ID: 1029306022

View in Genome Browser
Species Human (GRCh38)
Location 7:99620608-99620630
Sequence CAGGGTGACGAGAGTGTGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029306022_1029306027 26 Left 1029306022 7:99620608-99620630 CCGTGCACACTCTCGTCACCCTG 0: 1
1: 0
2: 0
3: 11
4: 184
Right 1029306027 7:99620657-99620679 AATTTTTTCCTACTCAACTCAGG 0: 1
1: 0
2: 0
3: 20
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029306022 Original CRISPR CAGGGTGACGAGAGTGTGCA CGG (reversed) Intronic
903670527 1:25032928-25032950 CAGGGAGACCAGAATGTGAATGG - Intergenic
905863012 1:41362832-41362854 CAGGGTGAGGAGTGTGACCATGG + Intronic
915320869 1:155055867-155055889 CAGGGGGAGGAGGATGTGCAGGG - Intronic
917217031 1:172689540-172689562 CTGGGTGACGATACTTTGCAGGG - Intergenic
920274865 1:204797069-204797091 CAGGCAAAAGAGAGTGTGCAAGG - Intergenic
922235201 1:223717511-223717533 CAGGCAGTCCAGAGTGTGCAGGG + Intronic
1062799871 10:371156-371178 CAGGGTGAGGGGATGGTGCAGGG - Intronic
1062799877 10:371174-371196 CAGGGTGAGGGGATGGTGCAGGG - Intronic
1062911600 10:1215661-1215683 CAGGACGACCAGAGTGTCCAAGG + Intronic
1063774428 10:9244982-9245004 CAAGGCAACCAGAGTGTGCAGGG + Intergenic
1066480120 10:35787447-35787469 AAGGTTGACGGTAGTGTGCAAGG - Intergenic
1068826664 10:61447840-61447862 CAGAGTGAGGGGGGTGTGCAGGG - Intronic
1069249947 10:66255562-66255584 CAGGATGAGGAGAGTGTGAGAGG - Intronic
1069995664 10:72340775-72340797 CAGGGTGATGTGAGTGAGGAGGG - Exonic
1070756950 10:78999205-78999227 CAGGCAGAGGAGAGTCTGCATGG - Intergenic
1071714815 10:88084976-88084998 TAGGGTGACTAGAGTGTGATGGG + Intergenic
1076385107 10:130050018-130050040 CAGGGCCTCGACAGTGTGCATGG + Intergenic
1077020149 11:413760-413782 CAGGCAGAGGAGAGGGTGCAGGG - Intronic
1077020198 11:413900-413922 CAGGCAGAAGAGAGGGTGCAGGG - Intronic
1077109362 11:855283-855305 CAGGGGGACGGGAGTGAGCGTGG + Intronic
1077379438 11:2222299-2222321 CAAGGTGGCTAGAGTTTGCAGGG + Intergenic
1077917041 11:6618198-6618220 CAGTGTGACACTAGTGTGCATGG - Intronic
1078328348 11:10398417-10398439 CAGGGAGGCCAGAGGGTGCATGG + Intronic
1084276286 11:68052649-68052671 CAGGGAAACCAGAGTGTGCTGGG + Intergenic
1084459159 11:69286643-69286665 CAGCGTGACGAGAGTGGGGATGG + Intergenic
1085313814 11:75531451-75531473 CAGTGAGAGGAGAGTGTGCAGGG + Intergenic
1088464459 11:110119565-110119587 CTGTGAGATGAGAGTGTGCATGG - Intronic
1088608858 11:111557912-111557934 CTGGGTGACGTGTGAGTGCACGG - Intronic
1088834299 11:113564773-113564795 CAGGCTGGCGAGACAGTGCATGG - Intergenic
1088871694 11:113895799-113895821 CTGGGTGAAGAGAGGGTGAACGG - Intergenic
1090620179 11:128553677-128553699 GAGGGTGGCGGGAGTGTGGAGGG - Intronic
1090836623 11:130458754-130458776 CAGGGAGCAGTGAGTGTGCAGGG + Intronic
1091709289 12:2726421-2726443 CAAGGTGATGAGGGTGTGGATGG + Intergenic
1095850473 12:46798311-46798333 TAAGGTGAGGAGAGTGTGGACGG - Intronic
1096547816 12:52353095-52353117 CAGGGAGAGGAGAGAGTGTACGG - Intergenic
1097182377 12:57178794-57178816 CAGGGGGAGGAGAGTGGGCGAGG + Intronic
1098771725 12:74560778-74560800 CAGGGAAAACAGAGTGTGCAGGG + Intergenic
1101906236 12:108828614-108828636 CAGGAAGACGAGACTGTGCCGGG + Intronic
1103442059 12:120970518-120970540 CAGGCTGACAAAAGTGGGCAGGG + Intergenic
1112201131 13:97276066-97276088 CAGGATGATGAGAGAGTGTATGG - Exonic
1112569827 13:100583951-100583973 CAGGGTGACCAGAAAGTCCATGG + Exonic
1114050853 14:18919104-18919126 GAGGGTGGCGAGAGGGAGCAGGG - Intergenic
1114111706 14:19482818-19482840 GAGGGTGGCGAGAGGGAGCAGGG + Intergenic
1114253591 14:20982607-20982629 CAGGGTCATGAGGGTGAGCAAGG - Intergenic
1114439017 14:22731295-22731317 CAGGCTGAGGAGAGTGTGACAGG - Intergenic
1114852369 14:26396624-26396646 CAAGGTGGCGAGATTGGGCATGG - Intergenic
1118508266 14:66440904-66440926 CAAGGTGGCTAGAGTTTGCAGGG - Intergenic
1118967379 14:70600707-70600729 CGGGTTGAAGAGAGTGCGCATGG + Intergenic
1119983269 14:79106263-79106285 CAGGATGAAGAGAGTCTGCTTGG + Intronic
1120693980 14:87623294-87623316 CTGGGTGACCAGAGTAGGCAAGG - Intergenic
1122027102 14:98886047-98886069 CAGGGTGACCACAGGCTGCAGGG + Intergenic
1123009485 14:105340854-105340876 CAGGGTGAAAGGAGTGGGCAGGG + Intronic
1123049656 14:105534842-105534864 CAGGGTGGCGGGGGTGGGCATGG - Intergenic
1124252282 15:28114653-28114675 CAGGGTGATGTGTGTGTGCTTGG + Exonic
1126369920 15:47934698-47934720 CAGGCTTAGGACAGTGTGCAAGG + Intergenic
1126797043 15:52267842-52267864 CAGGGAGATGAGGGTGGGCAGGG + Intronic
1126908127 15:53389397-53389419 CAGGCTGAGGAGAGAGTGGAAGG + Intergenic
1128791238 15:70435425-70435447 CAGGGTGACGAGGGTGGGAAAGG + Intergenic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1129668015 15:77590312-77590334 CAGGGAGAGAAGAGTGAGCAGGG + Intergenic
1130147229 15:81283196-81283218 CAGGGTTACAAATGTGTGCAGGG - Intronic
1130386300 15:83415147-83415169 GAGGGTGATGGGAGTGGGCAAGG - Intergenic
1131703361 15:94965246-94965268 CAGGGTTAAGAGAGTTTGAAAGG + Intergenic
1134664817 16:16011289-16011311 CAGGGTGAACAGTGTGTCCAGGG + Intronic
1140032710 16:71351155-71351177 CAGTGGGACGAGTGGGTGCATGG - Intergenic
1140508692 16:75491920-75491942 CCTGGTGTTGAGAGTGTGCATGG - Intronic
1142987382 17:3704348-3704370 CAGAGAGACAAGAGTGGGCAGGG + Intergenic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1144853146 17:18254187-18254209 CAGGGTGACGTGAGTGGTCAGGG + Intronic
1147364718 17:39952519-39952541 CCTGGTGAGGAGAGTCTGCACGG + Intergenic
1147386398 17:40084857-40084879 CAGGGAGAAGAGAGTGAGCTCGG + Intronic
1147442031 17:40453274-40453296 TAGGGTGACTACTGTGTGCAAGG + Intronic
1148857674 17:50587636-50587658 CAGGGAGACTAGAGAGAGCAAGG + Intronic
1149544057 17:57489937-57489959 GAGGGTGACGAGAGGGTGATTGG + Intronic
1152572006 17:81125040-81125062 CAGGGTGAGCAGGGTGAGCAGGG + Intronic
1152572008 17:81125049-81125071 CAGGGTGAGCAGGGTGTGCCGGG + Intronic
1156194916 18:34763735-34763757 CAGGGTGACTAGAATGTTTAAGG + Intronic
1157563791 18:48666194-48666216 AAGGGAGACAAGAGTGAGCAGGG - Intronic
1159166322 18:64705711-64705733 CAGGGTGACTAGAATCCGCAGGG + Intergenic
1159456782 18:68669366-68669388 CAGGGGGACCAGCGAGTGCAAGG + Intergenic
1162471070 19:10872128-10872150 CAAGGTGCCCAGAGTGAGCAAGG + Intronic
1162621598 19:11848441-11848463 CGGGGTCACAGGAGTGTGCAGGG - Intergenic
1162630658 19:11924794-11924816 CGGGGTCACAGGAGTGTGCAGGG - Intergenic
1162635530 19:11964721-11964743 CGGGGTCACAGGAGTGTGCAGGG - Intronic
1164648638 19:29876303-29876325 GAGGGTGAAGGGGGTGTGCAGGG + Intergenic
1166349031 19:42185609-42185631 CAGGGGGACAAGAGTGAGAAGGG - Intronic
1168314470 19:55478451-55478473 CTGGGTGACCAGAGTGACCAGGG + Intronic
928927970 2:36597865-36597887 CAGGGGGACGAGTGAGTGCGGGG - Exonic
930769823 2:55120104-55120126 CTGGGTGTCCAGAGTGGGCATGG - Intergenic
931058867 2:58503919-58503941 CAGGGTGAGCAGGGTGAGCAGGG + Intergenic
931780671 2:65576943-65576965 CAGGGTGTGGAGAGTTTACAAGG - Intergenic
932716683 2:74105584-74105606 CAAGGTGACGATGGTGTGCGTGG + Exonic
935187604 2:100748143-100748165 CAGGGGGAGGAGAGGGTGCTGGG + Intergenic
935378193 2:102421919-102421941 GAGAGTGAGGAGAGGGTGCATGG - Intronic
938287609 2:130130328-130130350 GAGGGTGACGAGAGGGAGCAGGG + Intergenic
938427985 2:131208531-131208553 GAGGGTGACGAGAGGGAGCAGGG - Intronic
938468895 2:131542543-131542565 GAGGGTGATGAGAGGGAGCAGGG - Intergenic
939166134 2:138643154-138643176 GAGGGTGATGAGAATGTGCTGGG - Intergenic
942237831 2:173929590-173929612 CAGGCTGAACAGATTGTGCAAGG + Intronic
942413219 2:175733284-175733306 CAGGGAGGCGAAGGTGTGCAAGG - Intergenic
947923356 2:233898811-233898833 CAGGCTGAAGGGAGTGTGCCAGG + Intergenic
1169197062 20:3689026-3689048 GAGGTTGGGGAGAGTGTGCAGGG - Intronic
1170931550 20:20773406-20773428 CAGGGTGGAGAGAGTGGGGAAGG - Intergenic
1171882905 20:30631351-30631373 CTGGGAGAAGAGAGAGTGCAGGG + Intergenic
1171942778 20:31347907-31347929 CATGGTGCAGAGAGTGTGCTTGG + Intergenic
1173176361 20:40767767-40767789 CAGGGTGGAGAGGGTCTGCAGGG - Intergenic
1177169608 21:17640715-17640737 CAGGGTCCCGAGGCTGTGCAGGG + Intergenic
1178567808 21:33704373-33704395 CAGGGTGAAGCGTGGGTGCAGGG - Intronic
1179893732 21:44350382-44350404 CGGGGTGCCGAGTGCGTGCAGGG + Intronic
1179960213 21:44763822-44763844 CAGGGTGTCCCGGGTGTGCAGGG - Intergenic
1180469330 22:15641479-15641501 GAGGGTGGCGAGAGGGAGCAGGG - Intergenic
1182654009 22:31875229-31875251 CAGGGAGACGAGAGTGTATACGG - Intronic
1182711791 22:32327840-32327862 CAGAGTGCAGAGGGTGTGCAGGG - Intergenic
1183369439 22:37424189-37424211 AAGGGTGACAACCGTGTGCAGGG - Intronic
1183404138 22:37621832-37621854 CTGGGGGACCAGGGTGTGCAGGG + Intronic
1183862297 22:40679026-40679048 GAGGGTGCCCTGAGTGTGCATGG + Exonic
1185337418 22:50276789-50276811 CAGGGGGTCGAGGGTGGGCATGG + Intronic
952680184 3:36082919-36082941 CAGGGTGAGGCGATAGTGCAAGG + Intergenic
954874967 3:53796218-53796240 CAGCGAGACGACTGTGTGCAGGG + Intronic
955525033 3:59811155-59811177 GAGGGTGACATAAGTGTGCAAGG - Intronic
962487872 3:135862604-135862626 CAGAGTGACTAGAGAATGCATGG - Intergenic
962845198 3:139267699-139267721 CATAGTGAGGAGAGTGGGCAGGG + Intronic
963177196 3:142312217-142312239 CAGGGAGTCGAGATTGTGCATGG + Intronic
966967533 3:185009842-185009864 CAAGGTGGCTAGAGTTTGCAGGG + Intronic
968520284 4:1031988-1032010 CAGGGCCAAGAGAGTGGGCACGG + Intergenic
968789592 4:2650438-2650460 CCCGGTGACGAGAGTGAGCCGGG - Intronic
970208746 4:13684507-13684529 AAGGTTGAAAAGAGTGTGCATGG + Intergenic
970635978 4:18009842-18009864 TAGGGTGAGGAGGGTGTCCATGG - Intronic
975147065 4:70980152-70980174 CAGTGTGAGGAGTGTGTACAGGG - Intronic
975828687 4:78346626-78346648 GAGAGTGAAGAGAGTGTGTAGGG - Intronic
977040778 4:92014803-92014825 CAGCTTGACAATAGTGTGCAAGG + Intergenic
977378293 4:96237266-96237288 CAGTGTGCCGAGGCTGTGCAGGG - Intergenic
977554914 4:98478625-98478647 CATCATGCCGAGAGTGTGCATGG - Intronic
981422545 4:144567660-144567682 CAGGCAAAAGAGAGTGTGCAGGG - Intergenic
984153458 4:176164029-176164051 CAGGGTGGTGTGTGTGTGCATGG - Intronic
985132875 4:186756907-186756929 CAGGGTGAAGAGGGTGTTCCAGG - Intergenic
1202764097 4_GL000008v2_random:136292-136314 CAGGGAGAAGAGGGAGTGCAGGG + Intergenic
985870950 5:2556467-2556489 CATGGTGGTGAGAGTGAGCAGGG + Intergenic
986133168 5:4949293-4949315 AAGGGTTACGAGAGTTTGCAGGG + Intergenic
986471528 5:8081298-8081320 CAGAGTGCACAGAGTGTGCAGGG + Intergenic
997491109 5:134276914-134276936 CAAGGTGACCAGAATTTGCAAGG - Intergenic
998446252 5:142200623-142200645 GTGGGAGAGGAGAGTGTGCATGG + Intergenic
1000016818 5:157285360-157285382 CAGGGTGACGTGCGTGGTCATGG - Exonic
1004217925 6:13719419-13719441 CAGGGTGAAAAGGGTCTGCAGGG + Intergenic
1004409590 6:15368450-15368472 CAGTGTCATGAGACTGTGCATGG + Intronic
1005481593 6:26260136-26260158 GAGGGTGAGGAGTATGTGCAAGG + Intergenic
1005592157 6:27339952-27339974 GGGAGTGAAGAGAGTGTGCAAGG - Intergenic
1006844779 6:37054691-37054713 CAGGGAGCTGAGAGGGTGCAGGG - Intergenic
1007513576 6:42393524-42393546 AAAGGTCACGGGAGTGTGCAAGG + Intronic
1008485722 6:52033326-52033348 CAGGATGGGGAGAGTGTGCAGGG - Intronic
1008925483 6:56887869-56887891 CAGGGGCACAAGAATGTGCAAGG - Intronic
1013569735 6:111409962-111409984 CATGGTGAGCAAAGTGTGCATGG - Intronic
1014992728 6:128102624-128102646 CAGGTGGAAGAAAGTGTGCATGG + Intronic
1016502211 6:144734466-144734488 CAGGGTGACGGGAGGGGGCAGGG - Intronic
1019427616 7:984810-984832 CAGGGGGACGGGAGTGGGGATGG + Intronic
1021772150 7:24015462-24015484 AAGGGTGCCAAGAATGTGCAAGG + Intergenic
1024464767 7:49700597-49700619 CAGGATGCTGAGGGTGTGCACGG + Intergenic
1027809291 7:82873299-82873321 GAGGATGACGGGAGTGTGGATGG - Intronic
1027971334 7:85085627-85085649 CAGAGTGACAAGAGAGTACACGG + Intronic
1029306022 7:99620608-99620630 CAGGGTGACGAGAGTGTGCACGG - Intronic
1032491584 7:132328241-132328263 CAGGCTGACGAGGATGTGCCTGG - Intronic
1034468809 7:151245205-151245227 AAGGGTGAGGGGAGCGTGCAGGG + Intronic
1034995948 7:155577441-155577463 CAGCATGACGAGGCTGTGCAGGG + Intergenic
1035583786 8:756740-756762 CAGGGTGAGGAGGGTGTGGCTGG - Intergenic
1037905643 8:22714574-22714596 CAGGGTGGAGAGAGAGTGCCTGG + Intronic
1037911692 8:22747567-22747589 CAGGGTGAGTGGGGTGTGCATGG + Intronic
1038181507 8:25233068-25233090 CAAGGTGGCTAGAATGTGCAGGG - Intronic
1039829624 8:41202444-41202466 CAGAGTGACGAGAATGTGGGTGG + Intergenic
1040605141 8:48924071-48924093 CAGGGTGAAGCCAGTGGGCACGG + Intergenic
1043784205 8:84376699-84376721 CAGGGTCAAGAGAATCTGCAGGG - Intronic
1045268060 8:100637550-100637572 CAGGGTGATGGTAGTGGGCATGG - Intronic
1047914441 8:129566484-129566506 CAGGGTGATGAGGGTGAGCCAGG + Intergenic
1049747784 8:144270279-144270301 CAGGGTCAAGAGGGAGTGCAGGG + Intronic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1051392665 9:16582501-16582523 CAGGTGGACGAGAGAGTGAACGG - Intronic
1055416516 9:76090214-76090236 CAGGGAGAAGGGAGGGTGCATGG - Intronic
1056826053 9:89877120-89877142 CAGGCTGAGGATGGTGTGCAGGG + Intergenic
1057379606 9:94555834-94555856 GAGGGTGGCGAGAGGGAGCAGGG + Intergenic
1059438202 9:114288911-114288933 CAGGGACAGGAGGGTGTGCAAGG + Exonic
1060280510 9:122213005-122213027 CAGTGTGATGGGAGTGTCCAGGG - Intronic
1060289193 9:122284733-122284755 CAATGTGACAAGAGTGTACAAGG - Intronic
1060438089 9:123613114-123613136 CCGGGAGACAAGAGTGTGCTTGG - Intronic
1185554850 X:1013107-1013129 CAGCGGGACGTGAGTGTGGATGG + Intergenic
1186145008 X:6615950-6615972 CAGGAGGAAGAGAGTGTGAAGGG - Intergenic
1186156645 X:6733043-6733065 CAGGGTGATGAGAAGGGGCATGG + Intergenic
1189693233 X:43638292-43638314 CAGGCTGAGGAGAGTGTGATAGG + Intergenic
1190076711 X:47322366-47322388 CAGCCTGAGGAGAGTGTGTAGGG - Intergenic
1191193509 X:57693387-57693409 GAGGGTGTTGAGAGAGTGCATGG + Intergenic
1191223593 X:58016647-58016669 CAGGCTCAAGAGAGTCTGCAGGG + Intergenic
1196541010 X:116908320-116908342 CAGAGTCAAGAGTGTGTGCAAGG + Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200182462 X:154159093-154159115 CTGGGTCTCGAGAGGGTGCAAGG + Intergenic
1200188116 X:154196207-154196229 CTGGGTCTCGAGAGGGTGCAAGG + Intergenic
1200193766 X:154233347-154233369 CTGGGTCTCGAGAGGGTGCAAGG + Intergenic
1200199521 X:154271151-154271173 CTGGGTCTCGAGAGGGTGCAAGG + Exonic