ID: 1029306958

View in Genome Browser
Species Human (GRCh38)
Location 7:99626579-99626601
Sequence TAGGATCCTGGCTAAGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029306952_1029306958 20 Left 1029306952 7:99626536-99626558 CCAGAGGGGAGGAAAGAGAAGAG 0: 1
1: 0
2: 16
3: 86
4: 679
Right 1029306958 7:99626579-99626601 TAGGATCCTGGCTAAGGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029306958 Original CRISPR TAGGATCCTGGCTAAGGGCC TGG Intronic
902380415 1:16049918-16049940 TAGGCTCCGGGCTAAGGGCTGGG + Intronic
904520194 1:31089173-31089195 TAAGATGCAGACTAAGGGCCTGG - Intergenic
906024991 1:42665823-42665845 TTGGATCCTAGCTTAGGCCCTGG + Intronic
909391297 1:75125181-75125203 GAGGAGCCTGTCTCAGGGCCTGG + Intergenic
911163845 1:94708349-94708371 TAGGATGTCTGCTAAGGGCCTGG - Intergenic
913109280 1:115642582-115642604 CCGGTTCCTGGCGAAGGGCCAGG - Intronic
913246077 1:116871204-116871226 CAGGATGCTGGCTACTGGCCAGG + Intergenic
916992749 1:170262195-170262217 TAGAGTCCTGGCTAGGAGCCAGG + Intergenic
917647899 1:177047045-177047067 CCGGATCCTAGCCAAGGGCCTGG - Intronic
918182099 1:182093091-182093113 TAGGATGCTGTCTAAGCACCAGG + Intergenic
922814841 1:228441249-228441271 TAGAATCCTGACTTTGGGCCTGG + Intergenic
923658506 1:235938936-235938958 CAGGATCTAGGCTAAGGGCTTGG - Intergenic
924829499 1:247578341-247578363 GAGGGCCCTGGCAAAGGGCCTGG - Intergenic
1067098781 10:43319757-43319779 TGGGATCCTGGCCAAGGGGGTGG + Intergenic
1068795838 10:61079106-61079128 TGGGAGCCTAGCTAAGAGCCAGG + Intergenic
1068896983 10:62215435-62215457 TAGGATCCTTGATGAGGTCCTGG + Intronic
1069751875 10:70750087-70750109 TAGGAGCCTGGGCAAGGGCAAGG + Intronic
1070712227 10:78691137-78691159 TGTGCTCCTGGCTCAGGGCCTGG + Intergenic
1071351732 10:84753221-84753243 TAGCATAGTGTCTAAGGGCCTGG - Intergenic
1073468644 10:103709125-103709147 TAGGAGCCTGGCTGATGGACAGG - Intronic
1074678679 10:115881323-115881345 AAGACTCCTGGCTAAGGGCTGGG - Intronic
1075002335 10:118808082-118808104 TGGGAGCCTTGCTAAGGGCCAGG - Intergenic
1075697886 10:124449376-124449398 TAGGACCTGGGCTAAGGGCTGGG - Intronic
1077061494 11:619689-619711 GAGGATCCAGGCTCAGGACCCGG - Exonic
1078715418 11:13834684-13834706 CAGGACCCTGGCTAAGGGAATGG + Intergenic
1080056564 11:27912713-27912735 TAGGATCCTAACTTAGGTCCCGG - Intergenic
1080522260 11:33077560-33077582 TAGGATTATTACTAAGGGCCAGG + Intronic
1081912780 11:46710824-46710846 TAGAATCCTGGCTTTTGGCCGGG - Intergenic
1083418115 11:62538301-62538323 TAAGGGCCTGGCTCAGGGCCTGG - Intronic
1084094966 11:66905295-66905317 TGGCACCCTTGCTAAGGGCCAGG - Intronic
1084591336 11:70092447-70092469 CAGGGTCATGGCTGAGGGCCAGG + Intronic
1086320620 11:85643441-85643463 TAGGAATTTGGCTCAGGGCCAGG + Intergenic
1090907312 11:131088187-131088209 TAGGATCTTGGCCAAGGTCAAGG + Intergenic
1091653937 12:2330579-2330601 TAGCATCCTGGCTAAGCACTTGG - Intronic
1091718866 12:2797888-2797910 TGAGATCCAGGCTAAGAGCCAGG + Intronic
1092070246 12:5626162-5626184 TAGGAATCTCGCTGAGGGCCAGG + Intronic
1092964098 12:13625064-13625086 TAGGGACCAGGCTGAGGGCCAGG + Intronic
1093870966 12:24290405-24290427 TAGGCTCCTGACAAAGTGCCTGG - Intergenic
1094503382 12:31039562-31039584 TAGGATACTGGGTTAGGGCAAGG + Intergenic
1100017035 12:90023767-90023789 TATCATCCTGGCTTAGGGGCAGG - Intergenic
1100689981 12:97029400-97029422 TAGGCATCTCGCTAAGGGCCGGG + Intergenic
1101974723 12:109347150-109347172 CAGGATCATGGCTAAGGGTATGG - Intergenic
1102542957 12:113635511-113635533 TAGGAGCCCGACTTAGGGCCGGG + Intergenic
1103918518 12:124387997-124388019 TAGGAGCCTGGCTGGGGGCTGGG + Intronic
1105291255 13:19055180-19055202 TTGGATCCTGGCTCAGGGCAGGG + Intergenic
1107418785 13:40225915-40225937 TAGGATCCTGGCGCAGGATCTGG + Intergenic
1115069265 14:29301566-29301588 TGGAATCCTGGATAAGGTCCAGG - Intergenic
1118918829 14:70131390-70131412 TAGGTTCCAGGCTGTGGGCCTGG + Intronic
1119828274 14:77676525-77676547 TAGTATCCTGGATAAGATCCTGG + Intronic
1121553540 14:94819853-94819875 CAGGCTGCTGGCTGAGGGCCAGG - Intergenic
1126978752 15:54217267-54217289 TAGGATTGTGGATAAGGGCAAGG + Intronic
1127870191 15:63066004-63066026 TAGCATCCTGCCTTAGAGCCAGG + Intronic
1128866830 15:71120584-71120606 TAGGCAGCTGGCCAAGGGCCAGG - Intronic
1129102212 15:73275921-73275943 TTGGATCTTGGCTAATGGCAAGG + Intronic
1133356220 16:5138917-5138939 GAGGATCATTGCTCAGGGCCTGG - Intergenic
1134023547 16:10938277-10938299 TAGGGTCATGGTTAAGAGCCAGG - Intronic
1134399799 16:13899406-13899428 CAAGATCCTGGCTGTGGGCCAGG + Intergenic
1136346370 16:29678897-29678919 TTGGACCCTGGGTTAGGGCCAGG + Intronic
1136366890 16:29813109-29813131 AAGGTTCCAGGCGAAGGGCCTGG + Exonic
1139908155 16:70380776-70380798 AAGGAGGCTGGCTATGGGCCCGG - Exonic
1141766046 16:86060664-86060686 TGGGCTGCAGGCTAAGGGCCAGG + Intergenic
1144039193 17:11393342-11393364 TAGGATCCTGGCTAAGAAGGGGG - Intronic
1145122650 17:20274344-20274366 CAGGACCCTGGCTGAGGCCCAGG - Intronic
1146307930 17:31745067-31745089 TAAGATCCTGCCAAAAGGCCAGG + Intergenic
1146680829 17:34806817-34806839 TAGCATCATGGCTAAGGGCATGG - Intergenic
1148047563 17:44753439-44753461 TGGGGTCCTGGGCAAGGGCCAGG + Intergenic
1148879992 17:50718382-50718404 TAGCATCGTGGCTGGGGGCCGGG + Intergenic
1151680293 17:75619508-75619530 CAGGATCCAGGCTGGGGGCCTGG - Intergenic
1152209750 17:78996815-78996837 TATGCTCCTGGCTAAGGGTAAGG + Intronic
1152231607 17:79116811-79116833 TGGGGTCCTGCCCAAGGGCCTGG - Intronic
1152389505 17:79994265-79994287 TAGAATCCCAGCTCAGGGCCGGG + Intronic
1152448626 17:80361897-80361919 TTAGATACTGGCTAAGGGTCAGG + Intronic
1156313880 18:35950007-35950029 CAGGATCCAGGCGATGGGCCTGG - Intergenic
1158519519 18:58159577-58159599 TAGGATCCTGTCTCAGGACTGGG + Intronic
1161357786 19:3828661-3828683 CAGGATTCTGCCTAAGGGCTTGG - Intronic
1161518118 19:4708191-4708213 AAGGATTTTGGCTCAGGGCCTGG - Intronic
1161560923 19:4972024-4972046 TAGGCTCCTGGCTCAGCTCCAGG + Intronic
1162003525 19:7763333-7763355 TGGGATCCTGGGTAAGGGGAAGG + Intronic
1162043203 19:7982727-7982749 TGGGATCCTGGATGAGGTCCTGG - Intronic
1163622559 19:18369561-18369583 TCTGAGCCTGGCTGAGGGCCGGG + Exonic
1165300107 19:34963454-34963476 TAGGATCCTGAATCAGGGCAGGG - Intronic
1168691824 19:58381983-58382005 TAGGAGCCGGACTAGGGGCCTGG - Intergenic
926109450 2:10172689-10172711 TAGAATCCTGGCGAAGGGAGGGG + Intronic
931171135 2:59804828-59804850 AAGGATCCTGGCCAAATGCCAGG + Intergenic
931262674 2:60633835-60633857 TTGGATTATGGCTTAGGGCCTGG + Intergenic
934949573 2:98567196-98567218 TGGGAACCTGGATCAGGGCCAGG + Intronic
935311277 2:101786183-101786205 TAGGCTCCTCTCTATGGGCCAGG + Intronic
937215940 2:120313752-120313774 TGGGATTCCGGCTAAGGGCTGGG - Intergenic
938071219 2:128309450-128309472 TGGGATCCTGGACAAGGACCAGG + Intronic
940255120 2:151720291-151720313 TAGATTTCTGGCTAAGGGCTTGG - Intronic
943151403 2:184118189-184118211 AAGGAACTTGGCTCAGGGCCAGG - Intergenic
944239215 2:197469500-197469522 ATGGATCAGGGCTAAGGGCCAGG + Intronic
944326458 2:198410756-198410778 CAGGGTCCTTGCTAAAGGCCGGG + Intronic
947046809 2:225996354-225996376 AACGATCCTGACTGAGGGCCAGG - Intergenic
948728132 2:239947084-239947106 TGGGATCCTGGGTAAGGAGCTGG + Intronic
1170599172 20:17828078-17828100 CAGGACCCTGGCTGATGGCCAGG + Intergenic
1172108886 20:32533859-32533881 CAGGAGCCTGTCTAATGGCCTGG - Intronic
1172381459 20:34496508-34496530 TAAAATCTTGGCTCAGGGCCAGG + Intronic
1172756478 20:37288815-37288837 TAGGCTCCTAGCTCAGGACCTGG + Intergenic
1174894863 20:54437453-54437475 GAGAATCCTGGCTAAGAGTCTGG - Intergenic
1179189840 21:39114455-39114477 TAGGTTTCTAGATAAGGGCCCGG + Intergenic
1183321064 22:37165463-37165485 TATTATCCTGGCTCAGGGCTGGG + Intronic
1184262818 22:43329130-43329152 CAGGGTCCAGGCTAAGGGCAAGG - Intronic
1184554740 22:45227057-45227079 CTGGCTCCTGGCTCAGGGCCCGG - Intronic
1184912138 22:47543211-47543233 GAGAATCCAGGCTCAGGGCCGGG - Intergenic
1185091674 22:48779021-48779043 TAGGTTCCTGGCTCAGGGAGCGG - Intronic
951763658 3:26172656-26172678 TAGGATCCTAGATTAGAGCCTGG - Intergenic
952010180 3:28891736-28891758 TAGCATGCTGGCTAAGGGCTAGG - Intergenic
953162159 3:40431018-40431040 TAGGATACTGGGTAAGGGAAGGG + Intergenic
953974476 3:47371688-47371710 TAGGATCCTGGCTGGTGGCTGGG + Intergenic
956588009 3:70884418-70884440 TGGGCTCCTGGTTATGGGCCAGG + Intergenic
956890432 3:73607818-73607840 TAGGCTGTTTGCTAAGGGCCAGG - Intronic
957491214 3:80929833-80929855 TAGCATATTGGCTAAGGGCTAGG - Intergenic
969145993 4:5124495-5124517 TTTGTTCCTGGCTCAGGGCCTGG + Intronic
969597675 4:8158317-8158339 TGGGGTCCGGGCGAAGGGCCGGG - Intronic
975213800 4:71731085-71731107 CTGCAGCCTGGCTAAGGGCCAGG - Intergenic
976077807 4:81319548-81319570 TACCAGCCTGGCTAAGGCCCTGG - Intergenic
981638878 4:146912606-146912628 GAGGATCAAGGCTCAGGGCCAGG + Intronic
990674982 5:58173928-58173950 TAGGATCGTGGATCAGGGCTGGG - Intergenic
991436183 5:66598260-66598282 AAGGATCCTGGATAAGGGTCTGG + Intronic
992996574 5:82339826-82339848 AAGGAGCCTGGACAAGGGCCTGG + Intronic
995156670 5:108922571-108922593 TATGAGCCTGGGTAAGTGCCTGG + Intronic
998172928 5:139883020-139883042 CTGGGTCCTGGCTAAGGGGCAGG + Intronic
1002131728 5:177086552-177086574 TAGGAGCCTGGCCTGGGGCCTGG + Intergenic
1003420876 6:5957549-5957571 TGGGATCCTGGATAAGATCCCGG + Intergenic
1004399306 6:15273793-15273815 TAGGATCCTGACTCAAAGCCAGG - Intronic
1006253556 6:32811350-32811372 AAGGAACCTGGCTCAGGGCTGGG - Intergenic
1006509063 6:34511985-34512007 CAGGAACATGGCTAAGGTCCAGG + Intronic
1006589491 6:35143733-35143755 GAGGACCCTGGCTAAAGGCTGGG - Intronic
1006788700 6:36684751-36684773 TAGAAGCTTGGCAAAGGGCCTGG - Intronic
1010444446 6:75934955-75934977 TTGGATCCTGTCCAAGGGCAAGG + Intronic
1011143506 6:84188048-84188070 TATGATCTTTGCTAAGGGACTGG - Intronic
1014047768 6:116912979-116913001 GAGGAGCCTGGCTAATGGCAAGG - Intronic
1017643372 6:156515806-156515828 GAGAATCCTGGCTAAGAGCTAGG - Intergenic
1019537282 7:1535849-1535871 CAGGATCCAGACTGAGGGCCTGG - Intronic
1022054125 7:26711669-26711691 TGGGACCATGGCTCAGGGCCTGG + Intronic
1024573171 7:50742424-50742446 TAGGATCCTGGTTAAGAGCATGG - Intronic
1024610942 7:51063587-51063609 TAGGAGGCAGGCTGAGGGCCAGG + Intronic
1025941386 7:66078182-66078204 CAGGCTCCTGGCTGAGGGGCAGG + Intronic
1026022704 7:66722143-66722165 TAGGACCCTGTCTCAGGGGCTGG + Intronic
1027656372 7:80935562-80935584 TAGGATTCGGTCAAAGGGCCAGG + Intergenic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1028829368 7:95310661-95310683 CAGGTACCTAGCTAAGGGCCTGG - Intronic
1029184037 7:98725846-98725868 TTGGTGCCTGGCTCAGGGCCTGG - Intergenic
1029306958 7:99626579-99626601 TAGGATCCTGGCTAAGGGCCTGG + Intronic
1033176507 7:139128708-139128730 TAGGATCCTGGTTAAGGTCGGGG - Intergenic
1034232790 7:149545895-149545917 TAGGATGTTGGCCAAGGGCCAGG + Intergenic
1036620954 8:10424414-10424436 TAGGATCGGGGAGAAGGGCCTGG + Intronic
1036620984 8:10424502-10424524 TAGGATCGGGGAGAAGGGCCTGG + Intronic
1037601182 8:20395438-20395460 TAAGATCTTGGCTAAGGGCAAGG + Intergenic
1037677801 8:21066868-21066890 CAGTGTGCTGGCTAAGGGCCTGG - Intergenic
1041962538 8:63635419-63635441 TGGGATCCTGGATAAGATCCTGG - Intergenic
1049698947 8:143998274-143998296 TAGGTTCCTAGCTGAGAGCCTGG - Intronic
1057229133 9:93308351-93308373 TGGGGGCCTGGCTCAGGGCCTGG - Exonic
1057996703 9:99825691-99825713 AAGGGTCCAGGCTCAGGGCCCGG - Exonic
1058167482 9:101636363-101636385 TAAGATCCTGGCACAGTGCCTGG - Intronic
1060199077 9:121641326-121641348 TAGGATGCTAGCTATGGGCTAGG + Intronic
1060301344 9:122376165-122376187 CAGGATCCAGGGAAAGGGCCTGG - Intronic
1060528669 9:124334778-124334800 GAGGACCCGGGCTGAGGGCCAGG + Intronic
1060540482 9:124426808-124426830 AAGGGTTCTGGCTAAGGGCAGGG - Intergenic
1061361426 9:130144787-130144809 AAGCATCCAGGATAAGGGCCAGG - Intergenic
1062008667 9:134255373-134255395 TACGTACCTTGCTAAGGGCCAGG + Intergenic
1062333866 9:136056454-136056476 AAGGATGATGGCTAGGGGCCTGG - Intronic
1062395967 9:136352983-136353005 TAGGACCCTGGGCAAGGGCTCGG - Intronic
1189923640 X:45930162-45930184 AAGTTGCCTGGCTAAGGGCCGGG - Intergenic
1190952734 X:55162103-55162125 TAGGATCCAGGTGAAGGGCCTGG - Intronic
1192146731 X:68687724-68687746 AAGGCTCCTGGGTCAGGGCCAGG - Intronic
1193925574 X:87479636-87479658 TAGGATGCTGGCTAAACTCCTGG + Intergenic
1194566145 X:95491190-95491212 TAGAATGCTGGCTATGGGTCAGG - Intergenic
1196027214 X:111053817-111053839 TAGGAGCATGGATAAGTGCCTGG - Intronic
1198026472 X:132712477-132712499 GAGGAGCCAGGCAAAGGGCCTGG + Intronic
1198526331 X:137504962-137504984 TAGGATCCTGGATCAGGGCCTGG - Intergenic
1198544935 X:137681502-137681524 TAGGGTCATGGCTATGGGGCTGG - Intergenic
1199896543 X:152132288-152132310 GAAGAACCTGGCTCAGGGCCTGG + Intergenic