ID: 1029301425

View in Genome Browser
Species Human (GRCh38)
Location 7:99584757-99584779
Sequence GTGGACACCCCCTGCGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029301418_1029301425 13 Left 1029301418 7:99584721-99584743 CCTGGGTATTAGGAAGGAAGAAC 0: 1
1: 0
2: 0
3: 8
4: 151
Right 1029301425 7:99584757-99584779 GTGGACACCCCCTGCGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029301425 Original CRISPR GTGGACACCCCCTGCGATAT TGG Intronic
No off target data available for this crispr