ID: 1029298814

View in Genome Browser
Species Human (GRCh38)
Location 7:99562349-99562371
Sequence ACTCCTGAAATAACACATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 193}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029298814_1029298815 -8 Left 1029298814 7:99562349-99562371 CCAGGATGTGTTATTTCAGGAGT 0: 1
1: 0
2: 0
3: 10
4: 193
Right 1029298815 7:99562364-99562386 TCAGGAGTTTGTGACATTCGAGG 0: 1
1: 0
2: 3
3: 92
4: 4006
1029298814_1029298819 25 Left 1029298814 7:99562349-99562371 CCAGGATGTGTTATTTCAGGAGT 0: 1
1: 0
2: 0
3: 10
4: 193
Right 1029298819 7:99562397-99562419 GCACCTTACTCGAGAGGAATGGG 0: 1
1: 0
2: 0
3: 2
4: 39
1029298814_1029298818 24 Left 1029298814 7:99562349-99562371 CCAGGATGTGTTATTTCAGGAGT 0: 1
1: 0
2: 0
3: 10
4: 193
Right 1029298818 7:99562396-99562418 TGCACCTTACTCGAGAGGAATGG 0: 1
1: 1
2: 0
3: 2
4: 63
1029298814_1029298816 -2 Left 1029298814 7:99562349-99562371 CCAGGATGTGTTATTTCAGGAGT 0: 1
1: 0
2: 0
3: 10
4: 193
Right 1029298816 7:99562370-99562392 GTTTGTGACATTCGAGGATGTGG 0: 1
1: 0
2: 2
3: 19
4: 113
1029298814_1029298820 26 Left 1029298814 7:99562349-99562371 CCAGGATGTGTTATTTCAGGAGT 0: 1
1: 0
2: 0
3: 10
4: 193
Right 1029298820 7:99562398-99562420 CACCTTACTCGAGAGGAATGGGG 0: 1
1: 0
2: 1
3: 4
4: 71
1029298814_1029298817 19 Left 1029298814 7:99562349-99562371 CCAGGATGTGTTATTTCAGGAGT 0: 1
1: 0
2: 0
3: 10
4: 193
Right 1029298817 7:99562391-99562413 GGCTGTGCACCTTACTCGAGAGG 0: 1
1: 1
2: 1
3: 3
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029298814 Original CRISPR ACTCCTGAAATAACACATCC TGG (reversed) Intronic
900351650 1:2237916-2237938 ACTCCTTAAGTAACCCGTCCTGG - Intronic
900711794 1:4119155-4119177 GCTCTTGAAATAACTCAGCCTGG - Intergenic
902314998 1:15612079-15612101 ACTGCTGAAATAATACATTGAGG + Intergenic
903855006 1:26331906-26331928 AAACATGAAATAACACATGCAGG + Intronic
905102526 1:35537515-35537537 TCTGCTGAAATAACACTTCATGG - Intronic
906175649 1:43769707-43769729 ACTCCTGTAATTAGTCATCCGGG + Intronic
907695288 1:56720441-56720463 ACTAGTTAAATAACACATACAGG + Intronic
908093518 1:60712494-60712516 ACTACTGAAATAAAATATCAGGG + Intergenic
908869544 1:68593203-68593225 ACTCCTCAAATGAAACAACCTGG - Intergenic
909300745 1:74010292-74010314 ACTCCTGGAAAAGCGCATCCAGG - Intergenic
910980639 1:92957401-92957423 ACTTGGGAAATAACACTTCCTGG - Intronic
911503026 1:98712580-98712602 ATACCTGAAATAACAAAGCCTGG - Intronic
911960928 1:104301579-104301601 ACTCCTGAAGCCACACATCTCGG - Intergenic
919500607 1:198333372-198333394 ATTCCAGAAATAACAAATCTAGG + Intergenic
920722653 1:208402045-208402067 ACTCCTCAAATAAGAAATTCCGG - Intergenic
1064373964 10:14778963-14778985 ACCCGGGAAATAACAGATCCAGG - Intergenic
1071367562 10:84914967-84914989 ATTCATGAAATAACAAAGCCTGG + Intergenic
1075647185 10:124104353-124104375 ACACATGAAATAACAGAACCAGG + Intergenic
1077848097 11:6047015-6047037 ACTGCTGACACAACTCATCCTGG + Intergenic
1083505600 11:63154640-63154662 ACTGCTGAAATAAAACATTGGGG - Intronic
1086896563 11:92320023-92320045 ACTACTGCAATAACCCATCCTGG - Intergenic
1090460640 11:126888616-126888638 AATCCTGAAATGATACATCTTGG - Intronic
1092046689 12:5435936-5435958 ATTCCTGCAAAAACACATACTGG - Intronic
1092746261 12:11675150-11675172 ACATCTAAAAAAACACATCCTGG - Intronic
1093114597 12:15193857-15193879 ACTTAGGAAATAACACATCCAGG - Intronic
1095053552 12:37575568-37575590 ACCCCTGAAATGACAAACCCAGG - Intergenic
1095442191 12:42248524-42248546 AGTCCAGAAATAACAGATGCTGG - Intronic
1098659474 12:73074377-73074399 CCTACTGAATTAATACATCCAGG - Intergenic
1098682604 12:73376291-73376313 CCTCCTGAGATACCACAGCCTGG + Intergenic
1098695107 12:73542662-73542684 ACTCAAGAAATAACAGATGCTGG + Intergenic
1100943284 12:99748908-99748930 CCTACTGAATTAACAAATCCTGG + Intronic
1101608375 12:106267734-106267756 TCTCCTGAAATAGAACATGCTGG - Intronic
1103921563 12:124402107-124402129 ACTCCTGAGCTAATAAATCCAGG - Intronic
1104709627 12:130976529-130976551 ACTCATGTGATACCACATCCCGG + Intronic
1106755404 13:32818061-32818083 ACTCCTGGAAGAAAACATACGGG + Intergenic
1107051809 13:36058638-36058660 ACCCCTCAAATAGCAAATCCTGG - Intronic
1109017192 13:57031883-57031905 ACTCCTGAGATAACAAACCCAGG - Intergenic
1113400793 13:109991180-109991202 AATCCTGAATTAACTCACCCTGG - Intergenic
1115661742 14:35501807-35501829 ACTACTGAAATAAAACATTGGGG + Intergenic
1118526156 14:66646309-66646331 AATCCTGAAATAACAAATGTTGG + Intronic
1119908867 14:78331658-78331680 CCTCCTCAACTCACACATCCTGG - Intronic
1120053886 14:79899720-79899742 ACTCCTCATACAACACCTCCTGG + Intergenic
1120795714 14:88630924-88630946 ACTCCTGAAGTAGCACACTCCGG + Intronic
1122508122 14:102245131-102245153 ATTCATAAAAAAACACATCCAGG + Intronic
1123222992 14:106873811-106873833 ACTGCTGAATTAACAAAGCCTGG + Intergenic
1123786968 15:23684071-23684093 ACTCCAGAAATGAAACATCCTGG + Intergenic
1123980534 15:25597850-25597872 CCTCCTGAGATAACATATCTGGG + Intergenic
1124662056 15:31557907-31557929 ACTCCTGGGATGACACATCTGGG + Intronic
1125576642 15:40760318-40760340 GCTCCTGGAAGAACCCATCCAGG + Intergenic
1128243875 15:66119718-66119740 ACACCAAAAATAACACCTCCGGG + Intronic
1129693433 15:77726638-77726660 ACTCCTAAAATAAAACATAGGGG + Intronic
1133193541 16:4152166-4152188 ACCCCTGAAATAACTCATGCTGG - Intergenic
1134101792 16:11457632-11457654 GCCCCAGAAATAACACTTCCAGG + Intronic
1135850382 16:25957975-25957997 ACACCTGAAACAACCCTTCCTGG - Intronic
1136602024 16:31298635-31298657 AGTACTGAAATCCCACATCCTGG + Intronic
1141848571 16:86628259-86628281 CCTCATGAAATACCACAGCCTGG - Intergenic
1145283831 17:21488853-21488875 AAGCCTGAAAAACCACATCCGGG + Intergenic
1147801554 17:43093927-43093949 ACTCCTGAAATGATAAATCAGGG - Exonic
1149168733 17:53784271-53784293 AATCCTGAAAGAACAGATGCTGG + Intergenic
1149405462 17:56345545-56345567 AGTCCTGAAACAACAGATGCTGG - Intronic
1153040889 18:812255-812277 CCTCCTGAAGTAACGCGTCCCGG - Intronic
1153069309 18:1087693-1087715 AATCTTGAAAAAACAAATCCTGG - Intergenic
1153219581 18:2849680-2849702 ATTATTGAAATAAAACATCCAGG - Intronic
1158058293 18:53308678-53308700 ACTCCCTAAATAACACATTTAGG + Intronic
1158189896 18:54815235-54815257 ACTCCTGCAATAATACTTCATGG - Intronic
1158244779 18:55419891-55419913 ACACCTGAAACAAAACATCTGGG + Intronic
1158353892 18:56594758-56594780 ACTCCTGTAAGAAAACATACAGG - Intergenic
1159262091 18:66027209-66027231 TCTCCGGAAATGACACCTCCAGG + Intergenic
1161629818 19:5348140-5348162 ACCTCGGAAGTAACACATCCTGG + Intergenic
1162614800 19:11790029-11790051 ACTACTGAAATAAAACATTGAGG + Intergenic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
1167728066 19:51232610-51232632 TCTTCTGAAATAACACAGGCAGG - Intronic
1168186228 19:54701453-54701475 TCTCCTGAAATATCACCACCTGG + Intergenic
925568333 2:5281473-5281495 ACTCCTGGAATAAAACATAAGGG + Intergenic
926604559 2:14884405-14884427 ACTCATGAGAAAACACTTCCTGG + Intergenic
927333759 2:21896518-21896540 ACTCCAAACATAATACATCCTGG - Intergenic
930008174 2:46914731-46914753 ACACCTGAAATAACACATAAAGG + Intronic
930197984 2:48528594-48528616 GCGCCTGAAATCACACAGCCAGG - Intergenic
930345484 2:50175212-50175234 CCTCCTGAAATAAGACAACACGG + Intronic
931338646 2:61376468-61376490 ACTGCAGTAATAACACATTCAGG - Intronic
932482630 2:72055810-72055832 AGTCCAGAAATAACAGATGCTGG - Intergenic
933884223 2:86702810-86702832 TCTGCTGAAATAGCACCTCCAGG - Intronic
935464197 2:103376231-103376253 ACTCCTAAAATAAAACATGAGGG - Intergenic
935632182 2:105221261-105221283 ACTTCTGAAATAAGACTTGCAGG + Intergenic
935902963 2:107812149-107812171 TATCCTGAAATCACACTTCCTGG - Intergenic
936495002 2:113011234-113011256 ACTCCTGGAAGAACACATAGGGG + Intergenic
937356906 2:121203462-121203484 GCTCCAGAAATAACACATTTTGG + Intergenic
938235760 2:129705468-129705490 AATCCTAAAACAGCACATCCTGG - Intergenic
939386324 2:141503655-141503677 TCTTCTAAAATATCACATCCTGG + Intronic
941505599 2:166340147-166340169 AAGCCTCAAATAACACATCTTGG + Intronic
942199372 2:173555431-173555453 ACTACTTAAATAACACTTCATGG + Intergenic
942387161 2:175454656-175454678 ACTTCTGTGATAACACATACAGG - Intergenic
943391339 2:187272792-187272814 ACTCCTAAAAGAACACATGAAGG - Intergenic
943911906 2:193579877-193579899 ACTCCTAAAATAAAACATAGGGG + Intergenic
944996920 2:205304243-205304265 AGTCTTGTCATAACACATCCAGG - Intronic
947454172 2:230237927-230237949 ACTCCTGAAATAACCTGGCCAGG + Intronic
948607234 2:239143908-239143930 ACTCCTGAAATCACAGCACCAGG - Intronic
1170802635 20:19603062-19603084 AGTCCTGAAATCACACAGCGTGG + Intronic
1171528715 20:25836829-25836851 ACCCCTGAAATGACAAACCCAGG + Intronic
1171548111 20:26019057-26019079 ACCCCTGAAATGACAAACCCAGG - Intergenic
1173607733 20:44343533-44343555 GCCCCTGGGATAACACATCCTGG + Intronic
1175455760 20:59112425-59112447 CCTAATGAAATAACACATCTAGG + Intergenic
1177087177 21:16720599-16720621 ACTCAGGAAACAACACATGCTGG + Intergenic
1178168596 21:30011456-30011478 ATTCATTAAATAATACATCCTGG + Intergenic
1178796905 21:35753201-35753223 AATCCTGAAATTAGACCTCCAGG + Intronic
1183373384 22:37448384-37448406 ACTCTTGAAAAATCACATTCTGG + Intergenic
950827579 3:15841238-15841260 ACTACTGAAAGAAAACATCTGGG + Intronic
951342671 3:21508281-21508303 ACTTCTGAAAGGACAGATCCTGG + Intronic
952110169 3:30113711-30113733 TCTCCTGAAATCACACAGACAGG + Intergenic
952805281 3:37343925-37343947 ACTACTGAAGTAACAGATCAGGG - Intronic
955051089 3:55411723-55411745 ACTCCAGCAATCACACATCTTGG - Intergenic
956752058 3:72351327-72351349 ACTCCTGACCTAGCCCATCCCGG + Intergenic
960420460 3:117439000-117439022 ACTCCAGAAAAAGCACATACAGG + Intergenic
962977385 3:140457397-140457419 ACCCCTGGAATAACACAACATGG - Intronic
963034983 3:141018314-141018336 AGTCCAGAAACAACACATGCTGG + Intergenic
963389119 3:144634830-144634852 AATGATGAAATAAAACATCCTGG - Intergenic
963884446 3:150565339-150565361 ACTGATGAAATAATGCATCCAGG - Intronic
966283671 3:178267155-178267177 ACTCATGTAATAACACTGCCTGG + Intergenic
966986127 3:185181944-185181966 AGTCACGAAATAACTCATCCAGG + Intergenic
967560718 3:190916085-190916107 AGTCCAGAAATAACAGATGCTGG - Intergenic
968854176 4:3106468-3106490 ATTTCTGAAGCAACACATCCAGG + Intronic
970123609 4:12784605-12784627 ACTCTTGAAATAAGACATGTAGG - Intergenic
971971733 4:33630009-33630031 AGTCATGAAACAACACATGCTGG + Intergenic
973556339 4:52086918-52086940 AGTCAGGAAACAACACATCCTGG - Intronic
974677763 4:65116824-65116846 ACTACTAAAATAAAACATTCGGG + Intergenic
975108322 4:70595001-70595023 AGTGCATAAATAACACATCCTGG - Intronic
976439925 4:85061426-85061448 ACTCCTGTGATGACACAGCCTGG - Intergenic
977587958 4:98795775-98795797 GCTATTGAAATAGCACATCCTGG + Intergenic
979877698 4:125913991-125914013 AGTCCAGAAATAAAACATCATGG + Intergenic
980478443 4:133352234-133352256 ACTCCTGAAAAAAGACTTACAGG - Intergenic
981124555 4:141091014-141091036 ACACCTGGAATATCACATCTGGG + Intronic
981163244 4:141524226-141524248 ACTACTGAAAGAAAACATCAGGG + Intergenic
981718949 4:147779509-147779531 ACTCCTGAGATAATCCATCTGGG - Intronic
982103164 4:151988684-151988706 AATCATGCAATAACACATTCAGG - Intergenic
984460448 4:180029796-180029818 ACTCCTGAAATGTCATATCTAGG + Intergenic
985353806 4:189096181-189096203 ACTCAGGAAATCACACAGCCGGG - Intergenic
989634306 5:43517986-43518008 ACTCCAGAAACAACAGAGCCTGG + Intergenic
991299009 5:65109902-65109924 ACTCTTGGAATAAAACATACGGG - Intergenic
991344949 5:65654962-65654984 AATCGTGAAGTAACACATCCTGG + Intronic
993853031 5:93034997-93035019 ACTCCAGGAGCAACACATCCAGG - Intergenic
994094614 5:95837926-95837948 AAACATGAAATGACACATCCAGG + Intergenic
995640468 5:114251056-114251078 ATTCCTCTAATAACAGATCCTGG + Intergenic
1008091468 6:47297910-47297932 AATCCTGAAACAAACCATCCCGG + Intronic
1009794579 6:68450919-68450941 AGTCATGAAACAACAGATCCTGG - Intergenic
1010304551 6:74303964-74303986 AGTCAAGAAATAACAGATCCCGG + Intergenic
1011516250 6:88156944-88156966 GATACTGAAATAAGACATCCTGG - Intronic
1013623950 6:111918912-111918934 ACTCCTGGACTCACACATCTGGG - Intergenic
1014369132 6:120583334-120583356 CCTACTGAAATAAGACATGCAGG - Intergenic
1014538003 6:122639597-122639619 ACTCCTGATATAACACCTTTTGG - Intronic
1014605637 6:123470814-123470836 ACTACTGAAATAACCCAAGCTGG + Intronic
1014704820 6:124732669-124732691 AATCCTAAAATATCACAACCAGG - Intronic
1015221254 6:130806100-130806122 TCTCCTGTCACAACACATCCAGG + Intergenic
1016733555 6:147451851-147451873 ACTCCTGAGATAACAAGGCCAGG - Intergenic
1017628476 6:156372188-156372210 ACTCTTGAAATAACATTTTCTGG - Intergenic
1018642431 6:165917030-165917052 ACTGCTGAGATAACCAATCCTGG - Intronic
1021757577 7:23868689-23868711 AGTCCGGAAATAACAGATGCTGG - Intergenic
1022114794 7:27252133-27252155 TATCCTGAAATAACCCCTCCTGG + Intergenic
1024589701 7:50870738-50870760 ATTCCTGGAGTCACACATCCTGG + Intergenic
1027192335 7:76003995-76004017 TCTCCTGGAAAAAAACATCCAGG + Intronic
1027914973 7:84305827-84305849 ACTCATGAAAAATAACATCCAGG + Intronic
1028470066 7:91196261-91196283 ACTCTTGAAATCACCCATCATGG - Intronic
1028626629 7:92884994-92885016 ACTCCAGAAACAACAGATGCTGG - Intergenic
1029298814 7:99562349-99562371 ACTCCTGAAATAACACATCCTGG - Intronic
1029359084 7:100075258-100075280 GCTCCTGAAACAACACGTGCTGG + Exonic
1030104182 7:105972989-105973011 CCAACTGAAATAAAACATCCTGG + Intronic
1032513529 7:132490825-132490847 ACTTCTGAAATTATACTTCCTGG - Intronic
1034087670 7:148334847-148334869 CCTCCTGAAAAGACACAGCCAGG + Intronic
1036227423 8:6971457-6971479 TCTCCTGAAATAACACAGGAGGG - Intergenic
1038838538 8:31156973-31156995 ACACTTGAAATAACACATGGTGG - Intronic
1043191557 8:77228976-77228998 ACTCATGAAGTAACAGATCCAGG - Intergenic
1044187968 8:89279147-89279169 ACTCCTGAAATTTAACACCCTGG - Intergenic
1044854860 8:96465503-96465525 AATTCTGAAATAACACACTCAGG - Intergenic
1045580381 8:103472413-103472435 ACTACTGAAAGAAAACATACAGG - Intergenic
1045657842 8:104405540-104405562 ACTCCTGAAATAAAGCATCTTGG + Intronic
1047090859 8:121574176-121574198 ACTCATAAAATAACACAGTCAGG + Intergenic
1048685324 8:136898558-136898580 GCTCTTCAGATAACACATCCAGG - Intergenic
1050959471 9:11708701-11708723 ACTCCTGAAATCACACCTGAGGG + Intergenic
1052486249 9:29104138-29104160 ACACCTGAAATAACATACACTGG + Intergenic
1053796693 9:41733058-41733080 ACCCCTGAAATGACAAACCCAGG + Intergenic
1054185107 9:61945133-61945155 ACCCCTGAAATGACAAACCCAGG + Intergenic
1054468244 9:65512898-65512920 ACCCCTGAAATGACAAACCCAGG - Intergenic
1054653403 9:67643363-67643385 ACCCCTGAAATGACAAACCCAGG - Intergenic
1055883736 9:81033945-81033967 ACTCCTGTGATAAAACATGCAGG - Intergenic
1056343712 9:85667468-85667490 ACTAATGAAATAACAGATACAGG + Intronic
1059179951 9:112202191-112202213 ACTACTGAATTAACCAATCCTGG - Intergenic
1060560040 9:124535255-124535277 ATTACTGAGATAACGCATCCAGG - Intronic
1062587722 9:137256946-137256968 ACTCCTGAAGCAGTACATCCTGG + Exonic
1186026887 X:5323219-5323241 ACACCTGAAATACCACCTACAGG - Intergenic
1186252353 X:7681900-7681922 ACACAGGAAATAACACTTCCAGG + Intergenic
1186584310 X:10855960-10855982 AAGCTTGAAATAACACATCTTGG - Intergenic
1187984951 X:24800030-24800052 ACTCCTCATATAACTCATCCAGG - Intronic
1188251234 X:27897540-27897562 ACTCCTAAAATAAAACATTGGGG + Intergenic
1190254766 X:48754182-48754204 ACCCCTGAAATCACACATTGTGG - Intergenic
1193509522 X:82382626-82382648 ACTACGGAATTAACTCATCCTGG - Intergenic
1193634113 X:83927013-83927035 AGTCTGGAAATAACACATGCTGG - Intergenic
1194865871 X:99065907-99065929 ACTCCTGAAAGAAAACATTAGGG + Intergenic
1194922806 X:99788038-99788060 ATTCCAGAAATAACAGATGCTGG - Intergenic
1195353543 X:104016582-104016604 AGTCCAAAAATAACACATGCTGG - Intergenic
1196228357 X:113191891-113191913 ACTCATGAAAGAAAACATACCGG + Intergenic
1197997359 X:132392261-132392283 AATCCTTACATACCACATCCTGG - Exonic
1199245352 X:145598461-145598483 ACTCTTCAAATGAAACATCCAGG + Intergenic
1201183122 Y:11369491-11369513 AGCCCTGAAATGACACATTCTGG + Intergenic
1201360282 Y:13139316-13139338 TCTCCTGTAATAGCATATCCAGG + Intergenic
1201695524 Y:16819999-16820021 AGTCAGGAAATAACACATGCTGG - Intergenic