ID: 1029307614

View in Genome Browser
Species Human (GRCh38)
Location 7:99631996-99632018
Sequence TTCCAAAGGCAGGTGGGGAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 300}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029307605_1029307614 -4 Left 1029307605 7:99631977-99631999 CCTTCCCCAGAGGGTGGTTTTCC 0: 1
1: 0
2: 0
3: 72
4: 223
Right 1029307614 7:99631996-99632018 TTCCAAAGGCAGGTGGGGACTGG 0: 1
1: 0
2: 1
3: 24
4: 300
1029307609_1029307614 -10 Left 1029307609 7:99631983-99632005 CCAGAGGGTGGTTTTCCAAAGGC 0: 1
1: 0
2: 2
3: 14
4: 109
Right 1029307614 7:99631996-99632018 TTCCAAAGGCAGGTGGGGACTGG 0: 1
1: 0
2: 1
3: 24
4: 300
1029307607_1029307614 -9 Left 1029307607 7:99631982-99632004 CCCAGAGGGTGGTTTTCCAAAGG 0: 1
1: 1
2: 2
3: 10
4: 144
Right 1029307614 7:99631996-99632018 TTCCAAAGGCAGGTGGGGACTGG 0: 1
1: 0
2: 1
3: 24
4: 300
1029307601_1029307614 7 Left 1029307601 7:99631966-99631988 CCTGAGTGTGGCCTTCCCCAGAG 0: 1
1: 0
2: 1
3: 24
4: 248
Right 1029307614 7:99631996-99632018 TTCCAAAGGCAGGTGGGGACTGG 0: 1
1: 0
2: 1
3: 24
4: 300
1029307606_1029307614 -8 Left 1029307606 7:99631981-99632003 CCCCAGAGGGTGGTTTTCCAAAG 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1029307614 7:99631996-99632018 TTCCAAAGGCAGGTGGGGACTGG 0: 1
1: 0
2: 1
3: 24
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029307614 Original CRISPR TTCCAAAGGCAGGTGGGGAC TGG Exonic
900206300 1:1433307-1433329 TCCCAAAGGCGGGTGGGGGCAGG + Intergenic
900593327 1:3469318-3469340 TGGCAGGGGCAGGTGGGGACAGG - Intronic
900793474 1:4693998-4694020 TTCACAAGGCAGGTGGGGTAGGG + Intronic
901055654 1:6447708-6447730 TTCCAGATGCAGGAGGGGAAGGG + Intronic
901954348 1:12773124-12773146 TTACAAAGTGAGGTGGGGGCTGG - Intergenic
903130810 1:21278483-21278505 TTACAAAGGGAGGTGGAGCCTGG + Intronic
903942579 1:26941918-26941940 TCCCAAAGCCAGGAGGGGAGGGG - Intronic
904587095 1:31586608-31586630 CTCCAAAGGCAACTGGGGGCTGG + Intronic
904939994 1:34158997-34159019 TCCCAAGGGCAGCTGGGGGCTGG - Intronic
905213540 1:36390945-36390967 TCCCACAGGCTGGTGGGCACTGG + Intergenic
905313822 1:37068472-37068494 TTTGACAGGGAGGTGGGGACAGG - Intergenic
905609143 1:39333792-39333814 TTAGAGAGGCAGGTGGTGACTGG + Intronic
905883850 1:41481283-41481305 TCCCGCAGGCAGGTGGGGATGGG - Intronic
906168725 1:43706760-43706782 TGCCTAAGGCAGGAAGGGACTGG - Intronic
906719414 1:47994672-47994694 TTGCAGAGGGAGGTGGGGATGGG + Intronic
906833754 1:49060990-49061012 TTCCAAACTCAGTGGGGGACAGG + Intronic
909005425 1:70270496-70270518 TTCCACAGACTGGTGGGGACTGG + Intronic
910089804 1:83449166-83449188 TTCCAAAGGCAGGTGATAATGGG - Intergenic
911364282 1:96917977-96917999 TACCAAAGGCAGTGGGGGAAGGG + Intergenic
913160404 1:116139989-116140011 GTCCAAGAGCAGGTGTGGACAGG - Intergenic
914195433 1:145445925-145445947 GTCCTCAGGCAAGTGGGGACTGG - Intergenic
915300252 1:154947605-154947627 CTCCAGAGGCAGGTGGGGCCTGG - Intronic
915335122 1:155136411-155136433 TACCAGAGGGAGGTGGGGGCGGG + Intronic
915735500 1:158082085-158082107 TTCCAATGCCAGATGGGGACAGG - Intronic
915792097 1:158683625-158683647 TTCCTAAAGCCAGTGGGGACAGG - Intronic
915829595 1:159114423-159114445 TTCTAAAGTCACTTGGGGACGGG + Intronic
917541675 1:175920631-175920653 TACCAAGGGGAGGTGGGGAAAGG + Intergenic
920059191 1:203215952-203215974 TTGGGAAGGCAGCTGGGGACTGG - Intronic
920077357 1:203347260-203347282 TGGCAAAGGGAGGCGGGGACTGG - Intronic
920351866 1:205343214-205343236 GGCCAAAGGCAAGTGGGGCCAGG - Exonic
920736549 1:208538020-208538042 TTCCAATGGCAGGTGAGGAAGGG - Intergenic
921046298 1:211480143-211480165 TTCCAGAAGCACCTGGGGACGGG - Intronic
922675300 1:227545731-227545753 GCACAAAAGCAGGTGGGGACAGG - Intergenic
922991965 1:229921772-229921794 TTCCAAAGGTAGGTGAGGCCTGG + Intergenic
924017746 1:239745644-239745666 TTCTAAAGGGTGGTGGGGGCGGG - Intronic
924584792 1:245352695-245352717 TGATAGAGGCAGGTGGGGACGGG + Intronic
1062863361 10:828014-828036 TGTGAAGGGCAGGTGGGGACAGG - Intronic
1063159559 10:3409252-3409274 TTGCAAAGGCCGGTGGTGCCGGG + Intergenic
1063333657 10:5187814-5187836 TTCCAAGGTCAGGGGGGAACTGG - Intergenic
1063499309 10:6538541-6538563 TTCTAAAGGCAGGAGGAGCCAGG - Intronic
1063954016 10:11249252-11249274 TTACAAAGTCAGTTGGGGGCGGG + Intronic
1066296358 10:34057216-34057238 TAGCACAGGCGGGTGGGGACAGG - Intergenic
1067281255 10:44874978-44875000 TTCCACTGACAGGTGGGGAAAGG - Intergenic
1068574535 10:58670449-58670471 TTGCCATGGCAGATGGGGACAGG - Intronic
1069818640 10:71214104-71214126 CTCCGGAGCCAGGTGGGGACGGG + Intronic
1072063650 10:91842934-91842956 TTCCCAAAGCACATGGGGACTGG - Intronic
1073036071 10:100565027-100565049 TTCCAGAGGGAAGGGGGGACAGG + Intergenic
1073423093 10:103440166-103440188 CTCCCAAGGCAGATGGGGGCAGG + Intronic
1076258067 10:129044649-129044671 TCCCAGAAGCAGGTGGGGACCGG + Intergenic
1076379146 10:130013510-130013532 TTCCAAAGGCAGCCTGGGTCTGG + Intergenic
1076736125 10:132459893-132459915 TTCAACAGGCAGGAGGGGCCAGG - Intergenic
1077659578 11:4055631-4055653 TGCCAAGGTCAGGAGGGGACTGG + Exonic
1078188100 11:9069336-9069358 TTCCCATGGCAGGTGTGCACTGG + Intronic
1079455702 11:20634322-20634344 TACCCAAGGCAGATGGGGAGCGG - Intronic
1079742546 11:24081117-24081139 TACTAAAGGCAAGAGGGGACAGG - Intergenic
1080291904 11:30680590-30680612 TTCCAAAGGCTGGTGGTACCAGG + Intergenic
1080309215 11:30869808-30869830 TTCCAAAGGCCTTTGGGCACAGG + Intronic
1081814231 11:45929631-45929653 GTCCAAAGGCTGCTGGGGAAGGG + Intronic
1082858403 11:57829839-57829861 TTCCGAAGGAAGGGGTGGACAGG - Intergenic
1083022916 11:59525392-59525414 ATCCAAATGCAGGTGGGGAGGGG - Intergenic
1083307456 11:61768820-61768842 CACCAGAGGCAGGTGTGGACTGG - Intronic
1083831520 11:65236677-65236699 TCCCACAGGCAGATGGGGATGGG + Intergenic
1083853226 11:65379666-65379688 TGCCACAGGGAAGTGGGGACAGG + Intronic
1083937154 11:65875660-65875682 TGCCAGAGGAAGGTGGGGAATGG + Intergenic
1084572574 11:69968379-69968401 TTCCAAAGGCAGAGGCAGACAGG + Intergenic
1084647094 11:70464902-70464924 TTCCAGAGGCATGTGTGGGCGGG + Intergenic
1085031636 11:73274836-73274858 GTCCCAAGGCAGGAGGGGGCAGG - Intronic
1085643195 11:78206199-78206221 TTGCCAAGGCAGGTCAGGACTGG + Intronic
1086081043 11:82902278-82902300 TTCAAGAGGCTGGTAGGGACTGG - Intronic
1086590020 11:88503592-88503614 ATCCAAAGTCAGTTGGTGACAGG + Intergenic
1088368278 11:109061597-109061619 TTCAAAAGGCAGGGGGGGAGAGG - Intergenic
1088458863 11:110061749-110061771 TTAGAAAGGCAGTTGGTGACTGG - Intergenic
1089009191 11:115119041-115119063 TTCCAAAGTGAGATGGGGATGGG + Intergenic
1089362479 11:117900247-117900269 TTCACAAAGCAGGTGGGGGCAGG - Intergenic
1089762519 11:120738754-120738776 TTGCCAAGGCAGGTGGTGATGGG - Intronic
1092995014 12:13941461-13941483 TTTCAAAGCCAGGTGAGGAACGG + Intronic
1094212347 12:27905763-27905785 TTCCAAAGTCAGGTTGGAGCTGG + Intergenic
1094454931 12:30621535-30621557 TTGCAAAAGCAGGTGGACACAGG - Intergenic
1096750342 12:53754944-53754966 GTGCAAAGGCAGGAGAGGACAGG - Intergenic
1098810023 12:75075865-75075887 TTCTTAAGGCAGGTGGAGATAGG - Intronic
1100334702 12:93618478-93618500 TCAGAGAGGCAGGTGGGGACTGG - Intergenic
1100568826 12:95826135-95826157 CTCGAAGGGCAGGTGGGGAAGGG + Intergenic
1100737484 12:97552941-97552963 TACAAAAGGCAGGTGAAGACAGG + Intergenic
1101521938 12:105492068-105492090 TGCAAAAAGGAGGTGGGGACAGG - Intergenic
1106449819 13:29870207-29870229 TTGCATAGAAAGGTGGGGACAGG - Intergenic
1107534268 13:41312118-41312140 TCCCAAAGGGAGGTGGTGCCAGG - Intronic
1107610943 13:42112440-42112462 TTCCAAAGCCACGTGGGGCCAGG - Intronic
1111306702 13:86422929-86422951 GAGCAAAGGCAGGTGGGGAAGGG - Intergenic
1112555225 13:100461708-100461730 CTGCAAAGGCAGGCAGGGACAGG - Intronic
1113597139 13:111541124-111541146 TTCCACATCCAGGTGTGGACTGG - Intergenic
1113709232 13:112453023-112453045 CACCAAAGGAAGGTGGAGACCGG + Intergenic
1113779177 13:112966311-112966333 GTCCAGGGGCAGCTGGGGACTGG + Intronic
1114555256 14:23558521-23558543 TTCCACAGGCAGGCAGGGAGTGG + Intronic
1114734656 14:25031972-25031994 TTCCAAGAGAAGGTGGGGAGTGG + Intronic
1115917662 14:38334677-38334699 TTTCAAATGCAGGTGGATACTGG + Intergenic
1117011419 14:51474397-51474419 TTACAATGGCAGTTTGGGACTGG + Intergenic
1118484277 14:66199148-66199170 TTTGAAAGGAAGGTGGGGATTGG - Intergenic
1119147771 14:72332384-72332406 TTCCAAATTCAGATGGGAACTGG - Intronic
1119455062 14:74748117-74748139 TCCCAATGGCAGGTGGGGCGTGG + Intergenic
1121110073 14:91306739-91306761 TTACAAAAGCAGGTGGGGGCTGG + Intronic
1121402229 14:93689804-93689826 TTCTAAAGGCAGGAGTGGAAAGG + Intronic
1121580788 14:95028003-95028025 CTGCAAAGCCAGGTAGGGACAGG + Intergenic
1121808959 14:96862099-96862121 TTGCAAAGGAAGGTAGGGGCGGG - Intronic
1121827959 14:97026264-97026286 TACCAAAGGGAAGTGGGGTCTGG + Intergenic
1122333176 14:100942036-100942058 TTCCAAAGGAAGGAGGGTCCTGG - Intergenic
1122508933 14:102250342-102250364 TGCCAAAGGCTGGGGGGGAGTGG + Intronic
1122881885 14:104693952-104693974 AAGCAGAGGCAGGTGGGGACAGG - Intronic
1125401980 15:39313661-39313683 TTCCTAAGGCAGGTGCAGCCTGG - Intergenic
1125525070 15:40369489-40369511 ATCCCATGGCAGGTGGGCACAGG - Exonic
1126413227 15:48393586-48393608 TTCCACAGGCTGGTGGGGTTGGG + Intergenic
1126431517 15:48590050-48590072 TTCCAAAGGCACATGGAGAATGG + Intronic
1127332022 15:57948985-57949007 GTGCCAAGGCGGGTGGGGACAGG - Intergenic
1127976254 15:63999306-63999328 TTTCCAGGGCACGTGGGGACTGG + Intronic
1128806784 15:70536899-70536921 TTCCCAAGGAAGGTGTGGCCAGG + Intergenic
1130638371 15:85646797-85646819 TGCCTAAGGGAGGTGGGGAATGG + Intronic
1130963803 15:88682332-88682354 CACCAAAGGCAGATGGGGAAGGG - Intergenic
1132052117 15:98615891-98615913 TTCCAAGGGAAGACGGGGACAGG + Intergenic
1132865125 16:2089513-2089535 TTCCCAAGGGAGCTGGGGAGGGG + Exonic
1133172263 16:3988535-3988557 TTTCCAGGGCAGGTGGGGAGGGG + Intronic
1133337752 16:5017170-5017192 TTCCAGAGGCGGGTGGGGGGAGG + Exonic
1134109177 16:11503980-11504002 TGCCAAGGGCAGCTGGGGAAAGG - Intronic
1134149641 16:11796412-11796434 ATCCCTAGACAGGTGGGGACAGG + Intronic
1134199356 16:12185113-12185135 TTCTACAGGCAGCTGTGGACTGG - Intronic
1134320135 16:13155407-13155429 GTCCCAGGGCAGGTGGGGAGGGG - Intronic
1134824448 16:17273319-17273341 TTACAAATGCAGGCGGGGAATGG - Intronic
1135025443 16:18995830-18995852 TTCCAATGTCAGGAGTGGACTGG + Intronic
1135379056 16:21978509-21978531 TGGAAAAGGCAGGTGGGGAAGGG - Intronic
1136172449 16:28497059-28497081 TCCCAGAGGCAGGCGGGGAGGGG + Exonic
1137403482 16:48172045-48172067 TACCAAGGGCTGGTGGGGAGGGG - Intronic
1137586397 16:49666321-49666343 TGTCGAAGGCAGGTGGGGAATGG - Intronic
1137623477 16:49892386-49892408 TCCCACAGGCAGTTGGTGACTGG - Intergenic
1138727896 16:59160994-59161016 TTCCAACGGCGGGGGAGGACTGG + Intergenic
1140825967 16:78706956-78706978 TTCCAAAGGCAGTTTGTGCCAGG - Intronic
1140865080 16:79053005-79053027 TGGCAAAAGCAGGTGGGAACAGG + Intronic
1142124343 16:88402724-88402746 GTCCAGAGGCAGGCGGGGGCCGG - Intergenic
1142494252 17:297982-298004 TTGGCAAGGCCGGTGGGGACAGG - Intronic
1144364213 17:14526369-14526391 TTCCAAAGGCAGTTTGGGAAAGG - Intergenic
1144782498 17:17815061-17815083 TCCCACAGGCTGGTGGGGAGAGG + Intronic
1147931230 17:43982933-43982955 TGCCAAAGGCAGCTGGAGGCCGG + Intronic
1148193751 17:45698599-45698621 GTGGAAAGGCAGGTGAGGACTGG + Intergenic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1148802828 17:50243162-50243184 TTAAAAAGGCAGCTGGGCACGGG - Intergenic
1148818636 17:50347447-50347469 CTCCAAAAGGAGGTGGGGGCGGG + Intronic
1149439733 17:56664147-56664169 GGCCAAAAACAGGTGGGGACAGG + Intergenic
1150590850 17:66560870-66560892 TCCCAAAGGCAAGGGTGGACAGG - Intronic
1151476811 17:74348823-74348845 TTCCAAAGGCAGGAAGGGGATGG + Intronic
1152073954 17:78147416-78147438 TTATAGAGGCAGGTGGGGAGTGG + Intronic
1152165816 17:78704900-78704922 TTCCTAAGGCAGCTGTTGACAGG - Intronic
1152237447 17:79145900-79145922 TTCCAAAGGCCGCCGGGGGCAGG + Intronic
1152388187 17:79987608-79987630 TTCCGAATGAAGGTGGGGATGGG + Intronic
1152612703 17:81323435-81323457 TTCCCAGGGCAGGTGGGGAGGGG - Intronic
1153417198 18:4859731-4859753 TTCCAAAGTCAGATGGAGGCAGG + Intergenic
1155145598 18:23080885-23080907 TTCCAAAGGCAGGTTGAGGTGGG - Intergenic
1156345757 18:36255792-36255814 TGCCAAAGGGAGATGGGAACTGG + Intronic
1157370733 18:47109177-47109199 TCCCAAAGGCAACTGGGAACAGG + Intronic
1158172451 18:54614877-54614899 TTGAAGAGGCAGGAGGGGACGGG + Intergenic
1158830508 18:61272388-61272410 TTCCATTGGCCGGTGGGGAGTGG + Intergenic
1161106174 19:2445165-2445187 TTGCAAAGGCTGGTGGGGGCAGG - Intronic
1161199215 19:3005336-3005358 TTCCAGAGGCAGGACAGGACAGG - Intronic
1161539944 19:4844546-4844568 TTCCAAAAGCAGGTGAGGCTAGG + Intronic
1162490663 19:10989432-10989454 TTCCAGAGGCAGGTGGGTGCTGG + Exonic
1162514279 19:11138783-11138805 TGCCAGAGGGAGGTGGGGAGAGG + Intronic
1163697278 19:18770229-18770251 TTTCAGAGGCAGGTCGGGCCAGG - Intronic
1165319498 19:35076649-35076671 GTCCTGAGGAAGGTGGGGACTGG - Intergenic
1166523398 19:43495977-43495999 ATCCAGAAGCAGGTGGGGAAAGG + Intronic
1167279498 19:48558579-48558601 TCCCTAAGGAAGGTGGGGCCGGG - Intronic
1167367738 19:49063888-49063910 TTATAGAGGCAGGTGGGGAAGGG + Intronic
1167775325 19:51550830-51550852 ATCCAAAGGTGGGTGTGGACTGG + Intergenic
1168353304 19:55688330-55688352 TTCCAAGAGCAGGAGGGGAAGGG - Intronic
1168703810 19:58456721-58456743 TTCCATTTGCAGGTGGGGACAGG + Exonic
925117910 2:1396127-1396149 TTCCAAGGGGAGATGGGGCCTGG - Intronic
925548545 2:5043716-5043738 TTCCAAAGGCATATGTTGACAGG + Intergenic
926047502 2:9720546-9720568 TTACAAAAGCAGGTGGGGGTAGG + Intergenic
926049150 2:9731929-9731951 TTTAAAAGGCAGCTGGGGCCGGG - Intergenic
929795132 2:45053470-45053492 TTCCAAATGCCTGAGGGGACAGG + Intergenic
930050999 2:47216187-47216209 CTCCAAAGCAAGGTGGGAACAGG - Intergenic
930422764 2:51175142-51175164 TTCCACAGACTGGTGGGGAAGGG - Intergenic
931473594 2:62565006-62565028 TTCTAAATGGAGGTGGGGAGGGG + Intergenic
931966822 2:67544276-67544298 TTGCAAAGCTAGGTGGGGACTGG + Intergenic
932207052 2:69892461-69892483 TTCCAAAGGCATCTGGGGGTTGG + Intergenic
932544734 2:72696439-72696461 TTGCAAAGGCACATGGGCACAGG - Intronic
932968703 2:76511192-76511214 TCTCAAGAGCAGGTGGGGACTGG + Intergenic
933236639 2:79871496-79871518 GTCCAAAGGCAGGAGGAGAAGGG + Intronic
934515933 2:94986599-94986621 TTCCAAAGGCTGCTGGGCTCTGG - Intergenic
936654218 2:114465994-114466016 TTCCAGAGGCAGGTAGGGGTGGG - Intronic
936993470 2:118389663-118389685 TTCCAAAGGCAGGAGGTGGAGGG + Intergenic
937870081 2:126780372-126780394 GGCCAAAGGCAGGTGGAAACTGG - Intergenic
943257239 2:185611354-185611376 TGCCAAAGTCAGGTGGGGATGGG + Intergenic
946147584 2:217742651-217742673 GTGCAAAGGCAGGTGGAGACAGG - Intronic
946195983 2:218033360-218033382 TTCCCCAGGATGGTGGGGACAGG - Intergenic
946724973 2:222653288-222653310 GTAAAAAGGAAGGTGGGGACTGG + Intronic
947447115 2:230172593-230172615 GTCCAAAAGGAGGAGGGGACGGG - Intronic
948659594 2:239498859-239498881 CTGCAAAGGGAGGTGGGGCCAGG + Intergenic
1168958042 20:1848513-1848535 TTCCCCTGGCAGGTGGGGCCAGG - Intergenic
1169305497 20:4486815-4486837 TTTGTAAGGCAGGTGGGCACTGG - Intergenic
1169305935 20:4490411-4490433 TGCCAGAGGCAGCTGGGGCCGGG - Intergenic
1169819991 20:9699865-9699887 TGCCATAGGCATGAGGGGACCGG - Intronic
1170785394 20:19462956-19462978 TTCTTAAGGCAGGGTGGGACAGG - Intronic
1171418201 20:24998121-24998143 TTCCAAACTCAGGTGCGTACTGG + Intergenic
1172647488 20:36480005-36480027 TTCCCAAGACAGGTGGGAAAGGG - Intronic
1172672588 20:36644543-36644565 GCCCAAAGGCAGATGGAGACAGG + Intronic
1172898614 20:38317902-38317924 TGGCAAAGGCAGGTAGGGAATGG + Intronic
1173001391 20:39108467-39108489 TTCCAAAGGAAGCTGGGGTCAGG - Intergenic
1174049949 20:47760544-47760566 TTTCAGAGGCAGGTGGGCAAAGG - Intronic
1174500496 20:50980850-50980872 TGGCACAGGGAGGTGGGGACTGG + Intergenic
1175746462 20:61460492-61460514 TTCCAGCGGCAGGTGAGGCCGGG - Intronic
1175901886 20:62363207-62363229 TTCCGGAGGCCTGTGGGGACCGG + Intronic
1176111693 20:63413835-63413857 TTCCTAAGCCAGGTGGAGCCCGG + Intronic
1176257058 20:64158279-64158301 AGACAAAGACAGGTGGGGACAGG - Intronic
1177893355 21:26833426-26833448 GGGCAAAGCCAGGTGGGGACTGG - Intergenic
1178536325 21:33413186-33413208 GCCCAAAGCCAGTTGGGGACTGG - Intronic
1178585847 21:33869986-33870008 TTACAAAGGCAGAAGGGGAAAGG - Intronic
1179553798 21:42159962-42159984 CTCCAAAGGCAGGCAGGGGCAGG + Intergenic
1179571138 21:42279542-42279564 CCCAAAAGGCAGGTGGGGCCTGG - Intronic
1180675521 22:17583541-17583563 TTCCCATAGGAGGTGGGGACAGG - Intronic
1181964368 22:26646262-26646284 TCCAGAAGGCAGGTAGGGACTGG - Intergenic
1182466459 22:30519909-30519931 TTCCAAGGGTAGGGGGAGACTGG - Intergenic
1182473847 22:30565066-30565088 GTCCAAAGAGAGGTGAGGACTGG - Exonic
1183069523 22:35386601-35386623 TTCCAAAGGCAGTAGTGGACGGG + Intronic
1183544069 22:38446379-38446401 TTCCAAGGTCAGGTGGGCTCAGG + Intronic
1184185336 22:42861119-42861141 TTCACAAGGAAGATGGGGACTGG + Intronic
1184478841 22:44735832-44735854 TTACACCAGCAGGTGGGGACGGG - Intronic
1185127291 22:49018165-49018187 GTCCCAAGGCAGCTGGGGGCAGG - Intergenic
950129470 3:10532052-10532074 TTCCAAAGCCAGGAGAGGATGGG - Intronic
952366018 3:32675646-32675668 TTTTAAAGGTAGGTGGGGGCAGG - Intergenic
953849814 3:46456921-46456943 TTCCACAGACAGATGGGGAATGG + Intronic
954033628 3:47838022-47838044 TTGCAAAGGCAGGGGGAGAACGG + Intronic
954223222 3:49166958-49166980 TTGCTCAGGCAGGTGGGGGCAGG + Intergenic
954625795 3:52021278-52021300 TCCTAATGGCTGGTGGGGACTGG + Intergenic
958176961 3:90008188-90008210 TTACAGAGGCAGGTAGGGAGGGG + Intergenic
960154874 3:114289825-114289847 TTCCCAAGGAAGATGGGGCCGGG + Intronic
961385324 3:126520096-126520118 TTCCCTGGGCAGGTGGGGAGGGG - Intergenic
961631041 3:128298732-128298754 TACCAAAGGCTGGTGGGCAGGGG - Intronic
963583426 3:147154531-147154553 CTCCTGAGTCAGGTGGGGACTGG + Intergenic
963654415 3:148026467-148026489 TTCCATAGGCTGGTGTGGCCTGG + Intergenic
964636010 3:158859235-158859257 GGGCAAAGCCAGGTGGGGACTGG + Intergenic
966460998 3:180176134-180176156 TTCCAAAGGTAGATGTGGGCAGG + Intergenic
967863004 3:194166971-194166993 GTCCAAAGGCAGATGGCAACAGG + Intergenic
968598794 4:1499490-1499512 TGCCAGAGGCAGGTGTGGTCAGG - Intergenic
968606756 4:1539224-1539246 TCCCAAAGTCAGGGAGGGACGGG + Intergenic
968620173 4:1600385-1600407 GTCTATAGGCAGGTGGGGCCAGG + Intergenic
968688297 4:1976088-1976110 TTCCACAGGAACGTGGGCACAGG - Intronic
968712301 4:2127648-2127670 TTCCAGAGGCAGATGGGCTCGGG - Intronic
970035062 4:11723798-11723820 TGCCACTGGCAGGTGGGGTCTGG + Intergenic
970969502 4:21965296-21965318 TTACAAAGGCAGCTGAGCACTGG + Intergenic
971074214 4:23129330-23129352 TTCCAAAGGCAGTTTGGGGAAGG + Intergenic
971701362 4:29981842-29981864 TTCCAGAGGCTGATGGGGTCAGG + Intergenic
972893098 4:43584185-43584207 TTCCAAAGGCTGGGGGTGAGAGG + Intergenic
975384488 4:73739761-73739783 TTCCAAAGGCAGTTGGAGCAAGG - Intergenic
975521683 4:75308258-75308280 TCCCAAAGACCAGTGGGGACAGG + Intergenic
977586800 4:98783431-98783453 TTACAAAGGTGGGTGGGGGCAGG + Intergenic
977785320 4:101026676-101026698 TTCCAAAGTTAAGTGGAGACAGG - Intronic
980096114 4:128492614-128492636 TTTCAAAGGCAGGTGGGAAGCGG - Intergenic
980977075 4:139621365-139621387 TTCCCCAGGAAGATGGGGACTGG - Intergenic
981064299 4:140464986-140465008 TTCAAAAGGCAAGTGAGGTCTGG - Exonic
983089260 4:163485110-163485132 TTCCAAAGGCAAGGGTGCACAGG + Intergenic
984484110 4:180345026-180345048 TGCGAAAGGCAGGTGGGCAGAGG + Intergenic
984554423 4:181197171-181197193 TTCTAAAGGCAGATGAGGCCTGG - Intergenic
986032609 5:3908512-3908534 TGCCAAAGGGAGCTGGGGAGAGG - Intergenic
986339348 5:6775958-6775980 TTCCAAAAGCAGGTGTAGGCGGG + Intergenic
987726271 5:21703924-21703946 TGGCAAAGGTAGGTGGGGCCTGG - Intergenic
988582689 5:32482019-32482041 GTCCAAAGGCAGGAGAGGAAGGG - Intergenic
988609972 5:32714154-32714176 TTCCCAAGGCCGGCTGGGACTGG + Intronic
996519092 5:124406440-124406462 TTCCAGTGGCAGGTGGGGTGAGG + Intergenic
998141111 5:139700021-139700043 TTCCAGAGGAGGGTGGGCACTGG - Intergenic
998930884 5:147180473-147180495 TTCCAAAGACAGGTGCAGAGAGG - Intergenic
1002290850 5:178199734-178199756 GCCCAAAGGCAGGAGGGCACTGG + Intergenic
1002872922 6:1183725-1183747 GTCCAAAGGATGGTGGAGACTGG - Intergenic
1002971157 6:2021725-2021747 TTCCACAGTTGGGTGGGGACGGG - Intronic
1004792321 6:19040486-19040508 TTCCAAAGGCAGCTGAGGGCTGG + Intergenic
1007958095 6:45935279-45935301 TTCCAGTGGCAGGCGGGGAGGGG + Intronic
1010735196 6:79436142-79436164 TTCCCATGGCACGTGGGGAGTGG - Intergenic
1012550731 6:100463247-100463269 TTTCAAAGGCAGAAGGGGCCGGG - Intronic
1015544257 6:134345951-134345973 TCCCAAAGGCAAGTGGGAATGGG + Intergenic
1015626170 6:135182349-135182371 GTCCAGAGGCCGGTGGAGACTGG - Intronic
1019469252 7:1209654-1209676 GTCTAAACCCAGGTGGGGACAGG - Intergenic
1019536695 7:1533176-1533198 TCCCACAGGCCGGTGGGGTCTGG + Intronic
1019780480 7:2936946-2936968 CTCCACGGGGAGGTGGGGACTGG + Intronic
1020261372 7:6532307-6532329 CTCCAAAGACAGGCGGGAACAGG + Intronic
1023030482 7:36086517-36086539 TTCCAAACCCAGGTGTGCACTGG - Intergenic
1025105076 7:56163881-56163903 TTCCCAAGGCAGCAGGGGAAAGG + Intergenic
1027055158 7:75044656-75044678 GTTCAGAGGCAGATGGGGACTGG - Intronic
1027122709 7:75533406-75533428 TTCCCAGGGCAGGTGGCCACTGG - Exonic
1027306660 7:76905613-76905635 TTCCAAAGGCAGGTGATAATGGG - Intergenic
1027474113 7:78608314-78608336 TCTCAAAGCCAGTTGGGGACAGG - Intronic
1027721240 7:81744165-81744187 TTCCAAAGAAAGGTGGGGGACGG + Intronic
1029067963 7:97871768-97871790 CTACAGAGACAGGTGGGGACTGG + Exonic
1029307614 7:99631996-99632018 TTCCAAAGGCAGGTGGGGACTGG + Exonic
1030228093 7:107175014-107175036 TTGCAAAGGAAGCTGGAGACGGG + Intronic
1030311954 7:108077845-108077867 TTTCAAAGCCACCTGGGGACCGG + Intronic
1030384276 7:108848663-108848685 ATGCACAGGCAGGTGGGGGCGGG - Intergenic
1032197286 7:129796646-129796668 TGCCACAGGCAGGTGGGACCTGG - Intergenic
1032368915 7:131327364-131327386 TTCCAGAGTCAGATGGAGACAGG - Intronic
1032883715 7:136116076-136116098 TTGCAAGGCCAGGTGGGGAAAGG - Intergenic
1035826275 8:2647327-2647349 TAAGACAGGCAGGTGGGGACTGG + Intergenic
1036801199 8:11794065-11794087 TTCCAAAAGGAGGTAGGGCCTGG + Intergenic
1037920916 8:22804868-22804890 TTCCAGAATCAGATGGGGACTGG - Intronic
1038305020 8:26392518-26392540 TTGCCAAGGCAGCGGGGGACTGG + Intronic
1039983593 8:42429395-42429417 ATCCAAAGGCAGCTGGGGTGGGG - Intronic
1039987754 8:42462155-42462177 TTCCAGAGACAGGAGGGGAGGGG + Intronic
1045381749 8:101634410-101634432 TTCCAAAGACAGGAGGGAAGAGG + Intronic
1048053358 8:130840238-130840260 TTCAGAAGGCAGATGGGGTCTGG + Intronic
1048508906 8:135044734-135044756 CTTCAAAGGCAGGTAGGGATTGG + Intergenic
1049587245 8:143437776-143437798 TGCCAATGGCAGTCGGGGACAGG + Exonic
1049773989 8:144396337-144396359 TTCAACAGACAGGTGGGGCCCGG - Exonic
1053015584 9:34660225-34660247 GTCCATACGCTGGTGGGGACGGG - Intronic
1055304803 9:74918386-74918408 TTGGAAAGGTAGGTGGGGAGAGG + Intergenic
1055913256 9:81374778-81374800 TTCAAAAGGCAGGTGGGCCTGGG + Intergenic
1057204505 9:93163245-93163267 TTCCTCAGGCAGGTGTGGCCTGG + Intergenic
1057564529 9:96156164-96156186 TTCTCAAGGCAGGTGAGGAGGGG - Intergenic
1060824065 9:126677500-126677522 TTGGAAAGGTAGTTGGGGACTGG - Intronic
1061564634 9:131430082-131430104 TTTCAAAGGCAGATCGGGAGCGG + Exonic
1062541155 9:137042113-137042135 TTCCAAATGGAGGTGGGCCCAGG - Intronic
1062699231 9:137890425-137890447 GTCCTCAGGCAAGTGGGGACTGG + Intronic
1187193283 X:17056989-17057011 TTTCAAAGGCAAATGGGCACTGG + Intronic
1187571593 X:20509262-20509284 GTTCAAAGGCAGGATGGGACAGG + Intergenic
1189287318 X:39860930-39860952 TCCCACAGCCAGGAGGGGACAGG + Intergenic
1190626769 X:52344506-52344528 GTCCAAAGGCAGGAGAAGACGGG - Intergenic
1190634061 X:52417421-52417443 TTCTAAAGGCAGGTAAGGAAAGG + Intergenic
1190701238 X:52991323-52991345 GTCCAAAGGCAGGAGAAGACGGG + Intronic
1190968836 X:55329503-55329525 TAGCAAATGCAGGTGGGGAGGGG - Intergenic
1195218163 X:102721109-102721131 TTCAAAAGGCAGGAGGGAGCAGG - Intronic
1195945723 X:110209079-110209101 TTCCAAAGGCTAGTGGGGACAGG + Intronic
1196890693 X:120288047-120288069 TTCCAAAGGCACCTTAGGACAGG + Intronic
1200901681 Y:8438947-8438969 TACTAAAGGAAGGTGGGTACAGG + Intergenic
1201518818 Y:14849571-14849593 TTTCAGAGGCAGGGAGGGACAGG - Intergenic