Intronic
1078481614 11:11681174-11681196 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1078504633 11:11925352-11925374 TCCCAGTGGGAGGCCGAGGTGGG - Intronic
1079048734 11:17133679-17133701 GAACTTTGGGAGACCGAGGTGGG + Intronic
1079218179 11:18533898-18533920 CAGCACTCGGAGGCCGAGGCAGG - Intronic
1079941422 11:26685371-26685393 CAGCACTCGGAGGCCGAGGCTGG + Intronic
1080436791 11:32252319-32252341 CAGCACTGGGAGGCCAGGGTGGG - Intergenic
1080550433 11:33369731-33369753 CAGCACTGGGAGGCCCAGGTGGG - Intergenic
1080565304 11:33504011-33504033 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1080650553 11:34219429-34219451 CAGCTGTGGGAGGCTGAGGAGGG + Intronic
1080692794 11:34572946-34572968 CAGCTTTGGGAGGCCAAGGTGGG - Intergenic
1080800640 11:35606939-35606961 CAGGAGTGAGAGGCCAAGGTGGG + Intergenic
1080821838 11:35814863-35814885 CAGCAGTAGGAAAACGAGGAGGG + Exonic
1080826545 11:35853521-35853543 CAACACTGGGAGGCCAAGGTAGG + Intergenic
1081796356 11:45823072-45823094 CAACTTTGGGAGACCAAGGTGGG + Intergenic
1081875585 11:46406297-46406319 CAACTTTGGGAGGCCGAGGTGGG - Intronic
1081914380 11:46721286-46721308 CAGCACTTTGAGGCCGAGGTGGG - Intronic
1081965375 11:47166108-47166130 CAGCACTGGGAGGCTGAGATGGG - Intronic
1082016490 11:47492481-47492503 CAACTGTGGGAGGCCGAGGCAGG + Intronic
1082099722 11:48162428-48162450 CAGCTGTGAGAGATGGAGGTGGG - Intronic
1082850474 11:57760025-57760047 GAGCTTTGGGAGGCCGAGGTGGG - Intronic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1082944500 11:58743251-58743273 CAGCAGAGAGTGACAGAGGTGGG + Intergenic
1083211490 11:61190104-61190126 CAGCATTGGGAGGCTGAGGCAGG + Intergenic
1083614767 11:64020961-64020983 GCGCTTTGGGAGACCGAGGTGGG - Intronic
1083676854 11:64330923-64330945 CCACTTTGGGAGACCGAGGTGGG - Intergenic
1083854744 11:65387104-65387126 CCTCCGTGGGAGCCCGAGGTGGG + Exonic
1084027251 11:66458941-66458963 CAGCTTTGGGAGGTCGAGGTGGG - Intronic
1084028591 11:66467520-66467542 CCGCAGGGGGAGGCCGAGATGGG + Intronic
1084067314 11:66712300-66712322 GCGCATTGGGAGGCCGAGGTGGG + Intronic
1084347577 11:68565551-68565573 CACAAGTGGAAGACGGAGGTGGG + Intronic
1084598218 11:70129867-70129889 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1084868743 11:72081172-72081194 CAACACTGGGAGACCAAGGCGGG + Intronic
1084941631 11:72616299-72616321 GGGCAGTGGGAGCCCCAGGTGGG - Intronic
1085001629 11:73042171-73042193 CAACACTGGGAGGCTGAGGTGGG - Intronic
1085070456 11:73539513-73539535 CAGCGCTGGGAGGCCGAGGCGGG - Intronic
1085071139 11:73547036-73547058 TAGCACTGGGAGGCCAAGGTGGG + Intronic
1085280612 11:75327833-75327855 CAGCACTGGGAGGCCAAGGTGGG - Intronic
1085354915 11:75827361-75827383 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085617490 11:78012332-78012354 CAACACTGGAAGGCCGAGGTGGG + Intergenic
1085623445 11:78054469-78054491 CAGCTTTGGGAGGCCAAGGTGGG + Intronic
1085633613 11:78140435-78140457 CAACACTGGGAGGCCGAGGTGGG + Intergenic
1085725642 11:78952393-78952415 CAGCAGCGGGAAACCCAGGGAGG + Intronic
1086326536 11:85707084-85707106 CAACTTTGGGAGGCCGAGGTGGG - Intronic
1086572573 11:88302375-88302397 CAGCATTGGGAGGCCGAGGCGGG + Intronic
1087067966 11:94045152-94045174 CAGCAATGGGAGGCCAAGGCAGG - Intronic
1087211109 11:95447063-95447085 CATCAGAGGGAGGCCGAGGTGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087947052 11:104175494-104175516 CAGCTTTGGGAGGCCGAGGTGGG + Intergenic
1088067180 11:105733700-105733722 CAACACTGGGAGGCCAAGGTGGG - Intronic
1088184103 11:107144246-107144268 CAGCAGTGGGAGACTGTAGAGGG - Intergenic
1088652371 11:111969179-111969201 CAGCACTGGGAGGCCAAGGCGGG + Intronic
1088777119 11:113096211-113096233 CAGCAGTGGGATACCAAGTGGGG + Intronic
1089313120 11:117573180-117573202 CAGCAGTAGCAGATCGGGGTTGG - Intronic
1090075938 11:123580057-123580079 GATCAGTGGGAGAATGAGGTGGG - Intronic
1090227214 11:125078949-125078971 AAGCAGTGGGGGACAGAGGTTGG + Intronic
1090283811 11:125481393-125481415 CAGCTTTGGGAGACCGAGGTGGG - Intronic
1090359761 11:126164060-126164082 ATGCTGTGGGAGGCCGAGGTGGG + Intergenic
1090834925 11:130447392-130447414 CCGCACCGGGAGGCCGAGGTGGG + Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091314771 11:134606481-134606503 CAATAGTTGGAGACAGAGGTGGG - Intergenic
1091563486 12:1631141-1631163 GAGCAGTGGGAGGCGGAGGCTGG + Intronic
1091749936 12:3015927-3015949 CAGCACTGGGAGGTCGAGGCAGG + Intronic
1091751621 12:3025188-3025210 CAGCACTGGGAGGCTGAGGTGGG - Intronic
1092151816 12:6254215-6254237 CAGCACTGGGAAGCCGAGGCGGG + Intergenic
1092221219 12:6715325-6715347 CAGCACTGGGAGGACGAGGTGGG - Intergenic
1092238971 12:6826132-6826154 CAGTGGTGGGAGGCCGCGGTAGG + Intronic
1092396371 12:8130626-8130648 CAGCACGGGGAGGCTGAGGTGGG - Intronic
1092418912 12:8313806-8313828 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092606440 12:10124948-10124970 CAACACTGGGAGATCGAGGTAGG + Intronic
1092777928 12:11960294-11960316 CAGCACTGGGAGGCCGAGGCGGG + Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1093100456 12:15022308-15022330 CAGCTTTGGGAGACTAAGGTGGG + Intergenic
1093464378 12:19435237-19435259 CAGCTATGGGAGGCTGAGGTGGG - Intronic
1093833226 12:23792376-23792398 GAACTTTGGGAGACCGAGGTGGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094587735 12:31793486-31793508 TAGCACTGGGAGGCCGAGGCAGG + Intergenic
1094611232 12:31997586-31997608 CAGCACTAGGAGGCCGAGGCGGG - Intergenic
1094621190 12:32082040-32082062 CAGCACTGGAAGGCTGAGGTGGG - Intergenic
1094684833 12:32701026-32701048 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1096144752 12:49270732-49270754 CAGCACTGGGAGGCCAAGGTGGG + Intronic
1096401536 12:51311294-51311316 TCCCAGTGGGAGGCCGAGGTGGG - Intronic
1096402450 12:51318506-51318528 CAACACTGGGAGGCTGAGGTGGG - Intronic
1096696865 12:53354851-53354873 CTGCTTTGGGAGGCCGAGGTAGG + Intergenic
1096725098 12:53555071-53555093 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1096738444 12:53674694-53674716 CAACACTGGGAGGCCAAGGTGGG - Intronic
1096839247 12:54370580-54370602 CAGCAGTGGGAGGGCGCGGGCGG - Intronic
1096853407 12:54458616-54458638 CAGCACGGGGAGACCAAGGCGGG - Intronic
1096952928 12:55493885-55493907 CACCTTTGGGAGGCCGAGGTGGG - Intergenic
1096964957 12:55618671-55618693 CAGCATTGGGAAGCCGAGGTGGG + Intergenic
1097006052 12:55918619-55918641 CAGCACTGGGAGGCCAAGGCGGG + Intronic
1097238723 12:57558425-57558447 CAGCATTGGGAGGCCAAGGCGGG + Intronic
1097495422 12:60325413-60325435 CAGCTTTGGGAGGCCGAGGCAGG - Intergenic
1097700426 12:62814462-62814484 CAGCATTGGGAGACCAAGGCAGG - Intronic
1097781918 12:63716668-63716690 GCGCTTTGGGAGACCGAGGTGGG + Intergenic
1098035159 12:66294240-66294262 GAGTTGTGGGAGGCCGAGGTGGG - Intergenic
1098227368 12:68338629-68338651 CTGCAGTAGGAGAAGGAGGTTGG - Intergenic
1098272315 12:68780731-68780753 CAACACTGGGAGGCCGAGGCGGG - Exonic
1098301628 12:69060169-69060191 CAGCTTTGGGAGGCTGAGGTGGG + Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098822669 12:75252620-75252642 CAGGAGTGGGAGGCCGAGGCAGG + Intergenic
1098970403 12:76849035-76849057 CAGCACTTGGAAGCCGAGGTGGG + Intronic
1099049573 12:77766998-77767020 CAGCACTGGGAGGCCAAGGCGGG - Intergenic
1099216398 12:79859087-79859109 CAACAGTGGGAGGCCAAGGCGGG + Intronic
1099612943 12:84898091-84898113 CAGCACTGGGAGGCTGAGATGGG + Intronic
1099639142 12:85262034-85262056 CAGCACTGGGAGACCAAGGCTGG - Intronic
1099657572 12:85513910-85513932 CAGCTGTGGGAGAATGAGTTTGG - Intergenic
1100023454 12:90099081-90099103 CAACACTGAGAGACCGAGGCAGG - Intergenic
1100445720 12:94657749-94657771 CAGCTTTGGGAGGCTGAGGTGGG - Intergenic
1100490661 12:95074673-95074695 CAGCAGTTGGAGACCGGCTTGGG + Intergenic
1100516078 12:95329252-95329274 CTGCTTTGGGAGGCCGAGGTGGG + Intergenic
1100531486 12:95465729-95465751 CAGTACTTGGAGGCCGAGGTGGG + Intergenic
1100811364 12:98341973-98341995 GAGCAGTAAGAGACCCAGGTTGG - Intergenic
1101090872 12:101283794-101283816 CAACAGTGGGAGGCTGAGGCAGG - Intronic
1101146409 12:101844869-101844891 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1101156630 12:101933862-101933884 CAGCTTTGGGAGGCTGAGGTGGG + Intronic
1101230186 12:102732758-102732780 CAGCACTGGGAGGCCGAGGCGGG + Intergenic
1101321153 12:103674070-103674092 CAGCAATGGGACAGCCAGGTAGG + Exonic
1101520303 12:105475995-105476017 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
1101610494 12:106287023-106287045 CAACACTGGGAGGCTGAGGTGGG + Intronic
1101674968 12:106909207-106909229 CAACACTGGGAGGCTGAGGTGGG + Intergenic
1101912074 12:108867388-108867410 CAGCACTGGGAGGCCAAGGTGGG + Intronic
1101982780 12:109422065-109422087 CAGCTTTGGGAGAGTGAGGTGGG - Intronic
1102098752 12:110261162-110261184 GTGCAATGGGAGGCCGAGGTGGG + Intergenic
1102109716 12:110355829-110355851 CAGCACTGGGAGGCCAAGGCAGG + Intergenic
1102110450 12:110361541-110361563 CAGCACTGGCAGGCTGAGGTGGG + Intergenic
1102275778 12:111580890-111580912 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1102333010 12:112051455-112051477 AAGCACTGGGAGGCCGAGGTGGG - Intronic
1102397280 12:112597483-112597505 CAGCCTTGGGAGGCTGAGGTGGG + Intronic
1102474854 12:113181903-113181925 CAGCACTGGGAGGCTGAGGTGGG + Intronic
1102479229 12:113209630-113209652 CAGCACTGGGAGGCTAAGGTGGG - Intronic
1102600025 12:114022589-114022611 CAGCAAAGGGAGATAGAGGTGGG - Intergenic
1102673366 12:114638798-114638820 CAGCATTGGGAGGCCGAGGCGGG - Intergenic
1102827502 12:115961721-115961743 CAACTTTGGGAGGCCGAGGTGGG + Intronic
1102991464 12:117319297-117319319 CAGCACTGGGAGGCCAAGGCAGG - Intronic
1103293243 12:119864580-119864602 CAGCACTGGGAGGCCGAGGTGGG - Intronic
1103346635 12:120255447-120255469 CAGCACTGGGAGACCGAGGCAGG + Intronic
1103416715 12:120746993-120747015 CAGCAGTTGGAGACCAACCTGGG + Intergenic
1103477259 12:121227837-121227859 CAGCACAGGGAGGCGGAGGTAGG + Intronic
1103576439 12:121881037-121881059 CAACACTGGGAGGCCAAGGTGGG - Intergenic
1103631834 12:122267781-122267803 CAGCACTGGGAGGCCGAGACGGG - Intergenic
1103635561 12:122302346-122302368 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1103637141 12:122316454-122316476 CATCACTGGGAGGCTGAGGTGGG - Intronic
1103703864 12:122861175-122861197 CAGGAGATGGAGACCCAGGTAGG + Exonic
1103711227 12:122914071-122914093 CAGCTTTGGGAGGCCGAGGCGGG + Intergenic
1103780802 12:123397637-123397659 CAGCAGTGGGAGGCTGTGCTAGG + Intronic
1103931326 12:124452637-124452659 CAGCCCTGGGAGGGCGAGGTGGG + Intronic
1103986445 12:124770682-124770704 CACCCTTGGGAGGCCGAGGTGGG - Intergenic
1103991514 12:124802550-124802572 CCCCAGGTGGAGACCGAGGTGGG + Intronic
1104004144 12:124880329-124880351 CAACACTGGGAGGCCGAGGCAGG + Intronic
1104026666 12:125032519-125032541 CAGCACTGGGAGGCCAAGGCAGG + Intergenic
1104466477 12:128994646-128994668 CAACACTGGGAGGCCGAGGTGGG - Intergenic
1104701251 12:130905788-130905810 GCACAGTGGGAGGCCGAGGTGGG + Intergenic
1105374705 13:19832940-19832962 CAGGAGTTGGAGACCAACGTGGG - Intronic
1105470738 13:20692476-20692498 CAGCTCTGGGAGGCCAAGGTGGG - Intergenic
1105852633 13:24349404-24349426 CAGCAGTGGCCGAGCCAGGTAGG + Intergenic
1106190813 13:27450815-27450837 CCCTAGTGGGAGACCGAGATTGG - Intergenic
1106290919 13:28361031-28361053 CACTTGTGGGAGGCCGAGGTGGG + Intronic
1106498735 13:30307244-30307266 CGGCAGTGGGAGGCCGAGAGGGG + Intronic
1106656980 13:31756865-31756887 CAGCACTTTGAGGCCGAGGTGGG - Intronic
1106743516 13:32674059-32674081 CAACATTGGGAGGCCGAGGCAGG - Intronic
1107144266 13:37041269-37041291 CAGCTTTGGGAGGCCGAGGCGGG + Intronic
1107187291 13:37538671-37538693 CAGCACTAGGAGGCCTAGGTGGG + Intergenic
1107368386 13:39712104-39712126 CAGCACTGGGAGGCCGAGGCGGG - Intronic
1107514920 13:41119723-41119745 CAGCTTTGGGAGGCCGAGGCAGG - Intergenic
1107685221 13:42890542-42890564 CCACATTGGGAGGCCGAGGTGGG - Intronic
1107781756 13:43910842-43910864 AAGTAGTGGGAGGCCGAGGCGGG - Intergenic
1107858457 13:44638160-44638182 CAACACTGGGAGGCTGAGGTGGG - Intergenic
1108011996 13:46025416-46025438 CAGCTGTGGGAGGCTGAGGCAGG - Intronic
1108319195 13:49271163-49271185 CAGCACTGGGAGACTGAGGCAGG + Intronic
1108341744 13:49504342-49504364 CTGAGGTGGGAGACTGAGGTGGG + Intronic
1108376416 13:49818347-49818369 CTGCACTGGGAGGCCGAGGCGGG - Intergenic
1108623823 13:52208746-52208768 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1108662894 13:52602271-52602293 CAACACTGGGAGGCCGAGGCAGG + Intergenic
1108693133 13:52878108-52878130 CAGCACTGGGAAGCCGAGGCGGG - Intergenic
1108893079 13:55286849-55286871 CAACACTGGGAGGCTGAGGTGGG - Intergenic
1109548536 13:63860801-63860823 CAGCAGTGGGAGGGGTAGGTGGG - Intergenic
1109885337 13:68534792-68534814 CAGCTTTGGGAGGCCAAGGTGGG + Intergenic
1110128639 13:71979143-71979165 CAGCCCTGGGAGACCAAGATGGG - Intergenic
1110959694 13:81606273-81606295 CAGCACTGGGAGGCCGAGGCGGG + Intergenic
1112019466 13:95359243-95359265 CAGCATTTGGACACCAAGGTGGG - Intergenic
1112025621 13:95408353-95408375 CAGCTATGGGAGGCTGAGGTGGG - Intergenic
1112082677 13:95991908-95991930 TAGCCTTGGGAGACCGAGGCAGG + Intronic
1112308508 13:98296929-98296951 CAGCTTTGGGAGGCCAAGGTAGG - Intronic
1112420693 13:99245594-99245616 CACCTTTGGGAGGCCGAGGTGGG + Intronic
1112468664 13:99668336-99668358 CAGCACTGGGAGGCCAAGGCAGG + Intronic
1112549809 13:100409085-100409107 CAGCAGTGGAGGAGGGAGGTAGG + Intronic
1112650664 13:101393568-101393590 CATAAGTGGGAGGCCGAGGCGGG + Intronic
1113249110 13:108431603-108431625 CAGCTGTGGGAGCCCGAGGTTGG - Intergenic
1113286463 13:108854241-108854263 CAGCACAGGGAGACTGTGGTGGG - Intronic
1113536965 13:111075956-111075978 CAGCAGTGGGAGAGGTAGGCTGG + Intergenic
1113702103 13:112395714-112395736 GCGCACTGGGAGGCCGAGGTGGG - Intronic
1113754322 13:112799405-112799427 CAGCAAAGGGAGATGGAGGTGGG + Intronic
1113855522 13:113443359-113443381 CAGCACTTGGAGACTGAGGTGGG + Intronic
1113916745 13:113878444-113878466 CAGTATTGGGAGGACGAGGTGGG - Intergenic
1114191794 14:20445047-20445069 CAGCACTGGGAGGCCAAGGCGGG - Intergenic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114465026 14:22915740-22915762 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1114502279 14:23179559-23179581 CAGCACTGATAGGCCGAGGTGGG + Intronic
1115103574 14:29733346-29733368 CAGCACTTGGAGGCCGAGGTGGG - Intronic
1115549991 14:34496242-34496264 CAGCAGTAGGAGGCCAAGGCAGG + Intergenic
1115580125 14:34749582-34749604 GAGCTGTGGGAGGCTGAGGTGGG + Intergenic
1115616560 14:35100877-35100899 CAACACTGGGAGGCCAAGGTGGG - Intronic
1115683890 14:35773000-35773022 CAGCTGTGGGAGACATAGGGAGG - Intronic
1115702776 14:35971462-35971484 CCACTGTGGGAGGCCGAGGTGGG + Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116802237 14:49454868-49454890 GAACACTGGGAGGCCGAGGTGGG - Intergenic
1116927537 14:50655797-50655819 CAGCACTGGGGGGCCGAGGTGGG + Intronic
1117124440 14:52606548-52606570 CAGCCCTGGGAGTCTGAGGTGGG - Intronic
1117698908 14:58394465-58394487 CAGCACTGGGAGACCGAGGTGGG - Intergenic
1117850676 14:59965635-59965657 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1117903367 14:60558973-60558995 CAACACTGGGAGGCCAAGGTGGG + Intergenic
1118072796 14:62264296-62264318 CAGCACTGGGAGGCCAAGGCGGG - Intergenic
1118308414 14:64675125-64675147 CAGGTTTGGGAGGCCGAGGTGGG + Intergenic
1118619360 14:67600485-67600507 CAGCACTGGGAGGCCAAGGCGGG + Intergenic
1118946336 14:70391011-70391033 CAACATTGGGAGGCTGAGGTAGG + Intronic
1118989426 14:70784494-70784516 CAACTTTGGGAGGCCGAGGTGGG + Intronic
1119365670 14:74089612-74089634 CAGTTTTGGGAGGCCGAGGTGGG - Intronic
1119521340 14:75288187-75288209 CAGCAGTTGGAGACCAACCTGGG - Intergenic
1119524266 14:75309838-75309860 CAACTCTGGGAGGCCGAGGTGGG + Intergenic
1119815223 14:77560337-77560359 CAGTACTGGGAGGCCAAGGTGGG + Intronic
1120115752 14:80615601-80615623 CGGCATTGGGAGGCCAAGGTGGG + Intronic
1120250879 14:82061004-82061026 CAGCAAAGGGAGACAGGGGTGGG + Intergenic
1120836876 14:89047012-89047034 CAGCACTTTGAGGCCGAGGTGGG + Intergenic
1120885780 14:89450829-89450851 GAGCAAAGGGAGGCCGAGGTGGG - Intronic
1121080467 14:91103884-91103906 CAGAAGTGGGAGCTGGAGGTGGG - Intronic
1121178878 14:91912396-91912418 CATTTATGGGAGACCGAGGTGGG + Intronic
1121631817 14:95426693-95426715 TACTATTGGGAGACCGAGGTGGG + Intronic
1121756375 14:96406163-96406185 CAGCACTGGGAGGCTGAGGCAGG - Intronic
1122169950 14:99864563-99864585 CAACACTGGGAGGCCGAGGCAGG + Intronic
1122377499 14:101274175-101274197 GCACTGTGGGAGACCGAGGTAGG - Intergenic
1122529009 14:102411619-102411641 CAGCAGAGGGAGATAGGGGTGGG - Intronic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122708929 14:103641169-103641191 CAACACTGGGAGGCCGAGGCAGG - Intronic
1122804071 14:104247896-104247918 CAGCAGTGTGAACCCGAGGAGGG - Intergenic
1122956633 14:105074404-105074426 CAGCAGTGGGAGGCCAAGGTTGG + Intergenic
1202900227 14_GL000194v1_random:32231-32253 CAGCAGAGGAAGACCGGGGTAGG + Intergenic
1202929458 14_KI270725v1_random:25638-25660 CGGCATTGGGGGACGGAGGTGGG + Intergenic
1123422838 15:20145584-20145606 CGGCATTGGGGGACAGAGGTGGG - Intergenic
1123532063 15:21152124-21152146 CGGCATTGGGGGACAGAGGTGGG - Intergenic
1123694190 15:22865106-22865128 CAGCACTGGGAGGCCGAGGATGG - Intronic
1123700385 15:22910406-22910428 CAACACTGGGAGGCCAAGGTGGG - Intronic
1123900404 15:24871127-24871149 GAGACTTGGGAGACCGAGGTGGG - Intronic
1123975851 15:25553914-25553936 CAGCACTGGGAAGCTGAGGTGGG + Intergenic
1124512332 15:30337827-30337849 CACCTTTGGGAGACTGAGGTGGG + Intergenic
1124730582 15:32192924-32192946 CACCTTTGGGAGACTGAGGTGGG - Intergenic
1125516009 15:40321829-40321851 CAGCTTTGGGAGGCCGAGGCGGG - Intergenic
1125537659 15:40451677-40451699 CAGCAGAGGGAGACCCATGTGGG - Intronic
1125544529 15:40492881-40492903 CAACTTTGGGAGGCCGAGGTGGG - Intergenic
1125580740 15:40783615-40783637 TCGCTGTGGGAGGCCGAGGTGGG + Intronic
1125646274 15:41275399-41275421 AAGCTTTGGGAGGCCGAGGTAGG - Intronic
1125660174 15:41387865-41387887 CAACACTGGGAGGCCAAGGTGGG + Intronic
1125669148 15:41457285-41457307 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1125834645 15:42738182-42738204 ATGCAGTGGGAGGCAGAGGTGGG + Intergenic
1125844272 15:42837111-42837133 GGGCTTTGGGAGACCGAGGTGGG + Intronic
1125997600 15:44178744-44178766 CAGCACTGGGAGGCCAAGGCGGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126594044 15:50368329-50368351 CAGCACTAGGAGGCCGAGGTGGG + Intergenic
1126611894 15:50538028-50538050 AAACTTTGGGAGACCGAGGTGGG + Intronic
1127187913 15:56499238-56499260 CAGCTTTGGGAGACCGAGGTGGG + Intergenic
1127201333 15:56655451-56655473 CAGCACTGGGAGGCCGAGGTGGG - Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127872116 15:63082433-63082455 CAGCACAGGGAGATCGAGGCAGG + Intergenic
1128091494 15:64922084-64922106 CAGGGGTGGGGGACAGAGGTCGG - Intronic
1128115820 15:65104627-65104649 CAGCACTGGGAGGCCGAGGCCGG + Intronic
1128143230 15:65316762-65316784 GAACATTGGGAGGCCGAGGTGGG + Intergenic
1128670377 15:69570287-69570309 CAGCACTGGGAGGCCGAAGCGGG + Intergenic
1129274790 15:74437850-74437872 GAACTTTGGGAGACCGAGGTGGG + Intergenic
1129441035 15:75580784-75580806 CAACTTTGGGAGGCCGAGGTGGG - Intergenic
1129449346 15:75641574-75641596 CAACACTGGGAGGCCAAGGTGGG + Intronic
1129526578 15:76220312-76220334 CAGCACTGGGAGGCCAAGGTGGG - Intronic
1129547890 15:76417771-76417793 CAACTTTGGGAGGCCGAGGTGGG + Intronic
1129587796 15:76886231-76886253 CCACACTGGGAGGCCGAGGTGGG + Intronic
1129626221 15:77202788-77202810 CATCTTTGGGAGGCCGAGGTGGG + Intronic
1129765367 15:78162166-78162188 ACGCAGTGGGAGACAGAGGGTGG - Intronic
1129884400 15:79028501-79028523 CAGCAGTCGGAGAGCGAAATAGG - Intronic
1130009279 15:80135875-80135897 CAGCACTGGGAGGCCAAGGTGGG + Intronic
1130033549 15:80337426-80337448 CAGCTTTGGGAGGCCGAGGCGGG - Intergenic
1130083649 15:80757897-80757919 CAGCACTTTGAGGCCGAGGTAGG - Intergenic
1130130982 15:81142535-81142557 GAGCTGTGGGAGGCAGAGGTAGG - Intronic
1130921386 15:88347938-88347960 CAGCACTGAGAGGCCGAGGCAGG + Intergenic
1131089317 15:89609357-89609379 CAACTGTGGGAGGCCGAGGAGGG - Intronic
1131201991 15:90406409-90406431 CAGCACTGGGAGGCTGAGGCGGG - Intronic
1132267178 15:100484425-100484447 CATCAGTGGGTGACAGAGCTGGG + Intronic
1132336289 15:101050551-101050573 CAGCTGTGGGAGAGCGGGTTTGG + Intronic
1132456033 16:23511-23533 CAGCTTTGGGAGGCTGAGGTAGG - Intergenic
1132535045 16:474631-474653 CAGTAGTGGGAGAAGGAGGGAGG - Intronic
1132548691 16:545322-545344 CAGCGGTGGGAGACCTCGGCAGG - Intronic
1132646027 16:999719-999741 CAGCAGTCAGAGGCCGATGTGGG + Intergenic
1132757353 16:1492418-1492440 CAGCACTGGGAAGCTGAGGTGGG - Intergenic
1132792989 16:1703802-1703824 CAACACTGGGAGGCTGAGGTGGG + Intergenic
1132912317 16:2320643-2320665 CAGCATTGGGAGGCTGAGGCAGG - Intronic
1133208860 16:4251449-4251471 CAACTTTGGGAGGCCGAGGTGGG + Intergenic
1133762932 16:8814236-8814258 CAGAACTGAGAGGCCGAGGTGGG - Intronic
1133805257 16:9121805-9121827 CAGCACTGGGAGGCCAAGGCGGG + Intergenic
1134106309 16:11487865-11487887 CAGCTTTGGGAGGCCGAGGTAGG + Intronic
1134138199 16:11694384-11694406 CAGCCCTGGGAGGCCGAGGCAGG - Intronic
1134150514 16:11801105-11801127 CAACACTGGGAGGCTGAGGTGGG + Intergenic
1134167204 16:11940490-11940512 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1134493502 16:14713223-14713245 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1134498883 16:14752347-14752369 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1134525435 16:14938968-14938990 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1134546970 16:15117410-15117432 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1134547455 16:15121894-15121916 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1134581685 16:15376668-15376690 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1134628357 16:15739077-15739099 CAGCAGTGGGGGATAGAGGAAGG - Intronic
1134713020 16:16337454-16337476 CAGCACTGGGAGGCCGAGGCAGG - Intergenic
1134720889 16:16380814-16380836 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1134946538 16:18331071-18331093 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1134953799 16:18371218-18371240 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1135292044 16:21248269-21248291 CAGCACTGGGAGGCTGAGGTGGG - Intronic
1135312599 16:21417949-21417971 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1135332558 16:21572976-21572998 CAGCACTGGAAGGCTGAGGTGGG + Intergenic
1135334189 16:21586921-21586943 CAGCACTGGGAGGCCAAAGTAGG + Intergenic
1135365547 16:21850402-21850424 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1135446292 16:22520934-22520956 CAGCACTGGGAGGCTGAGGCAGG - Intronic
1135555086 16:23429515-23429537 CACCTTTGGGAGGCCGAGGTGGG + Intronic
1136042496 16:27591427-27591449 CAGCTTTGGGAGGCCGAGGCGGG - Intronic
1136151776 16:28355898-28355920 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1136168009 16:28469738-28469760 CGGCACTGGGAGGCCGAGGCAGG + Intronic
1136194966 16:28645273-28645295 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1136211305 16:28759385-28759407 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1136241448 16:28946974-28946996 CAGCACTGGGAGCCTGAGGTGGG - Intergenic
1136256026 16:29039335-29039357 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1136309301 16:29396901-29396923 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1136322719 16:29498457-29498479 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1136437401 16:30238425-30238447 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1136490657 16:30605711-30605733 AAGCACTGGGAGGCCGAGGCGGG + Intronic
1136522321 16:30805216-30805238 CAGCACTGGGAGGCCAAGGCGGG - Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1136634499 16:31511079-31511101 GAGCTTTGGGAGGCCGAGGTGGG - Intergenic
1136861910 16:33709756-33709778 CGGTATTGGGGGACCGAGGTGGG + Intergenic
1138023192 16:53502998-53503020 CCGCAGTGGGACACGGAGGCGGG - Intronic
1138083504 16:54114048-54114070 GCGCTTTGGGAGACCGAGGTGGG - Exonic
1138416847 16:56876512-56876534 AAGCCCTGGGAGACCGAGGCAGG + Intronic
1138621185 16:58212624-58212646 CAGCACTTGGAGGCTGAGGTGGG + Intergenic
1138679456 16:58674521-58674543 CAGCTATGGGAGGCCAAGGTGGG - Intronic
1139182046 16:64760095-64760117 CAGCACTGGGAGGCCAGGGTGGG - Intergenic
1139484996 16:67250355-67250377 GAGAAGTGGGAGACCAAAGTAGG + Intronic
1139524469 16:67505769-67505791 CAACGCTGGGAGACTGAGGTGGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139583718 16:67887826-67887848 CAACACTGGGAGGCCGAGGCGGG - Intronic
1139589969 16:67928125-67928147 CTCCAGTGGGAGACCCTGGTAGG + Exonic
1139632407 16:68238547-68238569 CAGCACTGGGAGACCGAGGCGGG - Intergenic
1139811717 16:69624451-69624473 CAACACTGGGAGGCCGAGGCGGG - Intronic
1139825489 16:69754049-69754071 CAGCACTGGGAGACCGAGGCGGG - Intronic
1139856995 16:69989319-69989341 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1139857414 16:69991829-69991851 CCACTGTGGGAGGCCGAGGTGGG + Intergenic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139875309 16:70141296-70141318 CAGCACTGAGAGGTCGAGGTGGG - Intronic
1139878590 16:70165788-70165810 CAACACTGGGAGGCCAAGGTGGG + Intergenic
1140331496 16:74061605-74061627 CAGGAGTGGGAGAGAGAGGGTGG - Intergenic
1140358970 16:74329026-74329048 CAACACTGGGAGGCCAAGGTGGG - Intergenic
1140365716 16:74378656-74378678 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1140373922 16:74429704-74429726 CAACACTGGGAGGCCAAGGTGGG - Intergenic
1140497193 16:75399623-75399645 CAGCACTGGGAGGCCAAGGCAGG - Intronic
1140665315 16:77222138-77222160 TATCATTGGGAGGCCGAGGTGGG - Intergenic
1141680133 16:85538903-85538925 CAGCCAAGGGATACCGAGGTGGG - Intergenic
1141835182 16:86533894-86533916 CAGCACTGGGAGACAGAGCCAGG - Intronic
1142000114 16:87659473-87659495 CAGCACTGGGAGGTTGAGGTGGG + Intronic
1142022525 16:87792819-87792841 CAGCATTGGGAGGCCTAGGCAGG - Intergenic
1142197501 16:88745494-88745516 CACCTTTGGGAGGCCGAGGTGGG + Intronic
1142301335 16:89260154-89260176 CAACAGTGGCAGGCCGAGGCGGG + Intergenic
1142384839 16:89757206-89757228 CAGCACTGGGAGGCCAAGGCAGG - Intronic
1203123400 16_KI270728v1_random:1557939-1557961 CGGTATTGGGGGACCGAGGTGGG + Intergenic
1142545872 17:702415-702437 CAGCACTTTGAGGCCGAGGTGGG + Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1142983264 17:3683482-3683504 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1143063790 17:4226273-4226295 GAGCTTTGGGAGGCCGAGGTGGG + Intronic
1143065407 17:4243443-4243465 CAGCTGTGGGAGGCTGAGGCAGG - Intronic
1143098234 17:4489899-4489921 CAGCTCTGGGAGGCTGAGGTGGG + Intergenic
1143167786 17:4906604-4906626 CATCACTGGGAGGCTGAGGTAGG + Intergenic
1143188691 17:5025567-5025589 CAGCACTGGGAGGCCGAGGCAGG + Exonic
1143283873 17:5774682-5774704 CAGCAGTGGGAGGTGGAGGCTGG - Intronic
1143547704 17:7608343-7608365 CAACACTGGGAGGCCGAGGCTGG + Intronic
1143547839 17:7609779-7609801 CAACACTTGGAGGCCGAGGTCGG + Intronic
1143642840 17:8209257-8209279 CAGCACTGGGAGGCTGAGGCAGG - Intronic
1143892223 17:10111286-10111308 CAACTTTGGGAGGCCGAGGTGGG + Intronic
1143969591 17:10785907-10785929 CAGCACTGGGAGGCCGAGGCAGG - Intergenic
1144171234 17:12661844-12661866 CAACACTGGGAGGCCGAGGAGGG + Intergenic
1144203242 17:12960319-12960341 CAACACTGGGAGGCTGAGGTGGG + Intronic
1144409866 17:14990536-14990558 CACCAGTGGGAGACTGGGGTGGG - Intergenic
1144544975 17:16185823-16185845 CAGGACTGGGAGACTAAGGTGGG + Intronic
1144650893 17:17006075-17006097 GAGCTATGGGAGGCCGAGGTGGG + Intergenic
1144697460 17:17314676-17314698 GAGCAGAGGAAGACAGAGGTTGG - Intronic
1144727820 17:17510764-17510786 CAGCAGTGGAAGAACAAGCTGGG - Intronic
1144992625 17:19244210-19244232 CAGCACTGGGAGGCTGAGGCTGG + Intronic
1145856693 17:28165966-28165988 CAGCACTGGGAGGCTGAGGTGGG + Intronic
1146060222 17:29601168-29601190 AAGCTTTGGGAGGCCGAGGTGGG - Intronic
1146103099 17:30004879-30004901 CAACTTTGGGAGGCCGAGGTAGG - Intronic
1146154580 17:30510465-30510487 GAGCTTTGGGAGGCCGAGGTGGG + Intronic
1146174273 17:30654972-30654994 CAGCACTTGGAGGCCGAGGCGGG + Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146263571 17:31437034-31437056 AAGCATTGGGAGGCCGAGGCGGG - Intronic
1146334943 17:31961298-31961320 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1146347728 17:32070999-32071021 CAGCACTTGGAGGCCGAGGCGGG + Intergenic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146925139 17:36739399-36739421 CCACTGTGGGAGGCCGAGGTGGG - Intergenic
1147138875 17:38450652-38450674 CAGCACTGGGAGGCCAAGGTGGG - Intronic
1147154710 17:38538170-38538192 CAGCACTGGGAGGCTGAGGTGGG + Intronic
1147665946 17:42148160-42148182 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1147700591 17:42391668-42391690 AAGCTTTGGGAGACCGAGGCAGG + Intergenic
1147702649 17:42405557-42405579 GCGCTGTGGGAGACCGAGGCAGG + Intronic
1147752762 17:42746427-42746449 CAGCACTGGGAGGCAGAGGTGGG - Intergenic
1147796593 17:43048140-43048162 CAACACTGGGAGGCCAAGGTGGG - Intronic
1147854647 17:43469877-43469899 GTGCTTTGGGAGACCGAGGTGGG + Intergenic
1148051239 17:44770866-44770888 CATCACTGGGAGGCTGAGGTGGG + Intronic
1148375058 17:47135892-47135914 CAGCACTGGGAGGCCAAAGTGGG + Intronic
1148593843 17:48837005-48837027 CAGCACTGGGAGGCCAAGGCAGG - Intronic
1148637176 17:49157706-49157728 CTGCTTTGGGAGACCGAGGTGGG - Intronic
1148810125 17:50284984-50285006 GGGCAGGGGGAGACTGAGGTGGG + Intergenic
1148836714 17:50469411-50469433 CTGAAGTGGGAGACCGACGCCGG - Intronic
1148919352 17:51016658-51016680 CAGCACTGGGAGGCCAAGGCGGG + Intronic
1148953660 17:51335920-51335942 CTGCAGTGGTGGACCAAGGTGGG + Intergenic
1149472862 17:56933251-56933273 CAACACTGGGAGACTGAGGTGGG - Intergenic
1149485273 17:57037775-57037797 CAACACTGGGAGGCAGAGGTGGG - Intergenic
1149576638 17:57718137-57718159 CAACTTTGGGAGGCCGAGGTAGG + Intergenic
1149930792 17:60753088-60753110 CAGCACTGGGAGGCTGAGATGGG - Intronic
1150030741 17:61732227-61732249 CATCACTTGGAGGCCGAGGTGGG - Intronic
1150136685 17:62699652-62699674 CAGCACTGGGAGGCAGAGGTGGG - Intergenic
1150308039 17:64103248-64103270 CACCTTTGGGAGGCCGAGGTGGG + Intronic
1150483045 17:65525175-65525197 CAGGATTGAGAGGCCGAGGTGGG + Intergenic
1150493432 17:65589819-65589841 CAGCACTGGGAGGCTGAGGCGGG + Intronic
1150681353 17:67287040-67287062 CAACACTGGGAGGCCAAGGTGGG + Intergenic
1150889819 17:69134992-69135014 CAGCTTTGGGAGGCTGAGGTAGG - Intronic
1151237375 17:72730996-72731018 CAGCACTGGGAGGCCGAGGCGGG - Intronic
1151256709 17:72883041-72883063 CCACATTGGGAGGCCGAGGTGGG - Intronic
1151310264 17:73288503-73288525 CAGCACTGGGAGGCCGAGGTGGG - Intronic
1151318927 17:73341127-73341149 CAACACTGGGAGGCCGAGGCAGG - Intronic
1151342246 17:73479236-73479258 CAGCAGTGGGCCACTGAGCTCGG + Intronic
1151352795 17:73541592-73541614 CAGCAGGGAGAGACGGAGGGAGG - Intronic
1151527429 17:74680631-74680653 CAGCTGAGGGAGGCAGAGGTGGG - Intronic
1151536508 17:74741914-74741936 CAGGAGAGGGAGACCGAAGTGGG + Intronic
1151628254 17:75291446-75291468 CAGCACTGGGAGGCTGAGGTGGG + Intergenic
1151706123 17:75768846-75768868 CAACACTGGGAGGCTGAGGTGGG + Intergenic
1151840327 17:76613015-76613037 GAGCAGGGGGAGGCAGAGGTTGG + Intergenic
1151891443 17:76953056-76953078 TAGCACTGGGAGGCCGAGGTGGG - Intergenic
1151898014 17:76993427-76993449 CAGCACTGGGAGGCTGAGGCAGG - Intergenic
1151900822 17:77012833-77012855 CAACACTGGGAGGCCGAGGCTGG - Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152030329 17:77838217-77838239 CAGCAGTGGGTGTCTGAGGCAGG + Intergenic
1152070697 17:78132336-78132358 CTGCAGTGGGAGAGCAGGGTGGG - Intronic
1152075309 17:78155871-78155893 CAGCACTGTGAGGCCGAGGCAGG - Intronic
1152182768 17:78834687-78834709 CACCTGTGGGAGGCAGAGGTGGG - Intronic
1152405239 17:80094464-80094486 CAGCTTTGGGAGGCCAAGGTGGG + Intronic
1152495152 17:80665789-80665811 CAGCTGTGGGAGGCCAAAGTGGG - Intronic
1152607938 17:81302461-81302483 TAGAAGTTGGAGACCCAGGTGGG - Intergenic
1152632667 17:81417511-81417533 CAGGGGAGGGAGACCGAGGAGGG + Intronic
1152896859 17:82916489-82916511 CACCTTTGGGAGGCCGAGGTGGG - Intronic
1153057306 18:958854-958876 CAGCAGTGGGTGACAGATGATGG + Intergenic
1153649590 18:7228340-7228362 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
1153860704 18:9202072-9202094 CAGCACTGGGAGGCTGAGGTGGG - Intronic
1153983905 18:10336104-10336126 CAACACTGAGAGGCCGAGGTAGG + Intergenic
1154091135 18:11364382-11364404 GAGCTTTGGGAGACTGAGGTGGG - Intergenic
1154118480 18:11632603-11632625 CAGCACTGGGAGGCTGAGGCAGG + Intergenic
1154146272 18:11868762-11868784 CAACACTGGGAGGCCGAGGCAGG + Intronic
1154162761 18:11992088-11992110 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1154357577 18:13633511-13633533 CATCAGTGGGAGGCTGAGGCAGG - Intronic
1155145639 18:23081197-23081219 GAACACTGGGAGGCCGAGGTGGG - Intergenic
1155974879 18:32118285-32118307 CAGCTTTGGGAGGCCAAGGTGGG + Intronic
1156258283 18:35420637-35420659 CAGCACTGGGAGGCTCAGGTGGG + Intergenic
1156463837 18:37336428-37336450 CAGCTTTGGGAGGCCAAGGTGGG - Intronic
1157259883 18:46168506-46168528 CAACACTGGGAGGCCGAGGTGGG + Intergenic
1157679092 18:49589698-49589720 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1157905920 18:51570162-51570184 CAGCAAGGGGAGACAGGGGTGGG + Intergenic
1158467591 18:57704835-57704857 GCGCTTTGGGAGACCGAGGTGGG + Intronic
1158578733 18:58662778-58662800 CGCCGTTGGGAGACCGAGGTGGG + Intergenic
1158581972 18:58691620-58691642 CAACACTGGGAGTCTGAGGTGGG + Intronic
1158592933 18:58792575-58792597 CAGCTTTGGGAGGCCGAGGCAGG + Intergenic
1158869652 18:61673039-61673061 CAGAATTGGGAGACCTGGGTTGG - Intergenic
1158986325 18:62821181-62821203 CAACACTGGGAGGCTGAGGTGGG + Intronic
1159336294 18:67071679-67071701 CAACTTTGGGAGACCGAGGTGGG - Intergenic
1160194385 18:76740203-76740225 AAGAAGTGGTAGACCGAGGTGGG + Intergenic
1160481809 18:79246687-79246709 CAGCAGGGGGAGCGCGAGGCCGG - Intronic
1160595184 18:79968570-79968592 CAGCACTGGGAGGCCAAGGTGGG - Intronic
1160609507 18:80074367-80074389 GCGCTGTGGGAGGCCGAGGTGGG - Intronic
1160675721 19:390200-390222 CGGTAATGGGAGACAGAGGTGGG + Intergenic
1160709284 19:543596-543618 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
1160741874 19:690064-690086 CAGGATTGGGAGGCAGAGGTGGG + Intronic
1161095428 19:2387631-2387653 CAGCTATGGGAGGCTGAGGTGGG + Intergenic
1161437937 19:4274854-4274876 AAGCTTTGGGAGACCGAGGCAGG + Intergenic
1161445220 19:4314731-4314753 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1161603778 19:5202995-5203017 CTTCGGTGGGAGGCCGAGGTGGG + Intronic
1161617426 19:5279615-5279637 GAGCTTTGGGAGACCGAGATGGG - Intronic
1161760081 19:6164675-6164697 CAGCACTGGGAGGCTGAGGTGGG - Intronic
1161772456 19:6238477-6238499 CGGCTGTGGGAGCCGGAGGTGGG + Intronic
1161782507 19:6302677-6302699 CTGGATTGGGAGGCCGAGGTGGG + Intergenic
1161882112 19:6962929-6962951 CAACATTGGGAGGCCGAGGCAGG + Intergenic
1161972196 19:7588728-7588750 CAGCAGTGCGAGACCAACCTGGG - Intergenic
1162199763 19:9011584-9011606 GAGCTTTGGGAGGCCGAGGTGGG - Intergenic
1162307951 19:9886928-9886950 CAACACTGGGAGGCCGAGGCAGG - Intronic
1162309737 19:9899016-9899038 CAACTTTGGGAGGCCGAGGTAGG + Intronic
1162368538 19:10264556-10264578 CAGCTATGGGAGGCTGAGGTAGG + Intergenic
1162418085 19:10550252-10550274 ACGCTTTGGGAGACCGAGGTGGG - Intronic
1162435736 19:10657047-10657069 CAACTCTGGGAGACCGAGGCCGG - Intronic
1162670888 19:12256952-12256974 CACCTGTGGGAGGCTGAGGTGGG - Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162766979 19:12925602-12925624 CAACACTGGGAGGCCGAGGTGGG - Intronic
1162945833 19:14042893-14042915 CTGCTGTGGGAGGCCGAGGAGGG + Intronic
1163174967 19:15557966-15557988 CAGCACTGGGAGGCCAAGGTGGG - Intergenic
1163192904 19:15692201-15692223 GAGTATTGGGAGGCCGAGGTGGG - Intronic
1163303597 19:16463237-16463259 CAGCAGTGGGAGTGCCTGGTGGG - Intronic
1163310833 19:16513628-16513650 GAACTTTGGGAGACCGAGGTGGG - Intronic
1163450217 19:17372814-17372836 CAGCACTGGGAGGCCAAGGCGGG + Intronic
1163452110 19:17384402-17384424 CAGCACTTGGAGGCCGAGGCGGG + Intergenic
1163766151 19:19164565-19164587 CTACTTTGGGAGACCGAGGTGGG + Intronic
1164104763 19:22099833-22099855 CAGCATTAGGAGGCCGAGGCGGG + Intergenic
1164602112 19:29569179-29569201 CAACTCTGGGAGGCCGAGGTGGG - Intergenic
1164743509 19:30594422-30594444 GAGCAGGGGGAGACTGAGGAGGG - Intronic
1165010754 19:32844581-32844603 CAGCACTGGGAGACTGAGGCAGG + Intronic
1165070499 19:33252636-33252658 CTGCCTTGGGAGGCCGAGGTGGG - Intergenic
1165201032 19:34145174-34145196 GAACTGTGGGAGGCCGAGGTGGG - Intergenic
1165406215 19:35632916-35632938 CAGCTGTGGGAGAGAGAGATGGG - Exonic
1165573298 19:36793351-36793373 CAACACTGGGAGGCCAAGGTGGG - Intergenic
1165694597 19:37891408-37891430 CAGCACTGGGACGCTGAGGTGGG - Intronic
1165748474 19:38245415-38245437 CAACACTGGGAGGCCGAGGCGGG - Intronic
1165852406 19:38857301-38857323 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
1165985808 19:39767829-39767851 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1166029344 19:40115047-40115069 CAGCACTAGGAAGCCGAGGTGGG - Intergenic
1166096267 19:40541376-40541398 CAGCAGAGGGAGCCCGAGGCAGG + Intronic
1166115683 19:40652620-40652642 CACCTTTGGGAGGCCGAGGTGGG - Intergenic
1166127362 19:40723340-40723362 CAACACTGGGAAACCAAGGTGGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166199734 19:41229195-41229217 CAGCCTTAGGAGGCCGAGGTGGG - Intronic
1166669914 19:44703648-44703670 AGGCAGTTGCAGACCGAGGTGGG + Exonic
1166777454 19:45321831-45321853 CAGCGGTGGGAGACGGGGATGGG + Intronic
1166779061 19:45330725-45330747 GCGCAGTGGGAGGCCTAGGTGGG + Intergenic
1166793215 19:45410131-45410153 CAGCACTGGGAGGCTGAGGCAGG - Exonic
1166814929 19:45538472-45538494 CATTTGTGGGAGGCCGAGGTGGG + Intronic
1166985478 19:46657803-46657825 CAACTTTGGGAGACCGAGGCGGG + Intronic
1167086106 19:47310741-47310763 GAGCTTTGGGAGACCAAGGTGGG - Intronic
1167156146 19:47740499-47740521 CAGCATTGGGAGGCTGAGGCGGG + Intronic
1167247622 19:48383242-48383264 CAGCAGCGGGAGGCAGAGGAAGG - Exonic
1167399185 19:49253657-49253679 GTACACTGGGAGACCGAGGTGGG - Intergenic
1167506404 19:49873252-49873274 GAGCTGTGGGAGGCCGTGGTGGG - Exonic
1167512806 19:49905092-49905114 CAGCTTTGGGAGGCCGAGGCGGG - Intronic
1167582572 19:50354857-50354879 CGGCCTTGGGAGGCCGAGGTGGG - Intronic
1167702141 19:51055211-51055233 CAACACTGGGAGGCCAAGGTGGG - Intergenic
1167933348 19:52886379-52886401 CAGCACTGGGATGCCGAGGTGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168216664 19:54931173-54931195 CAGCAGTGGGAGGCCAAGACGGG + Intronic
1168231881 19:55037867-55037889 CAACCTTGGGAGGCCGAGGTGGG - Intronic
1168403577 19:56099462-56099484 CAACACTGGGAGGCCGAGGCGGG + Intronic
1168632152 19:57965497-57965519 CAGCACTGGGAGGCCAAGGTAGG + Intronic
1168662204 19:58176077-58176099 CAACACTGTGAGACCAAGGTGGG - Intergenic
1202692666 1_KI270712v1_random:102355-102377 CGGCATTGGGGGACGGAGGTGGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
926117242 2:10221309-10221331 CAGCTGTGGGCGCCCGAGGGTGG + Intergenic
926412730 2:12621220-12621242 CAACACTGGGAGGCCGAGGAGGG + Intergenic
927543023 2:23929039-23929061 CAGCACTTGGAGGCCGAGGCGGG + Intronic
927768992 2:25841699-25841721 TAGCTTTGGGAGACCGAGGAGGG + Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928009654 2:27595107-27595129 CAACAGAGGGAGACCGAAGAAGG + Intronic
928155009 2:28868764-28868786 CAGCACTGGGAGGCCGAGGTGGG + Intronic
928408948 2:31038990-31039012 CAGCACTGGAAGGCTGAGGTGGG - Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928644213 2:33334820-33334842 CAGCACTGGTTGGCCGAGGTGGG + Intronic
928860650 2:35853742-35853764 GAACTTTGGGAGACCGAGGTGGG + Intergenic
929195562 2:39180933-39180955 CAGCACTGGGAGGCCGAGGTGGG - Intronic
929202162 2:39246989-39247011 CAACACTGGGAGGCTGAGGTGGG - Intergenic
929393726 2:41498775-41498797 CAGCACTGAGAGGCCGAGGTGGG - Intergenic
929589356 2:43134928-43134950 GAACATTGGGAGACCGAGGCGGG + Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930121664 2:47765787-47765809 GAGCAGTGGGGGGCAGAGGTGGG + Intronic
930367130 2:50454077-50454099 CAGCACTTTGAGGCCGAGGTGGG + Intronic
930580381 2:53204035-53204057 CTGCTTTGGGAGACTGAGGTGGG + Intergenic
930715924 2:54594075-54594097 CAGCTTTGGGAGGCCGAGGTGGG - Intronic
930767353 2:55097555-55097577 CAGCAGTGGGGGAAGGAGGAGGG + Intronic
931060595 2:58524596-58524618 GACCATTGGGAGGCCGAGGTGGG - Intergenic
931353108 2:61510031-61510053 GCGCTGTGGGAGGCCGAGGTGGG + Intronic
931353459 2:61513245-61513267 CAGCACTGGGAGGCCAAGGCAGG - Intronic
931413504 2:62058525-62058547 CAGCACTGGGAGGCTGAGGTGGG + Intronic
931512783 2:63019460-63019482 CAGCACTGGGAGGCCCAGGCGGG + Intronic
932232071 2:70090976-70090998 CAACACTGGGAGGCCGAGGTGGG + Intergenic
932244807 2:70187935-70187957 GAGCTTTGGGAGGCCGAGGTGGG - Intronic
932267260 2:70378427-70378449 CAACAATGGGAGGCCAAGGTGGG - Intergenic
932282312 2:70504163-70504185 CAACACTGGGAGGCCGAGGTGGG + Intronic
932474473 2:71993331-71993353 GAGCTTTGGGAGACCGAGGCAGG - Intergenic
932488587 2:72103966-72103988 CTTCAGTGAGAGACAGAGGTAGG - Intergenic
932531382 2:72537353-72537375 CAGCACTGGGAGGCTGAGGCAGG + Intronic
932725961 2:74179840-74179862 CAGCTTTGGGAGGCCGAGGCGGG - Intergenic
933447303 2:82398376-82398398 CAGCAAAGGGAGACAGGGGTGGG + Intergenic
933449380 2:82427479-82427501 CAGCTTTGGGAGGCTGAGGTAGG + Intergenic
933953736 2:87351609-87351631 CGGCATTGGGGGACGGAGGTGGG + Intergenic
934237941 2:90247863-90247885 CGGCATTGGGGGACGGAGGTGGG + Intergenic
934322070 2:91980413-91980435 CGGCATTGGGGGACGGAGGTGGG + Intergenic
935002521 2:99033592-99033614 CAGCACTGGGAGGCTGAGGTGGG + Intronic
935013675 2:99159172-99159194 CAGCTCTGGGAGGCCGAGGCAGG - Intronic
935161435 2:100532833-100532855 CAACACTGGGAGGCCAAGGTGGG + Intergenic
935234775 2:101129387-101129409 CAACACTGGGAGGCCGAGGCAGG - Intronic
935469371 2:103438525-103438547 TAGGAATGGGAGACTGAGGTAGG - Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935707647 2:105870507-105870529 GCACAGTGGGAGGCCGAGGTGGG + Intronic
935872224 2:107463473-107463495 CAACACTGGGAGGCTGAGGTGGG + Intergenic
936757205 2:115729517-115729539 GAGCTGTGGGAGGCCAAGGTGGG + Intronic
936757654 2:115734407-115734429 CAGCACTGGGAGGCCGAGGTGGG + Intronic
936789354 2:116132906-116132928 CAGCTATGGGAGGCTGAGGTAGG - Intergenic
936870540 2:117130872-117130894 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
937001574 2:118472470-118472492 CAGCATTGGGAGGCCGAGGCGGG - Intergenic
937419677 2:121743327-121743349 CAACACTGGGAGGCCAAGGTGGG - Intronic
937444844 2:121949245-121949267 CAGCACTGGGAGGCCCAGGCGGG - Intergenic
937922765 2:127143524-127143546 CAGCACCGGGAGGCTGAGGTGGG + Intergenic
938014483 2:127856341-127856363 CAGCACTGGGAGGCCAAGGTGGG + Intronic
938243436 2:129760362-129760384 CAGCAGTGGTAGGCCGAGGCGGG + Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938792639 2:134690530-134690552 CAGCACTGGGAGGCTGAGGCTGG - Intronic
939491433 2:142881998-142882020 CAGCACTGGGAGGCCGAGGCAGG - Intronic
939492977 2:142899047-142899069 CAGCAGTGGTGGACCCGGGTGGG + Intronic
939739822 2:145892748-145892770 TTGCAGTGGGAGACCAAGATTGG + Intergenic
939936931 2:148304612-148304634 CTGCAGTGGGAGAGAGAGATTGG + Intronic
940265394 2:151830462-151830484 CAACACTGGGAGGCCAAGGTGGG + Intergenic
940595797 2:155791137-155791159 CAGCTTTGGGAGGCTGAGGTGGG - Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
940935054 2:159483528-159483550 GAGCTTTGGGAGGCCGAGGTGGG + Intronic
941528996 2:166641572-166641594 CAGCAAAGGGAGACAGGGGTGGG + Intergenic
941538018 2:166745213-166745235 CAGCACTGGGAGGCCGATGTGGG - Intergenic
941999946 2:171636185-171636207 CAACACTGGGAGGCTGAGGTGGG - Intergenic
942034447 2:171997317-171997339 CAGGAGTTGGAGACCCAGCTGGG - Intronic
942187315 2:173436721-173436743 GAACATTGGGAGGCCGAGGTGGG - Intergenic
942407505 2:175671198-175671220 CAGCACTGGGAGCCTGAGGCGGG + Intergenic
942477185 2:176339689-176339711 GAGCCTTGGGAGGCCGAGGTGGG - Intergenic
942623682 2:177876262-177876284 CAGCAATAAGAGACCCAGGTAGG + Intronic
942874111 2:180772258-180772280 GTGCTGTGGGAGGCCGAGGTGGG + Intergenic
943063733 2:183065227-183065249 GAGCTCTGGGAGGCCGAGGTGGG + Intergenic
943196576 2:184759893-184759915 CAGCAAAGGGAGATAGAGGTGGG - Intronic
943460441 2:188166077-188166099 CAGCAAAGGGAGATAGAGGTGGG + Intergenic
943666927 2:190618823-190618845 CAGCACTGGGAGGCCAAGGCAGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944167914 2:196742962-196742984 CAGCAGTGAGAGGCTGAAGTTGG - Intronic
944498444 2:200332491-200332513 CCACTGTGGGAGACCAAGGTGGG - Intronic
944777613 2:202983125-202983147 GAGGAGTGGGAGGCTGAGGTGGG - Intronic
944906876 2:204270566-204270588 CAGCAAAGGAAGACAGAGGTGGG + Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945365925 2:208953525-208953547 CAGCACTTGGAGGCCGAGGCGGG - Intergenic
945737192 2:213615342-213615364 CAGCACTGGGAGGCTGAGGCGGG + Intronic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946018100 2:216620363-216620385 CAGCACTTTGAGGCCGAGGTGGG + Intergenic
946196517 2:218035537-218035559 CAGCAGTGGGACACAGTGGAGGG - Intronic
946200796 2:218069701-218069723 CAGCAGTGGGACACAGTGGAGGG - Intronic
946217167 2:218193452-218193474 CAGCACTTGGAGGCCGAGGCAGG + Intergenic
946845104 2:223851907-223851929 CAGTTTTGGGAGGCCGAGGTGGG - Intergenic
947854458 2:233313814-233313836 CAACACTGAGAGACCAAGGTGGG - Intronic
947970594 2:234319876-234319898 CAACATTGGGAGGCCGAGGCAGG - Intergenic
947999761 2:234558129-234558151 AAGCTTTGGGAGGCCGAGGTGGG - Intergenic
948179962 2:235972023-235972045 CAGCACTGGGAGGCTGAGGTGGG - Intronic
948247959 2:236502328-236502350 CAGCACTGGGTGACTGAGGTGGG + Intronic
948360987 2:237420276-237420298 CAGGATTGGGAGGCCGAGATGGG + Intergenic
948389945 2:237604754-237604776 CAGCTTTGGGAGGCCGAGGCGGG + Intergenic
948676658 2:239600904-239600926 GAGCAGTGGGAGGCCCAGGGAGG - Intergenic
948957645 2:241306371-241306393 CAGCTGTGGGAGGCTGAGGCAGG - Intronic
948984967 2:241515721-241515743 CAACACTGGGAGGCCGAGGCGGG + Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169102245 20:2960493-2960515 CAGCTTTGGGAGGCCGAGGTGGG - Intronic
1169236671 20:3935342-3935364 CAGAAGTGTGGGACCGAGGGAGG + Intronic
1169239412 20:3962945-3962967 CAACACTGGGAGGCTGAGGTGGG - Intronic
1169359802 20:4938571-4938593 CAGCATTGGGAGGCCAAGGTGGG - Intronic
1169372212 20:5036609-5036631 CAGCACTGGGAGGCTGAGGTGGG + Intergenic
1169419790 20:5450727-5450749 TAGCATTGGGAGGCCAAGGTGGG + Intergenic
1169478791 20:5958122-5958144 CAGCACTGGGAGTCCGAGGCAGG + Intronic
1169841765 20:9945626-9945648 CAGCACTGGAAGGCCGAGGCAGG + Intergenic
1170148061 20:13199147-13199169 GAACTTTGGGAGACCGAGGTGGG - Intergenic
1170524208 20:17221444-17221466 AAGCAGTGGCAGACTGAGGATGG + Intergenic
1170841976 20:19931000-19931022 GAGCTTTGGGAGACCAAGGTGGG + Intronic
1170867510 20:20172564-20172586 CAACACTGGGAGGCCAAGGTGGG - Intronic
1171477472 20:25423358-25423380 CAGCTTTGGGAGACCAAGGTGGG - Intronic
1172150924 20:32789838-32789860 CAGCACTGGGAGGCCGAGGCGGG - Intronic
1172157781 20:32841060-32841082 CAGCACTGGGAGGCCAAGGCAGG - Intronic
1172339434 20:34144604-34144626 CAGCACTGGGAGGCCAAGGCAGG + Intergenic
1172391046 20:34565504-34565526 CAGCACTGGGAGGCTGAGGTGGG - Intronic
1172655286 20:36533096-36533118 GAACTTTGGGAGACCGAGGTGGG + Intergenic
1172665219 20:36594473-36594495 CAACAGTGGGAAACTGAGTTTGG + Intronic
1172666364 20:36603195-36603217 ACACATTGGGAGACCGAGGTGGG + Intronic
1172916456 20:38447196-38447218 CAGGAGTCGGAGATCGGGGTCGG - Intergenic
1172967204 20:38845333-38845355 GAGCATTGGGAGGCTGAGGTGGG + Intronic
1172990352 20:39031581-39031603 GAGCTTTGGGAGGCCGAGGTGGG - Intronic
1173249683 20:41357949-41357971 CTGCAGTGGGTGAGCGAGGGGGG + Exonic
1174270894 20:49367522-49367544 TAGCACTGGGAGGCCGAGGCAGG + Exonic
1174383156 20:50170618-50170640 CGCCACTGGGAGGCCGAGGTGGG - Intergenic
1174575566 20:51534579-51534601 CAGCACTGGGAGGCCGAGGTGGG - Intronic
1174584403 20:51596335-51596357 CAGCTTTGGGAGACCAAGGCAGG - Intergenic
1174608816 20:51781929-51781951 GAACTTTGGGAGACCGAGGTGGG + Intergenic
1175099346 20:56567447-56567469 CAACACTGGGAGGCCGAGGTGGG - Intergenic
1175346489 20:58281096-58281118 CAGCTTTGGGAGGCCAAGGTGGG + Intergenic
1175510580 20:59521848-59521870 CAGCTTTGGGAGGCCAAGGTGGG + Intergenic
1175691464 20:61068612-61068634 CAGCCCTGGGAGACCCATGTGGG - Intergenic
1175813544 20:61872013-61872035 CTGCAGAGGGAGGGCGAGGTGGG + Intronic
1175853075 20:62104212-62104234 CAGCTGTGAGAGAACGACGTGGG + Intergenic
1175894666 20:62330784-62330806 CAGCGGTGGGGGGCCGAGGTCGG + Exonic
1175989365 20:62780036-62780058 CAACACTGGGAGGCTGAGGTGGG - Intergenic
1176024369 20:62978344-62978366 CAGCAGAGGGAGATGGGGGTGGG - Intergenic
1176085937 20:63295527-63295549 CACCAGTGGGAGGCGGCGGTGGG - Intronic
1176158325 20:63634841-63634863 CACCTTTGGGAGGCCGAGGTGGG - Intergenic
1176230712 20:64031426-64031448 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1176259740 20:64173296-64173318 CAGCAGTCACAGACAGAGGTGGG + Intronic
1176619599 21:9047009-9047031 CAGCAGAGGAAGACCGGGGTAGG + Intergenic
1177349212 21:19913153-19913175 CACCACTGGGAGGCTGAGGTGGG + Intergenic
1177604308 21:23358835-23358857 GAACTTTGGGAGACCGAGGTGGG - Intergenic
1177806539 21:25880392-25880414 CAGCACTGGGAGACACATGTTGG + Intergenic
1178025803 21:28465089-28465111 CAGCACTGGGAGGCCGAGGCTGG - Intergenic
1178040602 21:28636567-28636589 GTGCAGTGGGAGGCAGAGGTTGG - Intergenic
1178077278 21:29023845-29023867 CAACACTGGGAGGCCGAGGCGGG - Intergenic
1178339321 21:31772607-31772629 CAACACTGGGAGTCCAAGGTGGG - Intergenic
1178544349 21:33480277-33480299 CAGCAGTGGGAGCCCGGCGGCGG - Intergenic
1178545465 21:33489999-33490021 CAGGAGTTGGAGACCAGGGTGGG - Intronic
1178884307 21:36473331-36473353 CAGCCTTGGGAGGCCAAGGTTGG - Intronic
1179005004 21:37506118-37506140 CAACAGTGGGAGAGCCCGGTCGG + Exonic
1179793827 21:43770920-43770942 GAGCTTTGGGAGGCCGAGGTGGG - Intergenic
1179977861 21:44880477-44880499 CAACAGTGGGAGGCCAAGGCAGG + Intergenic
1180034153 21:45234590-45234612 CAGAAGGGGGAGGCAGAGGTTGG + Intergenic
1180154849 21:45972821-45972843 CAGCAGTGGGAGCCCTCGGGTGG - Intergenic
1180548817 22:16526329-16526351 CGGCATTGGGGGACGGAGGTGGG + Intergenic
1180782383 22:18528536-18528558 CTGCAGAGGGAAACTGAGGTTGG - Intronic
1180900680 22:19369683-19369705 CAACACTGGGAGGCCGAGGTGGG + Intronic
1180938202 22:19639742-19639764 CCACAGTGGGTGACCCAGGTTGG - Intergenic
1181098882 22:20525459-20525481 AAACTTTGGGAGACCGAGGTGGG - Intronic
1181125936 22:20702563-20702585 CTGCAGAGGGAAACTGAGGTTGG - Intergenic
1181137326 22:20777598-20777620 CAACACTGGGAGACCAAGGCAGG - Intronic
1181157203 22:20930626-20930648 CAACACTGGGAGGCCGAGGCGGG - Intronic
1181239272 22:21467871-21467893 CTGCAGAGGGAAACTGAGGTTGG - Intergenic
1181355895 22:22295557-22295579 CGGCATTGGGGGACGGAGGTGGG - Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181622589 22:24101136-24101158 CAGCAGTGGGAGAGGGAGCCAGG + Intronic
1181635723 22:24173587-24173609 GCACAGTGGGAGGCCGAGGTGGG + Intronic
1181714077 22:24711706-24711728 GAGCAGTGGGAGATGGAGGTGGG + Intergenic
1181881398 22:25983120-25983142 CAACAGTGGGAGGCAGAGATGGG + Intronic
1181907723 22:26212667-26212689 CCACATTGGGAGGCCGAGGTGGG - Intronic
1181957921 22:26601747-26601769 CAGCACTGGGAGACTGTGGAAGG + Intronic
1182176238 22:28292432-28292454 CAGGAGTTGGAGGCCGAGGTGGG - Intronic
1182333788 22:29569740-29569762 CAGCACTCGGAGGCCGAGGCAGG + Intronic
1182352327 22:29705847-29705869 CAGCAGTGGGAGGCCCAGCGGGG + Intergenic
1182455667 22:30448622-30448644 TAGCACTGGGAGGCCAAGGTAGG + Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182625325 22:31641566-31641588 CAGCTTTGGGAGGCTGAGGTGGG + Intronic
1182631135 22:31686352-31686374 CAGCACTGGGAAGCCGAGGCGGG - Intronic
1182896516 22:33863509-33863531 CAACACTGGGAGGCCGAGGTGGG + Intronic
1182984282 22:34701757-34701779 CAGCACTGGGAGGTCGAGGCGGG + Intergenic
1183161966 22:36120420-36120442 GAGCTTTGGGAGACCAAGGTGGG + Intergenic
1183411375 22:37656738-37656760 CAGCACTGGGAGCCTGAGGCAGG + Intronic
1183450201 22:37889850-37889872 CAGCACTGGGAGGCCGAGGCGGG + Intergenic
1183461121 22:37951300-37951322 CAACACTGGGAGGCTGAGGTGGG - Intronic
1183588763 22:38768055-38768077 GAGCAGTGGGAGGAAGAGGTGGG + Intronic
1183642882 22:39102751-39102773 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1183659190 22:39208356-39208378 CAGCTGTGGGGGTCCGAGGAGGG + Intergenic
1183699244 22:39440962-39440984 CAGCACTGGGAGGCTGAGGTTGG + Intergenic
1183941595 22:41298745-41298767 CAACACTAGGAGGCCGAGGTGGG - Intergenic
1184129549 22:42509575-42509597 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1184139752 22:42571668-42571690 CAACACTGGGAGGCCGAGGCGGG - Intronic
1184156098 22:42668221-42668243 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184255274 22:43282940-43282962 GAACTTTGGGAGACCGAGGTGGG - Intronic
1184733656 22:46385341-46385363 CAGCACTGGGAGGCTGAGATGGG - Intronic
1184761358 22:46546621-46546643 CAGCACTGGGAGGCCAAGGCGGG - Intergenic
1185001021 22:48245842-48245864 CAGCAGTAGGAGGCTGAGGCGGG + Intergenic
1185039359 22:48496562-48496584 CAGCTGTGGGGGACAGAGGAGGG + Intronic
1185241941 22:49751408-49751430 GAGCTTTGGGAGGCCGAGGTGGG - Intergenic
1185257920 22:49846737-49846759 CAACACTGGGAGACCGAGATGGG - Intergenic
1185349672 22:50327814-50327836 CCGCTTTGGGAGGCCGAGGTGGG + Intergenic
1185405353 22:50645067-50645089 CAGGAGTGGGAGAGAGAGCTTGG - Intergenic
949304324 3:2622518-2622540 AAGCTCTGGGAGGCCGAGGTGGG - Intronic
950136582 3:10585247-10585269 CAGCTTTGGGAGGCCGAGGCTGG + Intronic
950348721 3:12325172-12325194 CAACACTGGGAGGCTGAGGTGGG + Intronic
950375033 3:12564190-12564212 GAACTGTGGGAGGCCGAGGTGGG - Intronic
950386048 3:12661458-12661480 AGGCCGTGGGAGGCCGAGGTGGG + Intronic
950576777 3:13836905-13836927 CAGCAGTGGCAGCCCCAGGTAGG + Intronic
950783702 3:15414599-15414621 CAACTTTGGGAGACTGAGGTGGG - Intronic
950838130 3:15940217-15940239 CAGCAGGGGAAGACGCAGGTAGG - Intergenic
951202923 3:19894738-19894760 CAACACTGGGAGGCCGAGGCAGG + Intronic
951299133 3:20972921-20972943 CAGCAGAGGGAGATAGGGGTGGG + Intergenic
951406370 3:22304022-22304044 CAACACTGGGAGGCCGAGGTGGG - Intronic
951559662 3:23953088-23953110 CAGCACTGGGAGGCCAAGGTGGG + Intronic
951761883 3:26157183-26157205 TAGGCGTGGGAGACCGAGGTGGG - Intergenic
951877338 3:27441732-27441754 CAACACTGGGAGACTGAGGCAGG - Intronic
951965677 3:28381914-28381936 CAGCAATAGGAGGCCAAGGTGGG + Intronic
952255054 3:31687823-31687845 CAACAGTGGGAGGCTGAGGCAGG + Intronic
952279236 3:31907378-31907400 CAACACTGGAAGGCCGAGGTGGG + Intronic
952367739 3:32689705-32689727 CACCTGTGGGAGGCTGAGGTGGG + Intronic
952403012 3:32980534-32980556 CAGCTTTGGGAGGCCAAGGTGGG + Intergenic
952616174 3:35276622-35276644 TAGCTGTGGTAGACAGAGGTGGG - Intergenic
952737620 3:36706012-36706034 CAGCACTTTGAGGCCGAGGTGGG - Intergenic
952819026 3:37470041-37470063 CAGCACTGGGAGGCCGAGGTGGG - Intronic
952915142 3:38232171-38232193 CACCTGTGGGAGGCTGAGGTGGG + Intronic
953328196 3:42030246-42030268 CAACATTGGGAGGCTGAGGTGGG + Intronic
953383836 3:42493519-42493541 CTGCAGTGGGGGACAGAGGAGGG + Intronic
953618531 3:44512844-44512866 CACTTGTGGGAGGCCGAGGTGGG - Intergenic
953661712 3:44895536-44895558 CTGCAGTTGGAGAGGGAGGTGGG + Intronic
953833903 3:46326839-46326861 CAGCAAAGGGAGATAGAGGTGGG + Intergenic
953843721 3:46410304-46410326 CAGCAGTGGGCGGCCTGGGTAGG - Intronic
953991552 3:47487849-47487871 CAGCACTGGGAGGCCGAGGTAGG - Intergenic
954026888 3:47790181-47790203 CAGCTTTGGGAGGCCGAGGCGGG - Intergenic
954058054 3:48044514-48044536 CAGCACTGGGAGGCCGAGGTGGG + Intronic
954141570 3:48609463-48609485 TAGCAGTGGCAGGTCGAGGTGGG - Intronic
954175426 3:48841130-48841152 CAGCACTGGGGGGCCGAGGCGGG - Intronic
954185350 3:48912797-48912819 CAGCACTGGGAGGCTGAGGCGGG + Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954574357 3:51667410-51667432 CATCACTGGGAGGCCGAGGAGGG - Exonic
954742239 3:52762634-52762656 AAGCTTTGGGAGGCCGAGGTGGG + Intronic
954791659 3:53137582-53137604 CAACACTGGGAGGCCAAGGTGGG + Intergenic
955064084 3:55519784-55519806 GAGCTTTGGGAGACTGAGGTGGG + Intronic
955283276 3:57614728-57614750 TAGCAGAGGGAGGCCGAGGCGGG + Intergenic
955384636 3:58469852-58469874 CAGCACTGGGATGCCAAGGTGGG - Intergenic
955737342 3:62053511-62053533 CAACTTTGGGAGGCCGAGGTGGG - Intronic
956435215 3:69228624-69228646 CAGGAGTTGGAGACCGACCTGGG + Intronic
956770862 3:72524896-72524918 CCACTTTGGGAGACCGAGGTTGG - Intergenic
956822101 3:72963324-72963346 CAGCACTGGGAGGCTGAGGCGGG + Intronic
956858716 3:73301429-73301451 CAGCACTGGGAGGCTCAGGTGGG - Intergenic
957316344 3:78581313-78581335 CAGCAGAGGGAGATAGGGGTGGG + Intergenic
957317652 3:78588573-78588595 CAGCAGAGGGAGATAGGGGTTGG + Intergenic
957904211 3:86537169-86537191 CAGCAAAGGGAGATAGAGGTGGG + Intergenic
958012606 3:87899614-87899636 CAGCTGTGGGAGGCTGAGGCGGG + Intergenic
958416534 3:93881074-93881096 CAGCACTGGGAGGCTGAGGCAGG + Intronic
958940985 3:100314519-100314541 CAGCACTGGGAGGCTGAGGTGGG + Intronic
959071739 3:101707822-101707844 CAACACTGGGAGGCTGAGGTGGG - Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959465748 3:106684648-106684670 CAGCTTTGGGAGGCCGAGGTGGG + Intergenic
959710003 3:109376535-109376557 CAGCACTTTGAGGCCGAGGTAGG - Intergenic
959930914 3:111981055-111981077 CAGCAATGGGAGGCCAAGGTGGG + Intronic
960512971 3:118572323-118572345 CAGCACTGGGAGGCCGAGGCTGG - Intergenic
960714574 3:120562577-120562599 CAGCTTTGGGAGATCGAGGTGGG + Intergenic
960760446 3:121068252-121068274 CAGCACTGGGAGGCCGAGGCAGG - Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
960805785 3:121582815-121582837 CAGCTATGGGAGGCTGAGGTGGG - Intronic
961579546 3:127868489-127868511 CAGCTTTGGGAGGCTGAGGTAGG + Intergenic
961772952 3:129263576-129263598 CATCAGTGGGAGCCAGTGGTAGG + Intronic
961896595 3:130173026-130173048 CAACACTGGGAGGCCGAGGCAGG - Intergenic
962518559 3:136176576-136176598 CAGCATTGGGAGGCTGAGGCAGG + Intronic
962937553 3:140094703-140094725 CAGCAGTGGCAGACAAAGGCTGG + Intronic
963140566 3:141943003-141943025 CAACACTGGGAGGCCGAGGTGGG - Intergenic
963738656 3:149051909-149051931 CAACACTGGGAGGCCGAGGTGGG + Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
963960516 3:151304325-151304347 CAGCACTGGGTGGCCGAGGCTGG + Intronic
964324370 3:155530561-155530583 AGCCTGTGGGAGACCGAGGTGGG - Intronic
964556700 3:157947529-157947551 GAACTGTGGGAGACCAAGGTAGG - Intergenic
964615090 3:158655237-158655259 CAGGAGTGGGAGGCCAAGGCGGG + Intronic
964772092 3:160235018-160235040 CCGCTTTGGGAGACTGAGGTAGG - Intronic
965205480 3:165715239-165715261 CAGCTTTGGGAGGCCTAGGTGGG - Intergenic
965579196 3:170249092-170249114 GCGCTTTGGGAGACCGAGGTGGG - Intronic
966005318 3:175004125-175004147 CAGCACTGGGAGGCCAAGGCAGG + Intronic
966276187 3:178172872-178172894 CAGCACTGGGAGGCTGAGGTGGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
966794590 3:183701331-183701353 CAGCACTGGGAGGCCAAGGCAGG - Intronic
966829974 3:183999529-183999551 CAGCACTGGGAGGCCAAAGTGGG + Intronic
966964674 3:184978644-184978666 CAGCTTTGGGAGGCTGAGGTGGG - Intronic
967078994 3:186031776-186031798 CAACTTTGGGAGGCCGAGGTGGG - Intergenic
967276272 3:187778388-187778410 CAACTTTGGGAGACTGAGGTGGG + Intergenic
967671893 3:192246575-192246597 GAACTTTGGGAGACCGAGGTGGG + Intronic
968141484 3:196261408-196261430 CAGCACTGGGAGGCCGAGGCAGG + Intronic
968394487 4:221178-221200 GAACTTTGGGAGACCGAGGTGGG + Intergenic
968419849 4:474628-474650 AAGCTTTGGGAGGCCGAGGTGGG + Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968643489 4:1726878-1726900 TAGCACTGGGAGGCCGAGGCGGG + Intronic
969732832 4:8966966-8966988 CAACATTGGGAGGCTGAGGTGGG + Intergenic
969806198 4:9610936-9610958 CAACACTGGGAGACCGAGGCAGG + Intergenic
969864363 4:10064137-10064159 CAGCTGTGGGAGCCCGATGAGGG - Intergenic
970127000 4:12825487-12825509 GAGCTTTGGGAGGCCGAGGTGGG - Intergenic
970381517 4:15512703-15512725 CAGCTTTGGGAGGCCGAGGAGGG + Intronic
970395467 4:15660828-15660850 CAACACTGGGAGGCCGAGGTGGG + Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970423515 4:15926427-15926449 CAGCTTTGGGAGGCCAAGGTGGG - Intergenic
970543699 4:17105495-17105517 AAGCTCTGGGAGGCCGAGGTGGG - Intergenic
970668112 4:18361642-18361664 CCGCTTTGGGAGGCCGAGGTGGG - Intergenic
970807526 4:20053842-20053864 CTGCAGTTGGAGGCCGAGGCAGG - Intergenic
971103534 4:23496736-23496758 CAGCAAAGGGAGAGCGGGGTGGG - Intergenic
971262423 4:25069358-25069380 GACCAGTGGGAGGCCAAGGTGGG - Intergenic
971729638 4:30361050-30361072 CAGCAGTAGGAGGCTGTGGTGGG + Intergenic
972329496 4:38051525-38051547 GAGCTTTGGGAGACTGAGGTGGG + Intronic
972391498 4:38617984-38618006 CAGGAGTTGGAGACCAAGTTGGG - Intergenic
972426173 4:38935161-38935183 CAGCTGTGGGAGGCCGAGGTGGG - Intronic
972494238 4:39618400-39618422 GAGTATTGGGAGGCCGAGGTGGG + Intronic
972514299 4:39797840-39797862 CAGCACTGAGAGGCCGAGGCAGG - Intergenic
972559766 4:40216220-40216242 GAACTTTGGGAGACCGAGGTGGG + Intronic
972629505 4:40831149-40831171 CAGCACTGGGAGGCCGAGGTGGG + Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973317242 4:48774791-48774813 CGGCACTCGGAGACTGAGGTGGG - Intronic
973318286 4:48783535-48783557 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
973643615 4:52928086-52928108 GAACTTTGGGAGACCGAGGTGGG + Intronic
973768131 4:54182256-54182278 CAGGCGTGGGAGGCCGAGGCAGG - Intronic
973886489 4:55327453-55327475 CAGCACTGGGAGGCCAAGGTGGG - Intergenic
973907513 4:55546517-55546539 CCGCAGCGGGAGACCTGGGTGGG - Intronic
973960396 4:56104148-56104170 GAGCTTTGGGAGGCCGAGGTGGG + Intergenic
975250534 4:72173484-72173506 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
975570839 4:75816209-75816231 CAGCACTGGGAGGCTGAGGCAGG - Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
975762845 4:77635318-77635340 CAGCAGGGGGTGAAGGAGGTGGG - Intergenic
976195983 4:82531506-82531528 CAACACTGGGAGGCCAAGGTGGG + Intronic
976278650 4:83304577-83304599 CAACACTGGGAGGCTGAGGTGGG + Intronic
976296972 4:83482460-83482482 TAGCACTGGGAGGCCAAGGTGGG + Intronic
976323961 4:83750144-83750166 CATCCTTGGGAGGCCGAGGTGGG + Intergenic
976598584 4:86917029-86917051 CAACACTGGGAGGCCAAGGTGGG + Intronic
976782400 4:88775455-88775477 CAGCACTGGGAGGCTGAGGTGGG + Intronic
976818044 4:89173522-89173544 CAGCAGTGGGAGGTTGAGGTTGG + Intergenic
976849050 4:89524182-89524204 AAGCAGTGGGAGTAGGAGGTTGG + Intergenic
977274277 4:94956314-94956336 GTGCTTTGGGAGACCGAGGTGGG - Intronic
977442981 4:97093765-97093787 CAGCTGTGGGAGGCTGAGGCAGG - Intergenic
977598835 4:98914109-98914131 CAGCACTTTGAGGCCGAGGTGGG + Intronic
977799360 4:101207578-101207600 CAGCACTGGGAGGCCGAGGTGGG + Intronic
978141336 4:105320684-105320706 CAGCACTGGGAGGCCGAGGTGGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978443487 4:108758802-108758824 CAGCACTGGGAGGCCGAGGCGGG + Intronic
978801324 4:112758146-112758168 CAGCACTCGGAGGCCGAGGCGGG - Intergenic
978906928 4:114016201-114016223 CAGCACTGGGAGGCCAAGGCAGG + Intergenic
979146302 4:117252385-117252407 CAGCAAAGGGAGATAGAGGTGGG - Intergenic
979219521 4:118206076-118206098 CAACTTTGGGAGGCCGAGGTGGG - Intronic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979360536 4:119758941-119758963 CACCCCTGGGAGGCCGAGGTGGG + Intergenic
980110354 4:128630193-128630215 GTGCTTTGGGAGACCGAGGTGGG - Intergenic
980122529 4:128742720-128742742 GAGCTTTGGGAGACCGAGGTGGG + Intergenic
980127565 4:128788261-128788283 AAGGAGTGGGAGACAGAAGTAGG - Intergenic
980316213 4:131204315-131204337 CAGCTATGGGAGGCCGAGGCGGG + Intergenic
980933081 4:139199874-139199896 CAACACTGGGAGGCCGAGGCGGG + Intergenic
981061873 4:140433408-140433430 CAGGATTGGGAGGCCGAGGCGGG + Intergenic
981308760 4:143274866-143274888 CAGGAGATGGAGACTGAGGTAGG + Intergenic
982027374 4:151264182-151264204 CAGCTTTGGGAGGCTGAGGTGGG + Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982202393 4:152973454-152973476 CAGCTGTGGGAGGCAGTGGTGGG + Intronic
982793697 4:159621162-159621184 GCGCATTGGGAGGCCGAGGTGGG - Intergenic
982833292 4:160090070-160090092 CAGAACTGGGAGGCCAAGGTGGG + Intergenic
982846457 4:160259181-160259203 CAGCATTGGGAGGCCGAGGTGGG - Intergenic
983187537 4:164717513-164717535 CAGGAGTTGGAGACCCAGTTTGG - Intergenic
983281812 4:165690389-165690411 CAGCTTTGGGAGGCTGAGGTGGG - Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
983683612 4:170381434-170381456 CAACTTTGGGAGGCCGAGGTGGG - Intergenic
984142067 4:176015523-176015545 CAACACTGGGAGGCCAAGGTGGG - Intergenic
984273199 4:177573543-177573565 CATCCTTGGGAGGCCGAGGTGGG - Intergenic
984645839 4:182218974-182218996 CAGCACTGGGAGGCCGAGGCAGG + Intronic
984738099 4:183130296-183130318 CAGCACTGGGAGGCCGAGGCAGG - Intronic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984930689 4:184844780-184844802 CAGGAGTTGGAGACCAACGTAGG - Intergenic
985495572 5:202984-203006 GTGCTGTGGGAGGCCGAGGTGGG + Exonic
985802035 5:2010812-2010834 CATCAGCGGGAGACCCAGGGAGG - Intergenic
985975412 5:3416096-3416118 CAGGAATGGGAGCCCGAGTTTGG - Intergenic
986114607 5:4759918-4759940 GAGCTTTGGGAGACCGAGGCAGG - Intergenic
987357875 5:17081079-17081101 CAGCAGTGGGAGGCGAGGGTTGG + Intronic
987368186 5:17168859-17168881 CAGCACTTTGGGACCGAGGTGGG - Intronic
988075168 5:26342973-26342995 CAGCACTGGGAGGCTGAGGCAGG + Intergenic
988112675 5:26843279-26843301 CAACACTGGGAGACCAAGGAGGG + Intergenic
988685504 5:33521651-33521673 CAGCACTTGAAGGCCGAGGTGGG - Intergenic
988919765 5:35929535-35929557 CAGCATTGTGAGGCCAAGGTGGG - Intronic
989272165 5:39546233-39546255 CAGTACTGGGAGGCCGAGATGGG + Intergenic
989273164 5:39555854-39555876 CAGCTGTGGGAGGCCGAGTTGGG + Intergenic
989278043 5:39611242-39611264 GCACAGTGGGAGGCCGAGGTGGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
989634473 5:43519701-43519723 CTGGAGTGGGATACAGAGGTAGG + Intergenic
990280929 5:54250141-54250163 CAGGAGTGGGAGCAAGAGGTGGG + Intronic
990433273 5:55759136-55759158 CAGCTTTGGGAGACCAAAGTGGG - Intronic
990504734 5:56433104-56433126 CAGCAGAGGGAGAGAGGGGTGGG + Intergenic
991068893 5:62455271-62455293 CAGCACTGGGAGGCCGTGGTGGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991379803 5:66008168-66008190 CAACACTGGGAGGCTGAGGTGGG + Intronic
991578289 5:68127518-68127540 CTACTGTGGGAGACCGAGGTGGG + Intergenic
992004344 5:72462795-72462817 CAACTGTGGGAGGCCGAGGCGGG - Intronic
992129124 5:73673923-73673945 CAACACTGGGAGGCTGAGGTGGG + Intronic
992601300 5:78403542-78403564 CAGCTTTGGGAGGCCAAGGTGGG + Intronic
992712406 5:79472526-79472548 CAGGAATGGGAGGCTGAGGTAGG + Intronic
992896431 5:81249327-81249349 CAGCACTGGGAGGCAAAGGTGGG - Intronic
993333059 5:86623527-86623549 CAGCACTCAGAGGCCGAGGTGGG + Intergenic
993644595 5:90446902-90446924 CAACTTTGGGAGGCCGAGGTGGG - Intergenic
993967475 5:94375275-94375297 GAGCTTTGGGAGGCCGAGGTGGG - Intronic
993987013 5:94609700-94609722 CAGGAGTGGGAGGCCGAGGCAGG + Intronic
994340129 5:98617261-98617283 CAGCACTGGGAGACTGAGGCAGG + Intergenic
994920490 5:106036452-106036474 CAGCAGTAGGGGACTGAGGGAGG - Intergenic
995884009 5:116872583-116872605 CAGCACTTGAAGGCCGAGGTGGG + Intergenic
996044466 5:118854942-118854964 CAGCAGCAGGAGGCCGAGGTGGG + Intronic
996173397 5:120324197-120324219 CAGCACTGGGAGGCCGAGGCGGG + Intergenic
996406722 5:123112443-123112465 CAGCAATGGGAAGCCGAGGAGGG - Intronic
996719062 5:126612451-126612473 CCACTTTGGGAGACCGAGGTGGG + Intronic
996785994 5:127237246-127237268 CAGCACTGGGAGGCCAAGGTGGG + Intergenic
997280159 5:132637778-132637800 CAACACTGGGAGGCCAAGGTGGG - Intronic
997285221 5:132673049-132673071 GAGCTTTGGGAGACTGAGGTAGG + Intergenic
997552943 5:134769650-134769672 CAGGGGTGGGAGGCCGAGGCAGG - Intronic
998120185 5:139570007-139570029 CAACACTGGGAGGCCAAGGTGGG + Intronic
998125128 5:139613816-139613838 CAGCTTTGGGAGGCTGAGGTGGG + Intronic
998347926 5:141480798-141480820 CAGCTTTGGGAGGCTGAGGTGGG + Intronic
999275517 5:150327393-150327415 AAGAACTGGGAGACTGAGGTAGG - Intronic
999734273 5:154500964-154500986 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1000247120 5:159457950-159457972 CAGCACTGGGAGACCAAAGCAGG + Intergenic
1000475309 5:161699706-161699728 CAGCTTTGGGAGGCGGAGGTGGG - Intronic
1001228989 5:169969685-169969707 CAACAGTGAGAGAACTAGGTGGG + Intronic
1001291506 5:170466016-170466038 CAGATGTGGGAGACCAAGGAGGG + Intronic
1001356201 5:171025832-171025854 GAACATTGGGAGACCGAGGCAGG - Intronic
1001660512 5:173388695-173388717 CAACACTGGGAGGCCAAGGTGGG - Intergenic
1001713036 5:173793238-173793260 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1002027850 5:176407548-176407570 CAGCAGTGGGAGGCTGAGGTGGG - Intronic
1002107642 5:176888010-176888032 CAACACTGGGAGGCTGAGGTGGG - Intronic
1002124285 5:177030370-177030392 CAGCACTGGGAGGCCGAGGCGGG + Intronic
1002141572 5:177144026-177144048 CAACTTTGGGAGGCCGAGGTGGG - Intronic
1002155641 5:177276570-177276592 CAACTTTGGGAGACCGAGGCGGG - Intronic
1002172097 5:177380926-177380948 CAGCACTTGGAGGCTGAGGTGGG - Intronic
1002236156 5:177804687-177804709 CAACTTTGGGAGGCCGAGGTGGG - Intergenic
1002483797 5:179520936-179520958 GAGCTTTGGGAGGCCGAGGTGGG + Intergenic
1002494233 5:179600942-179600964 CAGCACTGGGAGGCTGAGGTGGG - Intronic
1002525946 5:179816392-179816414 CAGCACTGGGAGGCCGAGGTGGG - Intronic
1002705461 5:181158421-181158443 CAGCAGTTGGAGACCAACCTGGG + Intergenic
1002985964 6:2191019-2191041 CAGCACTGGGGGACCCAGGGCGG + Intronic
1003074624 6:2971973-2971995 CAACACTGGGAGGCCGAGGCAGG + Intronic
1003083821 6:3045117-3045139 CAGCTGTGGGAGGCCAAGGTGGG - Intergenic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1003346387 6:5271805-5271827 CAGACTTGGGAGGCCGAGGTGGG - Intronic
1003613563 6:7634986-7635008 TAGCAATGGGAGGCCAAGGTGGG - Intergenic
1003678041 6:8225193-8225215 CAGCAATGGGAGGCTGAGGTGGG - Intergenic
1003924405 6:10863208-10863230 CAACACTGGGAGGCCGATGTGGG + Intronic
1004173919 6:13322140-13322162 CTGAAGTGGGAGGCTGAGGTGGG + Intronic
1004647731 6:17579286-17579308 CAGCACTGGGAGGCCCAGGTGGG - Intergenic
1004709637 6:18156666-18156688 CAATATTGGGAGGCCGAGGTGGG + Intronic
1005469141 6:26144734-26144756 GAACTTTGGGAGACCGAGGTGGG - Intergenic
1005874499 6:30000702-30000724 CAGCTTTGGGAGGCCGAGGCCGG + Intergenic
1005980920 6:30835868-30835890 CAGGTTTGGGAGACCAAGGTGGG + Intergenic
1006135325 6:31892471-31892493 GAGGAGTGGGAGACGGTGGTGGG - Exonic
1006530963 6:34653470-34653492 CAGCTTTGGGAGGCCGAGGTGGG - Intronic
1006543597 6:34760798-34760820 CAGCACTAGGAGGCCAAGGTGGG + Intronic
1006626102 6:35398999-35399021 CAGCTATGGGAGTCTGAGGTGGG + Intronic
1006647327 6:35523605-35523627 CAACAGTGGGAGGCCGAGGCAGG + Intergenic
1006820286 6:36887969-36887991 CAACACTGGGAGGCTGAGGTGGG - Intronic
1007102535 6:39259623-39259645 CAGGATTGGGAGAGGGAGGTGGG - Intergenic
1007460488 6:42014674-42014696 CAGCACTGGGAGGCTGAGGTTGG + Intronic
1007469665 6:42080620-42080642 CCACACTGGGAGGCCGAGGTGGG - Exonic
1007534320 6:42571494-42571516 CACCTTTGGGAGGCCGAGGTGGG + Intronic
1007565136 6:42844261-42844283 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1007741208 6:44010653-44010675 CAGCACTGAGAGACCGAGGCAGG - Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1009392613 6:63163369-63163391 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1010147520 6:72688081-72688103 CAGTATTGGGAGGCCGAGGCAGG - Intronic
1010686582 6:78860311-78860333 CAGCACTTTGAGGCCGAGGTGGG - Intergenic
1010795894 6:80115880-80115902 CAGCATTGGGAGGCCGAGGGGGG - Intronic
1011105084 6:83770261-83770283 GAGCAGTGAGTGACCAAGGTGGG - Intergenic
1011368192 6:86603595-86603617 CAGCAATGGGAGATGGGGGTGGG + Intergenic
1011470570 6:87703498-87703520 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1011516043 6:88154823-88154845 CACTTGTGGGAGGCCGAGGTGGG - Intronic
1011592459 6:88983535-88983557 GAGCTTTGGGAGGCCGAGGTGGG - Intergenic
1011682799 6:89799434-89799456 CAACACTGGGAGGCCGAGGCGGG + Intronic
1012596601 6:101048452-101048474 CAGCTTTGGGAGTCCAAGGTGGG - Intergenic
1012932240 6:105329397-105329419 CAGTTTTGGGAGGCCGAGGTGGG - Intronic
1013312620 6:108910215-108910237 CAACACTGGGAGGCTGAGGTGGG + Intronic
1013530951 6:111018185-111018207 CATCAGGGGGAGACCGGGGAGGG + Intronic
1014757079 6:125313180-125313202 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
1014913098 6:127117528-127117550 GAACACTGGGAGACCGAGGGTGG + Intergenic
1015304933 6:131697013-131697035 CGGCACTGGGAGACCAAGGAGGG - Intronic
1015400238 6:132780343-132780365 CATAAGTGGGAGGCTGAGGTGGG - Intronic
1015986306 6:138887470-138887492 CAGCACTGGGAGGCCGAGGCGGG - Intronic
1016270290 6:142280827-142280849 CCCCTGTGGGAGGCCGAGGTGGG + Intergenic
1016745252 6:147572585-147572607 CAACATTGGGAGTCTGAGGTGGG - Intronic
1016746909 6:147590657-147590679 CAGCACTGGGAGGCTGAGGCGGG - Intronic
1016971755 6:149770458-149770480 CAGCTTTGGGAGGCTGAGGTGGG + Intronic
1017001079 6:149998162-149998184 GAGCATTGGGAGGCCAAGGTGGG + Intergenic
1017270429 6:152497045-152497067 CAGCAAAGGGAGACAGAGGTGGG - Intronic
1017307454 6:152935682-152935704 CAGCACTGGGAGGCTGAGGAGGG - Intergenic
1017834091 6:158161127-158161149 CAGCACTTGGAGGCCAAGGTGGG + Intronic
1018156098 6:160986638-160986660 CAGCACTGGGAGGCCAAGGTGGG - Intergenic
1018232897 6:161692656-161692678 CAGCACTGGGAGGCTGAGGGGGG + Intronic
1018242883 6:161795478-161795500 CAGCACTGGGAGGCTGAGGCGGG - Intronic
1018330026 6:162717328-162717350 CAACTTTGGGAGACTGAGGTGGG + Intronic
1018361483 6:163074880-163074902 CTGGAGTGGGAGGCTGAGGTGGG + Intronic
1019098929 6:169611550-169611572 TAGCTTTGGGAGGCCGAGGTGGG - Intronic
1019105456 6:169663862-169663884 CTGCAGTGGGTGACCAAGGAGGG - Intronic
1019396211 7:819950-819972 TGGCACTGGGAGGCCGAGGTGGG - Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019502662 7:1372582-1372604 GCACTGTGGGAGACCGAGGTGGG - Intergenic
1019680670 7:2347076-2347098 CAGCCATGGGAGCCTGAGGTAGG + Intronic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019965316 7:4494094-4494116 CAGCACTGGGAGGCCGAGGTGGG - Intergenic
1019968688 7:4522765-4522787 CATCTGTGGGAGACCTTGGTTGG + Intergenic
1019969308 7:4527400-4527422 CAGCCTTGGGAGGCCGAGGCTGG + Intergenic
1020052989 7:5095062-5095084 CAACACTGGGAGACCAAGGCAGG + Intergenic
1020160602 7:5768319-5768341 CAGTAGTGGGAGGCCGAGGCAGG + Intronic
1020179052 7:5907105-5907127 CAGCACTGGGAGGCCAAGGTGGG - Intronic
1020234853 7:6347805-6347827 CAGCACTGGGAGGCCAAGATGGG + Intronic
1020303882 7:6817764-6817786 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1020308447 7:6852483-6852505 CAACATTGGGAGGCTGAGGTGGG - Intergenic
1020512295 7:9073081-9073103 CAGCACTGGGAGGCTGAGGTAGG - Intergenic
1020629881 7:10626597-10626619 CAACACTGGGAGGCCAAGGTGGG + Intergenic
1020834652 7:13134358-13134380 CAGCACTGGGAGGCAGAGGCTGG - Intergenic
1021134944 7:16954018-16954040 CAGCACTCGGAGGCCGAGGTAGG - Intergenic
1021447321 7:20747503-20747525 GAACTTTGGGAGACCGAGGTGGG - Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022299356 7:29088728-29088750 CACCTGTGGGAGGCCGAGGCGGG + Intronic
1022717731 7:32914019-32914041 CAACACTGGGAGGTCGAGGTAGG - Intergenic
1022940522 7:35232776-35232798 GCGCTTTGGGAGACCGAGGTGGG + Intronic
1023034709 7:36120317-36120339 CAGCAGTCTGAGACCGACCTGGG + Intergenic
1023388857 7:39687997-39688019 CAGCTTTGGGAGCCCAAGGTGGG - Intronic
1023906250 7:44523654-44523676 CAAGAGTGGGAGACCGATCTGGG + Intronic
1024480467 7:49856761-49856783 CATGATTGGGAGGCCGAGGTGGG + Intronic
1024748469 7:52434186-52434208 CAGCACTTTGGGACCGAGGTAGG - Intergenic
1024778135 7:52812326-52812348 AAGGATTGGGAGGCCGAGGTGGG - Intergenic
1024959137 7:54956924-54956946 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1025257671 7:57396407-57396429 CAGCACTGGGAGGCTGAGGCAGG + Intergenic
1025729546 7:64097842-64097864 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1025825845 7:65009767-65009789 CAGCACTGGGAGGCCAAGGCTGG + Intergenic
1025898841 7:65727552-65727574 CAGCACTGGGAGGCCAAGGCTGG + Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026013395 7:66654249-66654271 CAGCAGCGGGAGAGCGACGCTGG - Intronic
1026047677 7:66918689-66918711 CAACAGTGGGAGGCTGAGGCAGG - Intergenic
1026315686 7:69225245-69225267 CAGCACTGGGAGGCTGAGGCAGG - Intergenic
1026316269 7:69230413-69230435 CCTCAGTGGGAGACTGAGGTGGG - Intergenic
1026610114 7:71850964-71850986 GAGCATTGGGAGACTAAGGTGGG + Intronic
1026699284 7:72625548-72625570 CAGGAGCGGGAGGCTGAGGTGGG + Intronic
1026776802 7:73235569-73235591 CAGGAGTTGGAGACCGCGGCGGG + Intergenic
1026776957 7:73236331-73236353 GCGCTTTGGGAGACCGAGGTGGG + Intergenic
1026884094 7:73927864-73927886 CAGCACTGGGAGGCCGAGGTGGG - Intergenic
1026911974 7:74096253-74096275 CCGCTTTGGGAGGCCGAGGTGGG + Intronic
1026914368 7:74111188-74111210 CAACACTGGGAGGCCAAGGTGGG + Intronic
1027017651 7:74788939-74788961 CAGGAGTTGGAGACCGCGGCGGG + Intronic
1027416328 7:77978529-77978551 TAGCACTGAGAGGCCGAGGTGGG - Intergenic
1028323370 7:89490925-89490947 CAGCTTTGGGAGGCCGAGGCGGG + Intergenic
1028541282 7:91945112-91945134 CAACACTGGGAGGCTGAGGTGGG + Intronic
1028996136 7:97102249-97102271 CAGCTTTGGGAGGCCGAGGTGGG - Intergenic
1029289376 7:99490401-99490423 CAGCACTGGGAGGCCAAGGCTGG - Intronic
1029296788 7:99546605-99546627 CAGCAGTGGGAGACCGAGGTGGG - Exonic
1029374680 7:100170523-100170545 AAGCAGAGGGAGACAGAGGGAGG + Intronic
1029404415 7:100366198-100366220 CAGGATTGGGAGGCCAAGGTGGG - Intronic
1029411928 7:100418542-100418564 CAGCACTGAGAGGCTGAGGTGGG + Intronic
1029498579 7:100912644-100912666 CAGCATTGGGAGGCTGAGGTGGG + Intergenic
1029574852 7:101396706-101396728 CACCTTTGGGAGGCCGAGGTGGG - Intronic
1029653453 7:101909302-101909324 CAGGTTTGGGAGGCCGAGGTGGG + Intronic
1030666607 7:112285678-112285700 GAGCTTTGGGAGGCCGAGGTGGG - Intronic
1031232995 7:119134356-119134378 CAGGAGTGAGACACAGAGGTGGG + Intergenic
1031582912 7:123499316-123499338 CAGGAGTTGGAGACCAAGCTCGG - Intronic
1031768555 7:125812121-125812143 CAGCACTGGGAGGCCAAGGTGGG - Intergenic
1031976948 7:128100161-128100183 CAGCACTGGGAGACCAAGGCGGG + Intergenic
1032064829 7:128759947-128759969 CAACACTGGGAGGCCGAGGCGGG + Intronic
1032172491 7:129597090-129597112 CAGCACTGGGAGGCCAAGGCAGG + Intergenic
1032322301 7:130896560-130896582 CAGCAGGGGGAGAGAGAGGGAGG - Intergenic
1032348919 7:131142157-131142179 CAACACTGGGAGGTCGAGGTGGG + Intronic
1032390128 7:131550406-131550428 TAGCACTGGGAGGCTGAGGTGGG + Intronic
1032581965 7:133111937-133111959 CAGCAGTGGGAGGTGGAGGGAGG + Intergenic
1033185542 7:139224890-139224912 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1033203584 7:139396189-139396211 CAGCATTGGGAGGCTGAAGTGGG + Intronic
1033208942 7:139446087-139446109 CAGCACTGGGAGGCCGAGGCGGG - Intergenic
1033217376 7:139502994-139503016 CAGCACTGGGAGGGCGAGGCAGG + Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033349257 7:140548857-140548879 CAACACTGGGAAGCCGAGGTGGG - Intronic
1033713048 7:143969086-143969108 CAGCTTTGGGAGGCCGAGGCGGG + Intergenic
1034173694 7:149083461-149083483 TAGCACTGGGAGGCCGAGGCGGG - Intronic
1034181747 7:149144553-149144575 GCACAGTGGGAGGCCGAGGTGGG - Intronic
1034206765 7:149323235-149323257 CAGCTGTGGGAGGCTGAGGCAGG - Intergenic
1034404163 7:150891219-150891241 TAACAGTGGGAGGCTGAGGTGGG - Intergenic
1034681004 7:152927343-152927365 CAGCTGTGGAAGGCTGAGGTGGG + Intergenic
1034828288 7:154287047-154287069 CAGCAGTTTAAGGCCGAGGTGGG - Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035223672 7:157421882-157421904 CAGCACTGGGAGGCCGAGGCGGG - Intergenic
1035226600 7:157437263-157437285 AACCTTTGGGAGACCGAGGTGGG + Intergenic
1035450208 7:158973078-158973100 CGGCTTTGGGAGGCCGAGGTGGG - Intergenic
1036070417 8:5436567-5436589 CAGCAAAGGGAGATAGAGGTGGG + Intergenic
1036369334 8:8149420-8149442 CAACACTGGGAGGCCGAGGCAGG + Intergenic
1036805297 8:11827792-11827814 CAACACTGGGAGACCAAGGTAGG + Intronic
1036881556 8:12516220-12516242 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1037105090 8:15096929-15096951 CTGCTTTGGGAGGCCGAGGTGGG - Intronic
1037367371 8:18137126-18137148 CAGCACTGGGAGGCCAAGGCGGG - Intergenic
1037608441 8:20456834-20456856 CAACACTGGGAGGCTGAGGTGGG - Intergenic
1037852857 8:22346925-22346947 CAACACTGGGAGGACGAGGTAGG + Intronic
1038183009 8:25246523-25246545 CAACACTGGGAGGCCAAGGTGGG - Intronic
1038325601 8:26570490-26570512 CAACACTGGGAGGCTGAGGTGGG + Intronic
1038462899 8:27731344-27731366 CAACACTGGGAGGCCGAGGCGGG - Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1038745978 8:30255309-30255331 CAGGAGTTGGAGACCCACGTGGG + Intergenic
1039454253 8:37697125-37697147 CAGCTGTGGGAGACAGAAGCAGG - Exonic
1039550097 8:38437124-38437146 AAGAATTGGGAGGCCGAGGTGGG - Intronic
1039852316 8:41379755-41379777 GAACTTTGGGAGACCGAGGTGGG - Intergenic
1040003911 8:42601903-42601925 CAGCACTGGGAGATGGAGATGGG - Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1040936209 8:52784555-52784577 GCGCTTTGGGAGACCGAGGTGGG + Intergenic
1040937324 8:52795205-52795227 CATCTTTGGGAGGCCGAGGTGGG + Intergenic
1041305003 8:56448594-56448616 CAGGAGCGGGAGGCTGAGGTAGG + Intergenic
1041658999 8:60382776-60382798 CAGCACTGTGAGGCCGAGGTGGG + Intergenic
1041675773 8:60537924-60537946 CAGCACTGGGAGGCTGAGGTGGG - Intronic
1041726749 8:61025093-61025115 CAGCACTTGGAGGCCGAGGCAGG - Intergenic
1042283175 8:67077585-67077607 CAGCTTTGGGAGGCCGAGGCGGG - Intronic
1042307360 8:67345416-67345438 CAGCACTGGGAGGCTGAGGCAGG - Intergenic
1042310015 8:67370333-67370355 CACCCCTGGGAGGCCGAGGTGGG + Intergenic
1042365103 8:67927216-67927238 CAGCACTGGGAGACCGAGGCGGG + Intergenic
1042527227 8:69775803-69775825 CAGGAGTTGGAGACCAAGCTGGG + Intronic
1042829957 8:73016004-73016026 CAGCTCTGGGAGGCTGAGGTGGG + Intronic
1044071918 8:87771711-87771733 GTGCTTTGGGAGACCGAGGTGGG - Intergenic
1044365899 8:91345193-91345215 CAACACTGGGAGTCAGAGGTTGG - Intronic
1044905020 8:96991308-96991330 CTACTTTGGGAGACCGAGGTGGG + Intronic
1044982565 8:97731365-97731387 CAGCAGTTTGAGGCTGAGGTGGG - Intergenic
1044993788 8:97819979-97820001 CAGCTTTGGGAGGCCGAGGTGGG - Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045163825 8:99580601-99580623 CAACACTGGGAGGCTGAGGTGGG + Intronic
1045238229 8:100374832-100374854 CAACACTGGGAGGCCGAGGCGGG + Intronic
1045308848 8:100982862-100982884 CAGCGTTGGGAGGCTGAGGTGGG + Intergenic
1045401399 8:101822502-101822524 AAGCAGTGGGAGACATCGGTGGG + Intronic
1045474879 8:102544287-102544309 CAGCAGGGGAAGAACAAGGTGGG - Intergenic
1045574941 8:103410314-103410336 CAGCAGCAGGTGACCTAGGTGGG + Intronic
1046335432 8:112780802-112780824 CAGCAGTGGGAATCTGAGTTTGG + Intronic
1046395318 8:113632968-113632990 CAGGAGAGGGAGGCCAAGGTGGG - Intergenic
1046524051 8:115361342-115361364 CAGCAAGGGGAGACCGTGGCGGG + Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046750354 8:117920348-117920370 CAGCACTTGGAGGCCGAGGCGGG - Intronic
1046772401 8:118129036-118129058 CAACACTGGGAGGCTGAGGTAGG - Intergenic
1046860974 8:119091299-119091321 CAACACTCAGAGACCGAGGTGGG + Intronic
1047606224 8:126477601-126477623 CTGCAGTGGGAGACCCAGTTGGG + Intergenic
1047693918 8:127384287-127384309 CAGCTTTGGGAGGCCAAGGTGGG + Intergenic
1048017854 8:130513382-130513404 CAGCCTTGGGAGGCTGAGGTGGG + Intergenic
1048065293 8:130961354-130961376 GCGCTTTGGGAGACCGAGGTGGG - Intronic
1048500668 8:134971891-134971913 CAGCACTGGGAGGCCGAGGCAGG - Intergenic
1048804909 8:138231129-138231151 CAGCACTGGGAGGCTGAGGCAGG - Intronic
1049079296 8:140429334-140429356 CAGCACTGGGAGGCCACGGTGGG - Intronic
1049086359 8:140481348-140481370 CGGCCTTGGGAGGCCGAGGTGGG + Intergenic
1049089192 8:140501374-140501396 GAACTCTGGGAGACCGAGGTGGG + Intergenic
1049091449 8:140517651-140517673 CATCACTGGGAGGCCGAGGTGGG - Intergenic
1049141637 8:140960454-140960476 CAACACTGGGAGGCCGAGGTGGG - Intronic
1049207983 8:141372214-141372236 CAGCTGTGTGAGCCCGAGGGAGG - Intergenic
1049837607 8:144748318-144748340 CAGCACTGGGAGGCCGAGGCGGG - Intronic
1049918107 9:337905-337927 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051266019 9:15308973-15308995 CAGCACTGGGAGACTGAGGAAGG + Intergenic
1051310703 9:15767979-15768001 GCACATTGGGAGACCGAGGTGGG - Intronic
1052017353 9:23484533-23484555 CAACTTTGGGAGACCTAGGTAGG - Intergenic
1052290986 9:26840300-26840322 CAGCACTGGAAGGCCGAGGCGGG - Intergenic
1052291943 9:26852168-26852190 GAGCCCTGGGAGACTGAGGTGGG - Intronic
1052300153 9:26944879-26944901 CAACACTGGGAGGCCAAGGTGGG + Intronic
1052344084 9:27390667-27390689 CAGCAGTGAGAGACTAAGGGCGG + Intronic
1053167672 9:35856018-35856040 CTGAAGTGGGAGACGGAGCTGGG + Intergenic
1053202437 9:36161936-36161958 CAGCACTGGGAGACTGAGGCAGG + Intronic
1053344152 9:37365587-37365609 CAACACTGGGAGGCTGAGGTGGG + Intergenic
1053355905 9:37445394-37445416 GCGCTTTGGGAGACCGAGGTAGG + Intronic
1053690853 9:40586895-40586917 CGGCATTGGGGGACGGAGGTGGG + Intergenic
1053832781 9:42101810-42101832 CACCTTTGGGAGGCCGAGGTGGG + Intronic
1054273951 9:63050596-63050618 CGGCATTGGGGGACGGAGGTGGG - Intergenic
1054302111 9:63387866-63387888 CGGCATTGGGGGACGGAGGTGGG + Intergenic
1054351457 9:64020738-64020760 CAGCAGCGGAAGACCAAGGTAGG + Intergenic
1054400889 9:64714372-64714394 CGGCATTGGGGGACGGAGGTGGG + Intergenic
1054434495 9:65198686-65198708 CGGCATTGGGGGACGGAGGTGGG + Intergenic
1054495895 9:65822995-65823017 CGGCATTGGGGGACGGAGGTGGG - Intergenic
1054597772 9:67085600-67085622 CACCTTTGGGAGGCCGAGGTGGG - Intergenic
1055092519 9:72377467-72377489 AAGCTTTGGGAGACCGAGGCGGG + Intergenic
1055305585 9:74925969-74925991 GCGCTTTGGGAGACCGAGGTGGG + Intergenic
1056236936 9:84604043-84604065 CCACAGTGGGAGGCCGAGGCAGG - Intergenic
1056313173 9:85362838-85362860 GAACATTGGGAGGCCGAGGTGGG + Intergenic
1056544561 9:87602876-87602898 CCGCTTTGGGAGGCCGAGGTGGG - Intronic
1057228416 9:93304512-93304534 CCCCACAGGGAGACCGAGGTGGG + Intronic
1057475014 9:95391832-95391854 CAGCACTTGGAGGCCGAGGAGGG - Intergenic
1058063768 9:100526861-100526883 ATGCTTTGGGAGACCGAGGTGGG + Intronic
1058128444 9:101223064-101223086 GTGCTGTGGGAGACTGAGGTGGG + Intronic
1058244674 9:102607800-102607822 CAACACTGGGAGGCCGAGGGGGG - Intergenic
1058319895 9:103615778-103615800 TAGCAGTGGCAGACCCAAGTTGG + Intergenic
1058515282 9:105766045-105766067 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1058862161 9:109126976-109126998 CAGCACTGGGAGGCTGAGGCGGG + Intergenic
1058963535 9:110015350-110015372 CAACACTGGGAGGCCAAGGTGGG + Intronic
1058964146 9:110020859-110020881 AAGCACTGGGAGGCTGAGGTGGG + Intronic
1059171587 9:112130124-112130146 CAACACTGGGAGACCAAGGCAGG + Intronic
1059523824 9:114969930-114969952 CAGCATTGGGAGGCAGAGTTGGG + Intergenic
1059763828 9:117364363-117364385 CTGCAGTGGCAAACAGAGGTTGG - Intronic
1059766053 9:117385234-117385256 CCACTGTGGGAGACTGAGGTGGG - Intronic
1059777400 9:117489169-117489191 CAGCACTGGGAGGCTGAGGCAGG + Intergenic
1060400919 9:123349209-123349231 CAACACTGGGAGGCCAAGGTAGG + Intergenic
1060522070 9:124299621-124299643 GAGCGCTGGGAGACCCAGGTGGG + Intronic
1060635545 9:125197156-125197178 GAACTTTGGGAGACCGAGGTGGG + Intergenic
1060924832 9:127449071-127449093 CAGCACTGGGAGGCTGAGGCGGG - Intronic
1060981058 9:127792216-127792238 CAACACTGGGAGGCCAAGGTGGG + Intergenic
1060986218 9:127820439-127820461 CTGCAATGGGAGGCCGAGGCAGG - Intronic
1061395339 9:130340762-130340784 GAACTGTGGGAGGCCGAGGTGGG - Intronic
1061613356 9:131763083-131763105 GAACTTTGGGAGACCGAGGTAGG + Intergenic
1061695743 9:132372141-132372163 CAACACTGGGAGGCAGAGGTGGG + Intergenic
1061733587 9:132636401-132636423 CTGCAGTGGGAGATCCACGTAGG + Intronic
1061756743 9:132818734-132818756 CTTCAGTGGGAGGCCGAGGCGGG + Intronic
1061811004 9:133162883-133162905 CCGCAGTGGGTGACCGAGGGAGG - Intronic
1061933097 9:133843451-133843473 CAACACTGGGAGGCCAAGGTGGG - Intronic
1061998215 9:134199674-134199696 CAGCACTGGGAGGCCAAGGTGGG + Intergenic
1062329086 9:136028956-136028978 CACAAGAGGGAGGCCGAGGTGGG + Intronic
1062329421 9:136030907-136030929 CAGCACTGCGAGGCTGAGGTGGG - Intronic
1062676034 9:137744564-137744586 CAACACTGGGAGACTGAGGCGGG - Intronic
1203621509 Un_KI270749v1:133001-133023 CAGCATTGGGGGACGGAGGTGGG + Intergenic
1185515641 X:697081-697103 CAGCAAAGGGAGATAGAGGTGGG + Intergenic
1185519347 X:726269-726291 CAGCAATGGGAGAAAGATGTAGG - Intergenic
1185580461 X:1207894-1207916 CACCGTTGGGAGACCGAGGTGGG - Intronic
1185583609 X:1229028-1229050 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
1185630357 X:1512298-1512320 GCGCACTGGGAGGCCGAGGTGGG + Intronic
1185889177 X:3809245-3809267 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
1185907456 X:3949273-3949295 CAGCACTGGGAGGCTGAGGTTGG - Intergenic
1186129849 X:6454735-6454757 CAGGAGTGGGAGACCAACCTGGG + Intergenic
1186195715 X:7108799-7108821 CAACACTGGGAGACCGAGGCTGG - Intronic
1186443717 X:9607923-9607945 CACCTGTGGGAGGCTGAGGTGGG - Intronic
1186484672 X:9924900-9924922 GTGCTGTGGGAGGCCGAGGTGGG - Intronic
1186704098 X:12123852-12123874 CAGGAGTGGGAGACCAAGGTGGG - Intergenic
1186788714 X:12976119-12976141 CAGCAGTAGGAGAGCGAGAAGGG + Exonic
1187024501 X:15419948-15419970 CAACTTTGGGAGGCCGAGGTGGG + Intronic
1187115895 X:16350226-16350248 CAACACTGGGAGTCCGAGGCAGG - Intergenic
1187530151 X:20089027-20089049 TAGCACTGGGAGACCAAGGCGGG - Intronic
1187707257 X:22020983-22021005 CAGCTTTGGGAGGCCGAGGTGGG - Intergenic
1188249312 X:27873276-27873298 CAACTTTGGGAGGCCGAGGTGGG + Intergenic
1188250534 X:27888035-27888057 CAGAGTTGGGAGACCGAAGTGGG - Intergenic
1188271389 X:28145816-28145838 GAGCTTTGGGAGGCCGAGGTGGG - Intergenic
1188331846 X:28882394-28882416 CAGCTTTGGGAGGCTGAGGTGGG + Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188541422 X:31254791-31254813 GAGCTGTGGGAGGCCAAGGTGGG + Intronic
1188552369 X:31378051-31378073 CAGCAAAGGGAGACAGGGGTGGG - Intronic
1189413984 X:40798182-40798204 CAACACTGGGAGGCTGAGGTGGG + Intergenic
1189472937 X:41328213-41328235 CAGCTTTGGGAGGCCAAGGTGGG - Intergenic
1189785379 X:44554676-44554698 CAGCACTGGGAGGCAGAGGCGGG - Intergenic
1189824744 X:44906765-44906787 CAACACTGGGAGGCCGAGGTGGG - Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190080293 X:47351587-47351609 CAGCATTGGGAGGCCAAGGTGGG - Intergenic
1190094304 X:47466763-47466785 CACCTTTGGGAGGCCGAGGTGGG - Intronic
1190307986 X:49096982-49097004 GCACATTGGGAGACCGAGGTGGG - Intronic
1190319383 X:49171397-49171419 CAACACTGGGAGGCCGAGGCGGG - Intergenic
1190339155 X:49282693-49282715 CAGCAGGGGCAGAACGAGGGAGG + Intronic
1191244319 X:58213963-58213985 CAGCACTGGGAGGCTGAGGTGGG - Intergenic
1192034208 X:67545764-67545786 CAGCAGCGGGAGAGCGAGGGAGG + Exonic
1192122773 X:68472828-68472850 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
1192774059 X:74223531-74223553 CAGCACTTGGAGGCTGAGGTGGG - Intergenic
1192985745 X:76396666-76396688 CTGCTTTGGGAGACCAAGGTGGG + Intergenic
1194038511 X:88911227-88911249 GTGCTGTGGGAGACCAAGGTGGG + Intergenic
1194752656 X:97702079-97702101 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1195536550 X:106014306-106014328 CAGCAGTGGTGGACTGGGGTGGG + Intergenic
1195630162 X:107047503-107047525 CACCTGTGGGAGGCGGAGGTGGG - Intergenic
1196089387 X:111723516-111723538 CAACATTGGGAGGCCAAGGTGGG - Intronic
1196550546 X:117018524-117018546 GAGCTTTGGGAGGCCGAGGTAGG + Intergenic
1196606209 X:117660324-117660346 CAGCACTGGGAGGCTGAAGTGGG - Intergenic
1196819486 X:119691881-119691903 AAGGAGTGGGAGACAGAGGTAGG - Intronic
1196869922 X:120102991-120103013 CAGCACTGGGAGGCCAAGGTGGG - Intergenic
1196971416 X:121113044-121113066 CAGCACTTGGAGGCCGAGGCAGG - Intergenic
1197033909 X:121852198-121852220 TAGCAGTGGAAGACCTAGCTAGG + Intergenic
1197266819 X:124383191-124383213 CAGCATTGGGAGGCTGAGGCAGG - Intronic
1197840385 X:130740152-130740174 CAGCTTTGGGAGGCCGAGGTGGG + Intronic
1198035145 X:132794669-132794691 GAACTGTGGGAGGCCGAGGTGGG - Intronic
1198081574 X:133245108-133245130 CAACACTGGGAGGCCAAGGTGGG + Intergenic
1198210436 X:134510977-134510999 CAGCACTGGGAAGCCGAGGTGGG + Intronic
1198856676 X:141025052-141025074 CAACACTGGGAGGCCGACGTGGG + Intergenic
1198894742 X:141440993-141441015 CAGCTTTGGGAGGCTGAGGTGGG + Intergenic
1198906016 X:141562315-141562337 CAACACTGGGAGGCCGACGTGGG - Intergenic
1199982438 X:152928374-152928396 CAGGGGTGGGAGACCGGGGAAGG + Intronic
1200037184 X:153339423-153339445 CAGCATTCGGAGATTGAGGTGGG + Intronic
1200076822 X:153555294-153555316 CAGGAGTGGGAGCCAGGGGTAGG - Intronic
1200157309 X:153984110-153984132 CAGCACTGGGAGGCCGAAGCGGG - Intergenic
1200223398 X:154403264-154403286 CAGCACTGGCAGAGCAAGGTAGG - Exonic
1200400336 X:156016213-156016235 CAGCTTTGGGAGGCTGAGGTAGG + Intergenic
1201189556 Y:11435592-11435614 CGGCATTGGGGGACGGAGGTGGG + Intergenic
1201307751 Y:12565071-12565093 CAGCAAAGGGAGATAGAGGTGGG + Intergenic
1201549883 Y:15208798-15208820 GTGCACTGGGAGACTGAGGTGGG - Intergenic
1202028601 Y:20551023-20551045 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1202098345 Y:21278104-21278126 GCACACTGGGAGACCGAGGTGGG - Intergenic
1202241195 Y:22771537-22771559 AAGCTGTGGGAGACGGAGCTAGG - Intergenic
1202303920 Y:23447605-23447627 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
1202394181 Y:24405280-24405302 AAGCTGTGGGAGACGGAGCTAGG - Intergenic
1202476604 Y:25264812-25264834 AAGCTGTGGGAGACGGAGCTAGG + Intergenic
1202566890 Y:26222986-26223008 CAGCACTGGGAGGCTGAGGCGGG + Intergenic