ID: 1029303436

View in Genome Browser
Species Human (GRCh38)
Location 7:99601821-99601843
Sequence GGCTGCAGCAAGTGTCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029303427_1029303436 16 Left 1029303427 7:99601782-99601804 CCATAGCCATTGGTAGCTCTCAG 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1029303436 7:99601821-99601843 GGCTGCAGCAAGTGTCTGCATGG No data
1029303428_1029303436 10 Left 1029303428 7:99601788-99601810 CCATTGGTAGCTCTCAGAGACGC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1029303436 7:99601821-99601843 GGCTGCAGCAAGTGTCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029303436 Original CRISPR GGCTGCAGCAAGTGTCTGCA TGG Intronic
No off target data available for this crispr