ID: 1029310719

View in Genome Browser
Species Human (GRCh38)
Location 7:99661130-99661152
Sequence CTCAAACATATATAGAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 620
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 588}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029310719 Original CRISPR CTCAAACATATATAGAGAAA AGG (reversed) Intronic
901162452 1:7189489-7189511 CTCAAAAGAATATATAGAAATGG + Intronic
903972278 1:27126797-27126819 CCCAAAAATATATACACAAAAGG - Intronic
907752430 1:57275114-57275136 CTCAAGAAGATAAAGAGAAAAGG + Intronic
907792535 1:57681457-57681479 TGCAGAAATATATAGAGAAATGG - Intronic
907860941 1:58352461-58352483 ATCTAACATTTGTAGAGAAAGGG + Intronic
909454348 1:75833577-75833599 CCAAAACATATATAGACCAATGG + Intronic
909708538 1:78616491-78616513 CAAAAACAAAAATAGAGAAATGG + Intergenic
909761603 1:79294747-79294769 TTCATACATATATAGATATATGG + Intergenic
910298447 1:85677195-85677217 CTAAAAAATATTTAAAGAAATGG + Intronic
910664123 1:89705776-89705798 CTCAAAAATAAATAAATAAATGG + Intronic
911193681 1:94972658-94972680 CTCAAACAAAAGAAGAGAAAAGG - Intergenic
911381454 1:97120161-97120183 CACAAACTTATATGAAGAAAGGG - Intronic
911655853 1:100443333-100443355 CTCAAAAATAAATAAATAAAAGG - Intronic
911796219 1:102079630-102079652 CACAATCAAATATAGACAAATGG + Intergenic
912003065 1:104858517-104858539 ATTAAACATATATAGTTAAATGG + Intergenic
912089426 1:106052872-106052894 TGCAAAAATATATAGAGAACAGG - Intergenic
913077776 1:115355695-115355717 CTCAAACATATAGAGAAAATAGG + Intergenic
913080257 1:115378193-115378215 CTGAAACATATGTAGGGATAAGG + Intergenic
913389949 1:118299609-118299631 CTCAAATAAATAAAGAGCAATGG + Intergenic
913499216 1:119455222-119455244 CCCAAACATATATATATATAGGG + Intergenic
914212782 1:145596111-145596133 CCCAAAAATAAATAGATAAATGG - Intergenic
914262901 1:146014095-146014117 AGCAAACATATAGTGAGAAAAGG - Intergenic
914465182 1:147921771-147921793 CTCAGAAATATATGGAGATATGG + Intergenic
914939032 1:152006063-152006085 CAGAAACATATAAAGAAAAAAGG + Intergenic
916178974 1:162067987-162068009 CTCAAACTAATCTAGAAAAAAGG + Intergenic
916204646 1:162303760-162303782 CTTAAAAATATATATACAAATGG - Intronic
916734217 1:167592815-167592837 CTCAAAAAAATAAAAAGAAAAGG + Intergenic
916924379 1:169502477-169502499 CCAAAACATATATAGACCAATGG + Intergenic
917279272 1:173364730-173364752 CTACAACAAATATAGGGAAATGG + Intergenic
918247719 1:182674662-182674684 CTGAAACAAATAAACAGAAAAGG + Intronic
918473221 1:184896554-184896576 CAAAAACAAAAATAGAGAAATGG - Intronic
919596345 1:199568174-199568196 CTCAAACAAATATATAAAAATGG + Intergenic
920903752 1:210138500-210138522 TTCAAATATATAGAGAGATATGG - Intronic
920909343 1:210200258-210200280 CTCAAATATATTTAGACACAAGG + Intergenic
921211348 1:212902071-212902093 CACACACAGATAAAGAGAAAGGG + Intergenic
921215122 1:212930089-212930111 CTGAAATATATAGAGAAAAAGGG - Intergenic
921248614 1:213274503-213274525 ACCAAACATATAGAGAGAAAAGG - Exonic
921415507 1:214881571-214881593 CTCAATTATATAAAGAGAACTGG + Intergenic
921931792 1:220760439-220760461 CACAAACAAATAGATAGAAATGG - Intronic
922432999 1:225574599-225574621 CTCCAAAATATATAAAAAAAAGG + Intronic
923171006 1:231417298-231417320 TTAAAACATACATAAAGAAAAGG - Intronic
923804809 1:237246094-237246116 CTCAAAAAAATAAAAAGAAAAGG - Intronic
923903264 1:238353480-238353502 CTAAAACAAAAATAGACAAATGG - Intergenic
924068285 1:240249110-240249132 CTAAAACAAAAATAGACAAATGG - Intronic
1062852290 10:754337-754359 CTCCAAAATACATAGACAAACGG + Intergenic
1063758982 10:9050175-9050197 CTCAATCATAAATGGACAAAAGG + Intergenic
1065022625 10:21512937-21512959 CTGAAACATTTATAGACAAAAGG + Intergenic
1065108954 10:22421180-22421202 TACAAAGATATATAGAGTAACGG - Intronic
1065252563 10:23831236-23831258 CACAAAAAAATATAGATAAATGG + Intronic
1065700328 10:28419080-28419102 CTAAAGCAGATATAAAGAAATGG + Intergenic
1065743491 10:28817728-28817750 CTCATACATATAAATAAAAAGGG + Intergenic
1065795573 10:29304605-29304627 GTCAAACATGAATAAAGAAAGGG - Intronic
1066034069 10:31463071-31463093 CTCAAACATTTTTGGAGCAAGGG + Intronic
1066354578 10:34669948-34669970 CTAAAAGATTTATAGTGAAAAGG + Intronic
1066583137 10:36902331-36902353 CTCAATAATTTATAAAGAAAAGG + Intergenic
1067162281 10:43837186-43837208 CACACACACATATAGAGAGATGG + Intergenic
1068003366 10:51363438-51363460 CTAAATCAAATATAGAGAGAAGG + Intronic
1068165564 10:53327809-53327831 CTCAAAAAGAGAGAGAGAAAGGG - Intergenic
1068298173 10:55103133-55103155 CAGAAACATTTTTAGAGAAATGG - Intronic
1068986785 10:63114927-63114949 CTCAAAAAAATAAAAAGAAAAGG + Intergenic
1070988497 10:80709920-80709942 CTCATAGAAATAGAGAGAAATGG + Intergenic
1071232397 10:83603579-83603601 CTCAGAAATTTGTAGAGAAAAGG + Intergenic
1071780874 10:88843254-88843276 CTCATTCACATATATAGAAACGG + Intronic
1072147173 10:92651981-92652003 TTTAAATATATATAGAGAGAGGG + Intronic
1072159121 10:92749946-92749968 CTCAAAAATAAATAAATAAAGGG - Intergenic
1074644939 10:115438552-115438574 CAAAAATATATAAAGAGAAAAGG - Intronic
1074759666 10:116657606-116657628 CACAAATATATATAGACATATGG - Intergenic
1074984723 10:118647663-118647685 CCAAAACATATATAGACCAATGG - Intergenic
1075180071 10:120203320-120203342 GTCAAACAAAAATAAAGAAAAGG - Intergenic
1075236342 10:120733205-120733227 CACACACATATATATATAAAGGG - Intergenic
1076663911 10:132074689-132074711 CTAAAACAAAAATAGACAAATGG - Intergenic
1078423897 11:11234000-11234022 AGCAAACAGAGATAGAGAAAGGG - Intergenic
1078824714 11:14918114-14918136 CTCAAAAACAAATAGACAAAAGG + Intronic
1078943942 11:16042628-16042650 CTGAAACCTAGAGAGAGAAAAGG - Intronic
1079296488 11:19239749-19239771 CTCAGACATAAAGAGAGAAAAGG + Intronic
1079550265 11:21687575-21687597 ATTAAATATATATAGAGAGAGGG - Intergenic
1079605606 11:22362002-22362024 CTTAGACATATAGACAGAAATGG - Intronic
1079663707 11:23075793-23075815 CACACACATATATATATAAAGGG - Intergenic
1079825246 11:25182524-25182546 CTCAAATATATAGAGAAAAGTGG + Intergenic
1079826164 11:25197200-25197222 CACAAACATAGCTAGAAAAATGG + Intergenic
1079874646 11:25841581-25841603 CCCAAACATATTTTGTGAAATGG + Intergenic
1079887268 11:26003866-26003888 CTCAGCAATATAGAGAGAAAGGG + Intergenic
1081085356 11:38793215-38793237 CTCAAACATATATAAGGTGAAGG - Intergenic
1082071588 11:47943931-47943953 CACACACATAGATGGAGAAATGG - Intergenic
1082742055 11:56921755-56921777 CTGGAAAATATTTAGAGAAATGG + Intergenic
1082917160 11:58449730-58449752 CTCAAAAATAGATATACAAATGG + Intergenic
1083942547 11:65904649-65904671 CTCAAAAATAAATAAATAAATGG - Intergenic
1085700837 11:78744670-78744692 CTCAAAAATGTTTACAGAAAGGG - Intronic
1086438517 11:86805201-86805223 CAGCAACTTATATAGAGAAAAGG + Intronic
1086643100 11:89184584-89184606 CTCAATTATATATGGATAAAAGG + Intronic
1087619597 11:100526524-100526546 CTCAAAAAAATATATACAAATGG + Intergenic
1087848865 11:103005189-103005211 CTCAAACATTTTTGGTGAAAGGG - Intergenic
1088235316 11:107717019-107717041 CTCAAAAAAATAAAAAGAAAGGG + Intronic
1088542470 11:110927525-110927547 CTCAAACCTATTTATACAAAAGG - Intergenic
1090178012 11:124668968-124668990 CTGAATCATATATAGAGGAGAGG - Intronic
1090368738 11:126230457-126230479 CTCTAGCATAAATATAGAAAAGG - Intronic
1090914778 11:131153586-131153608 ATCAGACATTGATAGAGAAATGG + Intergenic
1092314312 12:7394236-7394258 CCAAAACAGATATAGACAAATGG + Intronic
1092476426 12:8822771-8822793 CTCAAACATTTATATGGAGATGG + Intronic
1092811749 12:12277067-12277089 CTCAAAAATAAATAAATAAATGG + Intergenic
1093289908 12:17307264-17307286 CTTAAAGGCATATAGAGAAAAGG - Intergenic
1094798756 12:34005232-34005254 CTTAAAGGTATCTAGAGAAAAGG - Intergenic
1095963388 12:47850189-47850211 CACAAATATACATAGAGAGAGGG + Intronic
1096990565 12:55798495-55798517 CTCAAAAATAAATAAATAAAGGG + Intronic
1097135921 12:56855386-56855408 CTCAAAAATATATTGAAATAGGG - Intergenic
1098143430 12:67474010-67474032 CTCAAACAGATCTGGAGAAGTGG + Intergenic
1098820766 12:75225421-75225443 CTGAAACACATATAAGGAAAAGG + Intergenic
1098968301 12:76819555-76819577 CTTAATCATATATAGAAAATAGG - Intronic
1099519100 12:83637593-83637615 CTAAAACAAAAATAGACAAATGG - Intergenic
1099789447 12:87313291-87313313 CTGAAACAAATATAGGTAAATGG - Intergenic
1099800243 12:87448120-87448142 CTCAGACATCCATAAAGAAAAGG - Intergenic
1100578732 12:95918429-95918451 GCCAAAGAAATATAGAGAAAGGG - Intronic
1100692372 12:97052051-97052073 CTCAAACAGAAAGAGAGAGATGG + Intergenic
1101224538 12:102674899-102674921 ATATAACAAATATAGAGAAAGGG + Intergenic
1101665203 12:106806486-106806508 GAGAAAAATATATAGAGAAAAGG - Intronic
1101685866 12:107019972-107019994 ATCAAACAGATTTAGAGATAGGG + Intronic
1101939264 12:109087680-109087702 ATCAAAGAAAGATAGAGAAAAGG + Exonic
1102144517 12:110644863-110644885 CTCAAAAATAAATAAACAAAGGG + Intronic
1103558541 12:121780055-121780077 CTCAAAAATAAATAAATAAAAGG - Exonic
1103757746 12:123222930-123222952 CACACACACATATATAGAAATGG - Intronic
1105676339 13:22676351-22676373 CTCAGACCTATCTAAAGAAACGG + Intergenic
1106742585 13:32661466-32661488 GTAAAACATATTTAGAGAACTGG + Intronic
1106938554 13:34750687-34750709 CTCAAAGACAGAGAGAGAAAGGG + Intergenic
1107672464 13:42760220-42760242 CTCAAACATAGATAGGCATATGG + Intergenic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1108152126 13:47547190-47547212 CACAGACATATATAAACAAATGG + Intergenic
1108744345 13:53376237-53376259 CTGAAACATGTATAAATAAAAGG - Intergenic
1108899515 13:55382817-55382839 CCAAAACATATATAGACCAATGG - Intergenic
1109266311 13:60204911-60204933 GTCAAACATAAATAGTGATAAGG + Intergenic
1109369261 13:61400033-61400055 CTCAGAAATATTTAGAGAAGAGG + Intergenic
1109400416 13:61820344-61820366 CTCAAACAAATAGAGGGGAAGGG + Intergenic
1110139799 13:72114516-72114538 CTAACACATATATTGAGATACGG - Intergenic
1110390162 13:74964231-74964253 CTAAAACATATATAGACCAATGG + Intergenic
1110513904 13:76386060-76386082 CACAACCATATAAAGATAAAAGG + Intergenic
1110560561 13:76907250-76907272 GTCAAATACAAATAGAGAAAGGG + Intergenic
1110635127 13:77758437-77758459 CTCAAACAAAAATAAATAAATGG - Intronic
1110732295 13:78893068-78893090 TTCAAATATTTATAGAGACAAGG - Intergenic
1110825958 13:79972530-79972552 CTTAAAGATAACTAGAGAAAAGG - Intergenic
1111229316 13:85321619-85321641 CTCCAACATCTATAGAAATATGG + Intergenic
1112217297 13:97446298-97446320 CTCAAAAATATATGCACAAATGG - Intronic
1113125018 13:106968493-106968515 CACAAACAAAAATAGACAAATGG - Intergenic
1114769752 14:25415345-25415367 CACACACATTTATGGAGAAACGG + Intergenic
1115381047 14:32739550-32739572 CTCACACATATAGAGAGTAGGGG - Intronic
1116027580 14:39534130-39534152 CCCAAACAGATATAGAGCGAGGG - Intergenic
1116283936 14:42947354-42947376 CTTAAAGCAATATAGAGAAATGG + Intergenic
1116309371 14:43303015-43303037 GTTATACATCTATAGAGAAATGG - Intergenic
1116659165 14:47685980-47686002 CAAAAACAAAAATAGAGAAATGG - Intergenic
1117848736 14:59943180-59943202 CAAAAACATAAATAGACAAATGG - Intronic
1118101901 14:62615213-62615235 CTGAAACATAAATGGAGATATGG - Intergenic
1119318500 14:73714851-73714873 CTCACACAAATACACAGAAATGG - Intergenic
1120142402 14:80943472-80943494 TTCAACCATATTTAGAGAATTGG + Intronic
1120785514 14:88531139-88531161 CTCAAAACTATATAAATAAATGG + Intronic
1120887379 14:89462484-89462506 CTGAATCATTTATAAAGAAAAGG + Intronic
1121116504 14:91346896-91346918 CTCAAAAAAAGAGAGAGAAAAGG + Intronic
1121392427 14:93587644-93587666 GTGAATCCTATATAGAGAAAAGG + Intronic
1122869511 14:104630573-104630595 CTCAAATATATAAATAAAAAAGG + Intergenic
1124008898 15:25819059-25819081 CGAAAACAAAAATAGAGAAATGG + Intronic
1125277588 15:38009775-38009797 CTCATTTATATATACAGAAATGG - Intergenic
1126003015 15:44229610-44229632 TTCAAAAAAATATGGAGAAAAGG + Intergenic
1126017799 15:44369717-44369739 CACACACATATATATATAAAGGG + Intronic
1126190016 15:45869305-45869327 CTCAAACTTGTTTGGAGAAATGG + Intergenic
1126223195 15:46239203-46239225 CTCAAATATTCATAGATAAATGG + Intergenic
1126764000 15:51995489-51995511 CTCAAACGTATATGAAGAAGTGG - Intronic
1127545418 15:59990158-59990180 CTCAGAAATGTATACAGAAAAGG + Intergenic
1127977979 15:64012957-64012979 CTACAACATAAATAGGGAAATGG + Intronic
1129316136 15:74745784-74745806 CTCAAAAATAAATAAATAAATGG - Intergenic
1129750166 15:78057125-78057147 CTCAAAGATTTAAAGTGAAAAGG - Intronic
1129964623 15:79723170-79723192 CTCAAACATGAATAGAAACATGG + Intergenic
1130064558 15:80593341-80593363 CTCAACCTTAGATAGACAAAGGG + Intronic
1131630561 15:94172667-94172689 TTCAGACATATATTCAGAAATGG - Intergenic
1132158619 15:99515454-99515476 CTCAAAAATAAATAAATAAATGG - Intergenic
1134255574 16:12608448-12608470 CCAAAACAGATATAGATAAATGG + Intergenic
1135273929 16:21094663-21094685 CTCAAATATATATATATATATGG + Intronic
1135589230 16:23693284-23693306 CTCAAAAATATATATATATAGGG + Intronic
1135690198 16:24530425-24530447 CTGAAAAATATTTAGAAAAAGGG + Intergenic
1135942360 16:26833467-26833489 CTCATATTTATATAAAGAAAGGG + Intergenic
1136609237 16:31356300-31356322 TTTAAAAATATATAGAGACAGGG + Intronic
1137382544 16:48012607-48012629 CTCCAGAATATACAGAGAAATGG - Intergenic
1137414930 16:48267298-48267320 CTCAAAAATATATATATGAATGG - Intronic
1137721983 16:50632829-50632851 ATTAAACATATGAAGAGAAAGGG - Intronic
1138789762 16:59889490-59889512 TTCAGAAATATATAGAGAATAGG + Intergenic
1138849480 16:60609364-60609386 CTAAAACAAAGATAGACAAATGG + Intergenic
1138975137 16:62196681-62196703 GTCAAGCATAAATACAGAAAAGG - Intergenic
1139796776 16:69489328-69489350 CTCATACATACACATAGAAAAGG - Intergenic
1140067416 16:71623611-71623633 TTCATCCATATATAGAGAGATGG + Intergenic
1140150638 16:72361146-72361168 TGAAAGCATATATAGAGAAATGG + Intergenic
1141140797 16:81495643-81495665 CACAAACATAAAAAGAGAAGGGG - Intronic
1142600005 17:1049119-1049141 TATAAACATATATAGGGAAAAGG - Intronic
1142854547 17:2722581-2722603 CTCCAACAAATGGAGAGAAAGGG + Intergenic
1144276791 17:13677675-13677697 CAAAAACATATATTGGGAAATGG + Intergenic
1145739750 17:27263337-27263359 CTGAAACATGTCTAGAGAAAGGG + Intergenic
1147285022 17:39395421-39395443 CTCAAAAATAAATAAATAAAAGG + Intronic
1147533863 17:41305200-41305222 CACAAACACATATATATAAAGGG - Intergenic
1147729396 17:42588656-42588678 CTCAAAAAAATAAAGAGAACAGG - Intronic
1148041436 17:44710511-44710533 CTAAAACATCTAATGAGAAAAGG - Intronic
1149055713 17:52362252-52362274 CACAAAAATATATAGATGAATGG + Intergenic
1150742867 17:67793644-67793666 CTTCAACATATATAAAGAATGGG + Intergenic
1151020579 17:70612347-70612369 CTCAAACAGAGATTGAGAAATGG - Intergenic
1153119984 18:1710525-1710547 CTCAAAGATAAAGAGAGAATGGG + Intergenic
1153213565 18:2794819-2794841 CTCCCACATGTATAGACAAAAGG - Intronic
1154032022 18:10761953-10761975 ATAAAACATATATTTAGAAAAGG - Intronic
1154136845 18:11787209-11787231 CCCAGACAAATATAAAGAAAAGG + Intronic
1154400409 18:14031617-14031639 CTCATAAATATTTAGAAAAATGG - Intergenic
1155774921 18:29749078-29749100 CTCAAATAAATATAGAAAGAAGG - Intergenic
1155970813 18:32081989-32082011 TTCAAACTTACATACAGAAAAGG - Intergenic
1155997906 18:32351645-32351667 CTAAAAAATATACAGAAAAATGG + Intronic
1156123073 18:33868365-33868387 CACAGACATATATAGAAAAATGG + Intronic
1156279276 18:35618794-35618816 CTGAAACAAATATGAAGAAAAGG + Intronic
1157006161 18:43587431-43587453 CACAAACAGAAAAAGAGAAAAGG - Intergenic
1157918143 18:51689829-51689851 CTGAAAGAAGTATAGAGAAAAGG - Intergenic
1158074305 18:53511179-53511201 CTAAAACCTAGAGAGAGAAAGGG - Intronic
1158559526 18:58502352-58502374 CTCAAACAAATAAAAAAAAATGG + Intronic
1158654650 18:59320087-59320109 CACAAACATACATTCAGAAAAGG - Intergenic
1158678528 18:59545372-59545394 CTCACACCGATATAGAGAAAAGG - Intronic
1159406364 18:68007413-68007435 CTCAAACAAAAAAAAAGAAAGGG + Intergenic
1159610905 18:70524676-70524698 CTCAACCATATATATAAATATGG + Intergenic
1161463163 19:4411228-4411250 CTCAAAAATAAATAAATAAATGG - Intronic
1161695417 19:5764615-5764637 CTCAAAAATAAATAAATAAATGG - Intronic
1162622076 19:11851577-11851599 CTAACACTTATATAGGGAAACGG + Intronic
1162889040 19:13718831-13718853 CTCAAAAATAAATAAATAAAAGG + Intergenic
1165429703 19:35765577-35765599 CTCAAAAATAAATAAATAAATGG + Intronic
1167224132 19:48225488-48225510 CTCAAAAATAAATAAATAAAGGG + Intronic
1167869570 19:52356536-52356558 CTCAAAAATATATAAATCAATGG - Intronic
1167872109 19:52379196-52379218 CTCAAAAATATATAAATCAATGG - Intronic
925695995 2:6579446-6579468 CACACACACATATAGAGAGAGGG + Intergenic
925836385 2:7950982-7951004 CTCTCACATACATGGAGAAAAGG - Intergenic
926500519 2:13647590-13647612 CTCAAATATTTTTAAAGAAAAGG - Intergenic
926511536 2:13786998-13787020 CTAAAAAATATACACAGAAAAGG + Intergenic
926726496 2:16002494-16002516 CACAAACATACATATATAAAGGG - Intergenic
927231385 2:20827384-20827406 CACACACATATTTAGAGATAAGG + Intergenic
927294222 2:21435150-21435172 AGCAAACATATAAAGAGAACAGG + Intergenic
927664855 2:25024298-25024320 TCCAAACATATGTGGAGAAAGGG + Intergenic
928020528 2:27701226-27701248 TTTAAAGATATTTAGAGAAAAGG + Intergenic
928813535 2:35259442-35259464 ATCAAATATATGTAGATAAAGGG + Intergenic
929356502 2:41030949-41030971 CTAATACATATATTGAGTAAAGG - Intergenic
929435980 2:41928762-41928784 ATCAGACAAATGTAGAGAAAAGG - Intergenic
929470826 2:42191289-42191311 AGCCAACATATAGAGAGAAATGG - Intronic
930242383 2:48949296-48949318 CTCCAACTCACATAGAGAAAAGG + Intergenic
932943406 2:76196920-76196942 CTGGAACATATTAAGAGAAATGG - Intergenic
933261206 2:80133506-80133528 CCCAAATGTATATAGAGTAAAGG + Intronic
933345614 2:81081593-81081615 CACAAACATAAATAGACAAACGG + Intergenic
933540157 2:83629987-83630009 CTCAAATGTAGATATAGAAATGG - Intergenic
933842350 2:86297881-86297903 CTCAAACACATCTAGGGAAAGGG - Intronic
934043876 2:88154688-88154710 CTGAAACAAAAATAGACAAATGG + Intergenic
935813933 2:106828869-106828891 CTAAAACACAGATAAAGAAATGG + Intronic
935824067 2:106925579-106925601 CTGAAACAGATGTAGAGAATTGG + Intergenic
937778015 2:125804331-125804353 TTTGAACATATATACAGAAATGG - Intergenic
937793602 2:125989872-125989894 CAAAAACATATATTGAGGAAAGG - Intergenic
939230585 2:139420730-139420752 CCCAAACACATCTTGAGAAATGG - Intergenic
939232803 2:139452078-139452100 CTCAAACAAAAATAGACAAATGG - Intergenic
939450304 2:142365091-142365113 CTCACACATATGTAAAAAAAGGG - Intergenic
939734870 2:145830879-145830901 CACAATCCTATATACAGAAAAGG + Intergenic
939931463 2:148239712-148239734 CACACACATATATTGAGATAGGG + Intronic
940603281 2:155887807-155887829 CTAAAACAAAAATAGACAAATGG + Intergenic
941265132 2:163351959-163351981 CGCAAACATACATAAATAAAAGG - Intergenic
941446838 2:165611349-165611371 CACACACATATATCGTGAAATGG - Intronic
941462687 2:165790168-165790190 CTGAAACAATTATAGGGAAAAGG + Intronic
941851355 2:170185403-170185425 CACAAACATACATTGAGGAAAGG - Intronic
941919138 2:170831580-170831602 CACACACATATGTAGAGACAAGG - Intronic
942677462 2:178443462-178443484 TTCAAACATATACATAGAAATGG - Intronic
942943970 2:181653265-181653287 CTGACACAGATATGGAGAAAAGG + Intronic
942954891 2:181762599-181762621 GACAAACAAAAATAGAGAAAGGG - Intergenic
943198502 2:184787852-184787874 CAAAAACAAATATAGACAAATGG - Intronic
943305113 2:186251929-186251951 CACATAAATATATAGAGATATGG + Intergenic
943375583 2:187072524-187072546 CTCAAGCATATGTAGAGAAGAGG - Intergenic
943532841 2:189108101-189108123 ATAAAACATATATAATGAAAGGG - Intronic
943821276 2:192325604-192325626 TTCAAAACTATAAAGAGAAAAGG - Intergenic
943922934 2:193732708-193732730 CACAAATATATACAGGGAAAGGG + Intergenic
945192974 2:207209037-207209059 CTAAAACATATCTAGGGCAAAGG - Intergenic
945315083 2:208361831-208361853 CTCAAACATTTGAAGAAAAATGG - Intronic
945648733 2:212535234-212535256 CTCATATATATATATATAAAAGG - Intronic
945712315 2:213313713-213313735 CTCAAACCAATATAGAAAATAGG - Intronic
946028522 2:216687326-216687348 CCTGAAGATATATAGAGAAAAGG + Intronic
946261852 2:218499409-218499431 CAGAAAAATATATAGAGAGAGGG - Intronic
946583334 2:221155134-221155156 CTCAGACATCTATAGTGCAAAGG - Intergenic
947102828 2:226639593-226639615 CTCAAACATATTTATACAAATGG + Intergenic
1168937269 20:1676170-1676192 CTTAAACATAGATGGAGAAGGGG - Intergenic
1169010559 20:2246644-2246666 TGCAAAAATATATAGAGAGATGG - Intergenic
1169797499 20:9480002-9480024 CACATATATATATAGAGAGAGGG - Exonic
1170116111 20:12861644-12861666 CTCACACATCTTTATAGAAAAGG - Intergenic
1171308870 20:24129798-24129820 CTTAATCATTTATAGAAAAAAGG - Intergenic
1172865905 20:38097087-38097109 GAAAAACATACATAGAGAAAGGG + Intronic
1173230170 20:41188861-41188883 CTAAAACAAAAATAGACAAAGGG - Intronic
1173394781 20:42669181-42669203 CTCAAAAAGATGTGGAGAAAGGG - Intronic
1174895181 20:54441449-54441471 CTTAAACAAACATAGAGACAAGG + Intergenic
1175065385 20:56280473-56280495 CTATAACATATATAGATATATGG + Intergenic
1175710155 20:61213380-61213402 CTCAAGCACCTAGAGAGAAAAGG - Intergenic
1177384600 21:20392387-20392409 CCAAAACATATATAGACCAATGG - Intergenic
1177883666 21:26722984-26723006 TTAAAAGATATGTAGAGAAAAGG - Intergenic
1178540541 21:33445871-33445893 CTCAAACATACTTACAGACAGGG + Intronic
1178567786 21:33704012-33704034 CAGAAACATACCTAGAGAAAAGG - Intronic
1179900708 21:44392256-44392278 CTCAAACATAAAAATAGACAAGG - Intronic
1181935945 22:26438688-26438710 CACACACATATATATATAAAGGG + Intronic
1182000310 22:26914474-26914496 CTCAATCTTAAAAAGAGAAAGGG - Intergenic
1183556252 22:38529609-38529631 ATGAAACATATATAGAGTTATGG + Intronic
1183634210 22:39051236-39051258 CTCAAAAAGATAAAGAGGAACGG + Intronic
1183952770 22:41360934-41360956 CTCAAAAATAAATAAATAAAAGG + Intergenic
1184343664 22:43900112-43900134 CTGAATCATTTATAAAGAAAAGG - Intergenic
949244838 3:1914846-1914868 CTAAAACAGATATAGATTAATGG - Intergenic
949302336 3:2598800-2598822 CTCCAACATATATACATGAAAGG + Intronic
949389964 3:3550019-3550041 AGCATACATATATAGAGAGAGGG - Intergenic
949529976 3:4946276-4946298 CACACATATATAAAGAGAAAGGG - Intergenic
950540918 3:13612209-13612231 GTCAAACATAAAGACAGAAAAGG - Intronic
951015558 3:17728515-17728537 CTGATACATATAGAGACAAACGG + Intronic
951030888 3:17880744-17880766 CACACACATATTTAGAGACAGGG + Intronic
951930903 3:27966189-27966211 CTCAAACAGAGATAGATCAATGG + Intergenic
952264251 3:31770139-31770161 CTGATACAGATAAAGAGAAAAGG + Intronic
952309365 3:32173866-32173888 CTCAATTTTATGTAGAGAAATGG - Intergenic
952335223 3:32398052-32398074 CTTAAACATATATTGAATAAAGG - Intronic
954270349 3:49503096-49503118 TGCAAACATATATGGAGAGATGG - Intronic
954342849 3:49969561-49969583 CACACACATATATACACAAATGG - Intronic
954854906 3:53635588-53635610 CTGAAACCCAGATAGAGAAAGGG - Intronic
956312851 3:67900883-67900905 CTAAACCATATGTGGAGAAATGG + Intergenic
957391143 3:79571518-79571540 CTAATACATTTATAGAGGAAAGG + Intronic
957670444 3:83294407-83294429 CTCAAAAATAAATAAACAAATGG - Intergenic
957791441 3:84946159-84946181 TTTAAACATATTTACAGAAATGG - Intergenic
958070177 3:88599912-88599934 CTGACACATATAAATAGAAATGG + Intergenic
958686239 3:97400198-97400220 CAAAAACATATATTGAGGAAAGG + Intronic
958715051 3:97770316-97770338 CTCAAAAGAATATAGACAAATGG - Intronic
958888794 3:99759975-99759997 CAAAAACATATATAAAGAAGAGG - Intronic
959277173 3:104290927-104290949 TTGAAACATAAATAGAGATATGG - Intergenic
959459783 3:106611201-106611223 GTAAAACATGTAAAGAGAAAAGG - Intergenic
960485116 3:118242206-118242228 CTGAAAGATATATGGGGAAAGGG + Intergenic
960562981 3:119106011-119106033 GCAAAACATATATAGAGCAAAGG + Intronic
962613655 3:137103197-137103219 GTTAAAGAAATATAGAGAAAAGG + Intergenic
963318879 3:143790837-143790859 TTCAAAAATATTTAAAGAAAGGG - Intronic
966759238 3:183401929-183401951 CTCAGACAAATATCTAGAAATGG + Intronic
966897162 3:184454142-184454164 CTCAAATATATATATATATATGG - Intronic
968237587 3:197045044-197045066 CATAAACATATGTAGAAAAAAGG + Intronic
969104949 4:4799875-4799897 GTGAAACATATATCCAGAAAAGG + Intergenic
969382275 4:6810558-6810580 CTAAAACAGAAATAGACAAATGG + Intronic
970012542 4:11475535-11475557 ATCCAACATAGAGAGAGAAAAGG - Intergenic
970165636 4:13234741-13234763 CAAAAACATAAATGGAGAAATGG + Intergenic
970962278 4:21886415-21886437 CTCTGACATAATTAGAGAAATGG - Intronic
971098997 4:23441518-23441540 AAAAAACATATATAGAGAAGAGG - Intergenic
971543573 4:27854672-27854694 ATCTAAAATATATAGAGAAAAGG + Intergenic
971976584 4:33696999-33697021 CTCAGACAAATATGAAGAAATGG - Intergenic
972107408 4:35506756-35506778 CTCAAGCATCTGTAGAAAAATGG + Intergenic
972272712 4:37527497-37527519 TCTAAACATAAATAGAGAAAAGG - Intronic
972927452 4:44028642-44028664 CTAAAACAAAAATAGACAAATGG + Intergenic
974361665 4:60888961-60888983 GTCAAAGGTATAGAGAGAAATGG + Intergenic
974420475 4:61665869-61665891 ATAAAACATGTATGGAGAAAGGG + Intronic
974583656 4:63839997-63840019 CAAAAACAAAAATAGAGAAATGG - Intergenic
974912200 4:68136378-68136400 CTAAAACAAAAATAGACAAATGG + Intergenic
976240581 4:82952104-82952126 ATCAAAGAAAAATAGAGAAATGG + Intronic
976691084 4:87867872-87867894 CCCAAATATATATATAGAAACGG - Intergenic
977342544 4:95777010-95777032 CACAAACAAAAATAGATAAATGG + Intergenic
977517572 4:98040575-98040597 CAAAAACATATATAGGGAAAAGG - Intronic
977527976 4:98167156-98167178 CTCAAACAAATCTAGAGGGAGGG - Intergenic
977958442 4:103057315-103057337 CACAAACATATTTTGAGACAAGG + Intronic
977963432 4:103112110-103112132 CTCACACATATATATGGACATGG - Intronic
978046191 4:104131066-104131088 CTAAAATATATATAGGAAAATGG + Intergenic
978182218 4:105812682-105812704 TTAAAACATATATATATAAATGG - Intronic
978571927 4:110147412-110147434 CAAAAACAAATATAGACAAATGG + Intronic
978624232 4:110666336-110666358 CTCACACAATTAAAGAGAAAGGG + Intergenic
979169273 4:117579628-117579650 TTCTAACATACGTAGAGAAAGGG + Intergenic
979382315 4:120021577-120021599 CTCAAACATATATTGAAATTAGG + Intergenic
979542680 4:121903768-121903790 CTAAAACATACATAGAGATTTGG + Intronic
979553961 4:122023580-122023602 CTAAAACATAAATTGGGAAAAGG + Intergenic
980277165 4:130667779-130667801 CTCAGAAATGTATAGAGTAATGG + Intergenic
980397634 4:132235346-132235368 CAAAAACAAAAATAGAGAAAAGG + Intergenic
980840421 4:138253461-138253483 CTCAAAAATAAATAGAAAATTGG + Intergenic
981021921 4:140038536-140038558 ATCACACATATTTAGAGCAATGG + Intronic
981266989 4:142796980-142797002 CTCAAACATAAACAGAAAATTGG + Intronic
981988299 4:150884551-150884573 CTCTAAGATATATAGAAACATGG + Intronic
982434250 4:155364870-155364892 TGCAAACAAATATAGATAAAAGG + Intronic
982954340 4:161743394-161743416 CTAAAACATATGTAGACCAATGG - Intronic
983864883 4:172754237-172754259 CACATACATACATACAGAAAAGG + Intronic
984181844 4:176493036-176493058 CTCAAACATCTAAAAAAAAAGGG - Intergenic
984542013 4:181050910-181050932 CTTTAACTTATATGGAGAAAAGG + Intergenic
985586710 5:743209-743231 CAGAGACAGATATAGAGAAATGG - Intronic
985601293 5:835396-835418 CAGAGACAGATATAGAGAAATGG - Intronic
986865453 5:11981307-11981329 CACACACATATATAGACACATGG - Intergenic
987831085 5:23096052-23096074 CTCACACAGTTTTAGAGAAAGGG - Intergenic
988188153 5:27894264-27894286 TTAAAGCATATATTGAGAAAAGG + Intergenic
988440933 5:31231854-31231876 CTCTAACATAAAGAGATAAAAGG + Intronic
988512971 5:31881312-31881334 CACACACATATATATGGAAATGG - Intronic
988804069 5:34724014-34724036 CTCAAAAATAAATAAATAAAAGG - Intronic
990440746 5:55842553-55842575 CTGAAAGTTATTTAGAGAAAGGG - Intergenic
990687620 5:58324180-58324202 CACAAACATATATACATATATGG - Intergenic
990969418 5:61486943-61486965 CAGAAACAAAAATAGAGAAATGG - Intronic
991139235 5:63219960-63219982 CTCAAATATATACCTAGAAACGG - Intergenic
991209329 5:64086150-64086172 CTTAAAGACAGATAGAGAAAAGG - Intergenic
991277977 5:64873689-64873711 CTAAAACAAAAATAGACAAATGG - Intronic
991722507 5:69506908-69506930 CTGCAACATACATAAAGAAAAGG + Intronic
992179872 5:74185394-74185416 CTCAAACCTATAAGGGGAAATGG - Intergenic
992545129 5:77806453-77806475 CTGAAACAAATATGGACAAATGG - Intronic
992689974 5:79232814-79232836 CTCAAAAATAAATAAATAAATGG - Intronic
992705300 5:79385238-79385260 CTAAAACAAAAATAGACAAATGG + Intronic
992706094 5:79394582-79394604 TTCATACATTTATTGAGAAAGGG + Intronic
993027450 5:82663108-82663130 TTCAGAAATATATAGAGTAATGG + Intergenic
993698066 5:91085251-91085273 CACACATATATATAGAAAAAAGG + Intronic
993892188 5:93487885-93487907 CCAAAACATATATAGACCAATGG + Intergenic
994259830 5:97644222-97644244 CTAAAACAAAAATAGACAAATGG + Intergenic
994777729 5:104056149-104056171 CTCAAAAAGAAATAGACAAATGG - Intergenic
994867516 5:105295400-105295422 CACAAACATATTAAGAGCAAGGG + Intergenic
994871699 5:105359651-105359673 CTCAAATACATATATAAAAAAGG - Intergenic
995175832 5:109175577-109175599 CTAAAACAAAAATAGACAAATGG + Intronic
995758730 5:115542397-115542419 CACAAACAAATATAGAATAAGGG + Intronic
996123306 5:119695398-119695420 CAAAAACAAAAATAGAGAAAAGG - Intergenic
996261562 5:121477137-121477159 TTCAAATATAAATAGAGACATGG + Intergenic
996264278 5:121516384-121516406 CTTAAACATATATAGAGATGAGG - Intergenic
996570355 5:124927109-124927131 ATCAAACATTCATATAGAAAAGG - Intergenic
998610973 5:143687836-143687858 CTCAAATATTAAAAGAGAAATGG - Intergenic
998840503 5:146248946-146248968 TACATACATATATAGAAAAATGG - Intronic
999045369 5:148462605-148462627 CTAAAACAGATTTAGAGAATTGG - Intronic
999311044 5:150552404-150552426 TTTAAAAATATATAGAAAAAGGG + Intronic
999341249 5:150775296-150775318 CTCAAACATATAAAAATAAGAGG + Intergenic
999464754 5:151792219-151792241 CTTAAGCATGTATATAGAAATGG + Intronic
999557227 5:152756738-152756760 CCAAAACATATATAGACCAATGG + Intergenic
999588255 5:153115319-153115341 CACAAATTTATATAGAGTAAAGG + Intergenic
999669533 5:153946393-153946415 ATCAAACAGATATTCAGAAAGGG + Intergenic
1000688163 5:164279095-164279117 CTCAAAAATATATATGGGAATGG + Intergenic
1000959881 5:167587204-167587226 CTTAAAGATATAGAAAGAAAGGG - Intronic
1001180799 5:169518357-169518379 CCAAAACATATATAGACCAATGG - Intergenic
1001451549 5:171828979-171829001 CACAAACAAATATTGGGAAATGG - Intergenic
1001681276 5:173558847-173558869 TTCAACCATATATAGAGATAGGG - Intergenic
1001723704 5:173878124-173878146 TTCAAACATATATACAGCCATGG - Intergenic
1001790324 5:174451383-174451405 CAAGAACATATATTGAGAAAAGG + Intergenic
1002975776 6:2074521-2074543 CTAAAACAAAAATAGACAAATGG - Intronic
1002984833 6:2178902-2178924 CACAAACAAGTATAGACAAATGG + Intronic
1003166307 6:3681876-3681898 AGCAAACCTATAGAGAGAAAAGG - Intergenic
1005414890 6:25589487-25589509 CTCAAAAATAAATAAATAAAAGG - Intronic
1005420558 6:25644367-25644389 CACACACATATATATATAAAGGG + Intergenic
1005664147 6:28033664-28033686 CACAGACATATATAAAGAATAGG - Intergenic
1006547192 6:34790044-34790066 CTGAGACATATAAAGACAAAAGG - Intergenic
1008446684 6:51599832-51599854 CTCAAACAAAGATATACAAATGG + Intergenic
1008890166 6:56478898-56478920 CAAAAACAAATATAGACAAATGG + Intronic
1010484639 6:76395167-76395189 CTAAAACAAAGATAGACAAATGG - Intergenic
1010976215 6:82316849-82316871 TTCAAAAATATAGAGAAAAAGGG + Intergenic
1011118666 6:83925491-83925513 GTTTAACATATATATAGAAAAGG + Intronic
1011317154 6:86048022-86048044 CACAAACATACATTGAGGAAAGG - Intergenic
1011586815 6:88934940-88934962 CTCAAACAACAATAGACAAATGG - Intronic
1011631843 6:89334368-89334390 GTAAAACATATACAGAAAAAAGG + Intronic
1011972834 6:93249216-93249238 ATCAAACAAATATATACAAATGG + Intronic
1012163032 6:95911681-95911703 ATTAAAAATATATAGAGAGAAGG - Intergenic
1012264685 6:97127567-97127589 CTTTAGCTTATATAGAGAAAAGG + Intronic
1012317954 6:97803457-97803479 CTCACAGATGTACAGAGAAATGG - Intergenic
1012738257 6:102978698-102978720 CTCAAAAGTATATATACAAATGG + Intergenic
1013156637 6:107497583-107497605 ATATATCATATATAGAGAAAGGG - Intronic
1013567461 6:111381732-111381754 TTCAAATATATAAAGTGAAAAGG + Intronic
1014131887 6:117844915-117844937 CATAAACAAAAATAGAGAAATGG + Intergenic
1015058526 6:128934030-128934052 CTAAAATAAATATAAAGAAAAGG - Intronic
1015084222 6:129268185-129268207 CAAAATCTTATATAGAGAAAAGG - Intronic
1015259491 6:131219313-131219335 CTCCAACAAAAATGGAGAAATGG - Intronic
1015310267 6:131759348-131759370 TACAAACGTATATAGAGGAAAGG + Intergenic
1015471098 6:133607342-133607364 CTCAAAAATAGAAAGAGAAAAGG + Intergenic
1015610950 6:135017611-135017633 TTTAAAAATATATAAAGAAAAGG + Intronic
1015773342 6:136791287-136791309 CTCAAAACTACACAGAGAAAAGG + Intronic
1016136454 6:140549824-140549846 CTCAAAATAATATAGATAAATGG - Intergenic
1016646571 6:146416088-146416110 CTTAAACATATAAACACAAAAGG - Intronic
1016664241 6:146616435-146616457 CACAAACAAAAATAGACAAATGG - Intronic
1016807204 6:148223913-148223935 ATTATACATATATAGAGATATGG - Intergenic
1017640297 6:156487317-156487339 CTCAAAAATAAATAAATAAAAGG - Intergenic
1017793996 6:157824455-157824477 CTCAAAAACAAATAGACAAAGGG - Intronic
1018130641 6:160729594-160729616 CTCAAAAATATATTAAGGAAAGG + Intronic
1018944403 6:168336332-168336354 CTCACACATATATGGAGTCAGGG + Intergenic
1019227985 6:170530901-170530923 CTAAAACCTATAAAGAGACATGG - Intergenic
1020167774 7:5821639-5821661 CACACACATATATATAAAAAAGG - Intergenic
1020248181 7:6447007-6447029 CTCAAAAAAATAAAAAGAAAAGG + Intronic
1020392313 7:7671296-7671318 CTCAAATAAATAAAGAGAAGAGG - Intronic
1020512590 7:9076955-9076977 CTCAAACAGACAAAGACAAATGG - Intergenic
1020678750 7:11210475-11210497 CTCAAAAATAAAAAGCGAAAGGG + Intergenic
1021074301 7:16282147-16282169 CTTAAATATAAATAGAAAAAAGG - Intronic
1021294049 7:18881843-18881865 AGCAAACATGTATGGAGAAAAGG + Intronic
1021500203 7:21324331-21324353 TTCACAAAAATATAGAGAAATGG - Intergenic
1021691805 7:23237469-23237491 CTCAAATATTTATAGCTAAATGG - Intronic
1021909967 7:25375737-25375759 CTTAAGCATATATGAAGAAATGG + Intergenic
1021916884 7:25443036-25443058 GGCAAACAAAAATAGAGAAAAGG - Intergenic
1022154810 7:27649444-27649466 CTAAAACAAATCTAAAGAAAAGG + Intronic
1023321298 7:39000664-39000686 CTCAAACATATTTGTTGAAATGG + Intronic
1023692815 7:42809321-42809343 TTCAAACATATAGAGAAAGAGGG + Intergenic
1023930908 7:44705938-44705960 CTCAAAAAAATATAGAAAAGTGG - Intronic
1023947063 7:44811590-44811612 CTCAAACTTCTATAGATATATGG - Intronic
1024016618 7:45322227-45322249 CTCACACAAATATATATAAAAGG - Intergenic
1024039296 7:45538017-45538039 CACAAACATACATACAGAGAGGG + Intergenic
1024162029 7:46686538-46686560 TTCAAATATATATATACAAAAGG + Intronic
1024347344 7:48326464-48326486 ATCAAACATATATTGAGTAGAGG + Intronic
1024362292 7:48480781-48480803 CCCAAACTTACATACAGAAAAGG + Intronic
1024850194 7:53704738-53704760 CACACACATATATAGATATATGG - Intergenic
1025195023 7:56925901-56925923 CTCAAAAATAAATAAATAAAAGG + Intergenic
1025676929 7:63651042-63651064 CTCAAAAATAAATAAATAAAAGG - Intergenic
1025841162 7:65151002-65151024 CTTAGACATATACAAAGAAAAGG + Intergenic
1027823371 7:83078137-83078159 CTCAAATATAAACAGATAAATGG + Intronic
1027923391 7:84427127-84427149 CTCTAGGAAATATAGAGAAAAGG - Intronic
1028174594 7:87640037-87640059 TATAAACATATATAAAGAAATGG - Intronic
1028992997 7:97070059-97070081 CTCAAAAGAATATACAGAAAAGG - Intergenic
1029310719 7:99661130-99661152 CTCAAACATATATAGAGAAAAGG - Intronic
1029315702 7:99711366-99711388 CTCAAACATATCTAAAGGAAAGG - Intronic
1029673306 7:102048826-102048848 CTCAAAAATAAATAAATAAAGGG + Intronic
1029881740 7:103819622-103819644 CTCATACAAATATATAGTAAGGG - Intronic
1030260116 7:107555162-107555184 ATCAAACATCTGTAGGGAAAAGG - Intronic
1030611615 7:111695944-111695966 CTCAAAAGTATAGAGAAAAAGGG - Intergenic
1030756871 7:113296365-113296387 CAAAAACATATACTGAGAAAAGG + Intergenic
1031307527 7:120149926-120149948 TTCTAACATATATACAAAAAGGG - Intergenic
1031767195 7:125795480-125795502 CACACACATCTATAGAGAGAAGG - Intergenic
1031925967 7:127638933-127638955 CTCAAAAATAAATAAATAAAAGG - Intergenic
1032639956 7:133755196-133755218 CACACACATATATAAACAAATGG - Intronic
1032891056 7:136195431-136195453 CAAAAACATAAATAGACAAATGG - Intergenic
1033339390 7:140479759-140479781 CTCAAATATTACTAGAGAAATGG - Intergenic
1033702097 7:143849619-143849641 CAAAAGCAAATATAGAGAAATGG + Intergenic
1034653863 7:152713065-152713087 CTCAAAAAAAAATAAAGAAAAGG - Intergenic
1035711702 8:1721732-1721754 CCAAAACAGATATAGACAAATGG + Intergenic
1035828896 8:2673296-2673318 ACCAAACAGAAATAGAGAAAGGG - Intergenic
1036012234 8:4739424-4739446 CTCTACAATATAAAGAGAAAAGG + Intronic
1036071801 8:5448826-5448848 CATATACATATATACAGAAATGG - Intergenic
1036198797 8:6748439-6748461 CTCAAACAGATATTTTGAAAAGG - Intronic
1036542186 8:9726900-9726922 CACACACATATATATACAAATGG - Intronic
1037137849 8:15484831-15484853 ATTTAAAATATATAGAGAAATGG + Intronic
1037661501 8:20931124-20931146 CTATAACAATTATAGAGAAAAGG - Intergenic
1038160211 8:25030176-25030198 CACACACATATTTAGAGACAGGG + Intergenic
1039034981 8:33350078-33350100 CTCAAACAAAGATATATAAATGG - Intergenic
1039155603 8:34553187-34553209 CAGAAATAGATATAGAGAAATGG + Intergenic
1039195518 8:35027061-35027083 CTCAAAGACACATACAGAAAAGG - Intergenic
1040033282 8:42845032-42845054 CTCAGATCTATATAAAGAAAAGG - Intergenic
1041078948 8:54196297-54196319 CTCAAACAAAGATATACAAATGG - Intergenic
1041995663 8:64054297-64054319 CTCAAACGTATTTAGGGACAGGG - Intergenic
1042129441 8:65572675-65572697 CTAAAACAAAAATAGACAAATGG - Intergenic
1043193784 8:77263877-77263899 CTCAAATATATATAAATATATGG + Intergenic
1043213715 8:77558659-77558681 CACAAGCAAATATAGACAAATGG + Intergenic
1043645653 8:82515073-82515095 CTAAAAAATATATAGCAAAAGGG - Intergenic
1043668620 8:82851309-82851331 TTCAACCATCTATAGAAAAATGG - Intergenic
1043863973 8:85354512-85354534 CTCACACATATACAAAGTAAAGG + Intronic
1044032004 8:87249953-87249975 CCAAAGCATAAATAGAGAAATGG + Intronic
1044620201 8:94183376-94183398 CATAAACATATATAGATCAATGG + Intronic
1045471894 8:102520084-102520106 CTCAAAAATATACAGATGAAAGG + Intergenic
1045594682 8:103638719-103638741 ATCAAAGATATTTTGAGAAATGG - Intronic
1045958092 8:107933464-107933486 CACACACACATATAGAGAGAGGG - Intronic
1045997280 8:108377738-108377760 CTCAAAGATATATGGACAAGCGG - Intronic
1046028850 8:108758880-108758902 ATCAAAGCTATATAGATAAAGGG + Intronic
1046578812 8:116066584-116066606 CTCAAATATATATAGAAGTATGG - Intergenic
1047333706 8:123916440-123916462 GGCAAACATATGGAGAGAAAAGG - Intronic
1047552570 8:125891668-125891690 ATAAAACAGAAATAGAGAAATGG - Intergenic
1047730198 8:127721433-127721455 CACAAACATTTGTACAGAAATGG + Intergenic
1048096673 8:131303101-131303123 CACAAACAAAAATAGACAAATGG - Intergenic
1050496066 9:6243800-6243822 CTTAAAGATGTACAGAGAAATGG - Intronic
1050556252 9:6792020-6792042 CTCAAAAAGAAAAAGAGAAAAGG + Intronic
1051442956 9:17106490-17106512 CAAAAACAAATATAGACAAATGG - Intergenic
1051590316 9:18770837-18770859 CCCAGACATATACATAGAAAAGG + Intronic
1051828470 9:21248644-21248666 CTCAAAAATAGATATAGATATGG + Intergenic
1052302290 9:26966308-26966330 CTGACAAATATATAAAGAAAAGG - Intronic
1052397909 9:27963357-27963379 CTCAAACAGATACAGTGATAAGG + Intronic
1052576354 9:30296976-30296998 CTCAAAAATCAATATAGAAACGG + Intergenic
1052649412 9:31281766-31281788 CACAAGCATACACAGAGAAAAGG - Intergenic
1053156544 9:35784766-35784788 TTTAAAAATATATAGAGATAGGG - Intergenic
1054801608 9:69355327-69355349 ATCAGACACATATATAGAAATGG + Intronic
1055786509 9:79874734-79874756 CACAAACATTTATGGAGAAAAGG + Intergenic
1055959545 9:81807437-81807459 CTCAAAAATAAATAAATAAATGG + Intergenic
1056308700 9:85318697-85318719 CTCACACATATATTGACTAATGG + Intergenic
1056786526 9:89596526-89596548 CTGAAACAAATATAGTAAAATGG + Intergenic
1057493501 9:95541406-95541428 CTCAATCATATAGAGAGAGGAGG - Intergenic
1058148708 9:101440812-101440834 TTCAAAGACATATGGAGAAATGG - Intergenic
1058218682 9:102267867-102267889 CAAAAACATATATTGGGAAATGG - Intergenic
1058624402 9:106919497-106919519 TTGAAACATATATACAGAAATGG - Intronic
1058690039 9:107512246-107512268 CTCAAAAATAAATAAATAAAAGG + Intergenic
1058738037 9:107913876-107913898 GTCAAACATATAATGAGAAAAGG + Intergenic
1059143335 9:111874999-111875021 CTCAAAAATAAATAAATAAATGG - Intergenic
1059294170 9:113254896-113254918 CTCAAAAATAAATAAATAAAAGG + Intronic
1059615003 9:115940216-115940238 TTCAAACAAAGATATAGAAATGG - Intergenic
1060121785 9:120998384-120998406 CACAAACATGTAAAGAGACAGGG - Intronic
1061976764 9:134072269-134072291 CTCAAAAAAATAAAAAGAAAAGG + Intergenic
1185481938 X:453197-453219 CTCTATCATATAGAGAAAAATGG + Intergenic
1185706352 X:2270156-2270178 ATCAAAAATTTATAGGGAAATGG - Intronic
1185879898 X:3731677-3731699 CTCAAAAATAAATAAATAAAAGG + Intergenic
1185911360 X:3984040-3984062 GTCAAAAATACATACAGAAAAGG - Intergenic
1186370800 X:8945157-8945179 CTAGAATAAATATAGAGAAATGG + Intergenic
1187044394 X:15632125-15632147 CTCATAAATATAGAGAGAAGAGG + Intronic
1187706043 X:22010297-22010319 CTGAAGCAAAAATAGAGAAAAGG + Intergenic
1188208580 X:27391415-27391437 CACAAACAAAAATAGAGAAATGG + Intergenic
1188280809 X:28266684-28266706 CACACACATATAGAGAGAGAGGG + Intergenic
1188402630 X:29765857-29765879 CACAAACGCATATAGAGTAATGG + Intronic
1188636997 X:32445816-32445838 CTCAATAAAATATTGAGAAATGG + Intronic
1188913876 X:35886221-35886243 CTATAACAGATAGAGAGAAATGG - Intergenic
1189539618 X:41972263-41972285 GACAAACATATACAGAGAGAAGG - Intergenic
1189876007 X:45436636-45436658 CTCTAACCTATTAAGAGAAAGGG - Intergenic
1190715985 X:53104038-53104060 CTCAAAAATAAATAAATAAAAGG - Intergenic
1191010356 X:55750694-55750716 CTCAGACACATATATAGATATGG - Intronic
1191829920 X:65406055-65406077 CACAAACATTTAAAGAGAACTGG + Intronic
1192096180 X:68213357-68213379 CTCAAACAAATATATGGAAATGG + Intronic
1192526416 X:71848803-71848825 CTCAAATATATACAAAGAGAGGG - Intergenic
1192724625 X:73735739-73735761 CACAAACAAAAATAGAGAAATGG - Intergenic
1192991021 X:76456338-76456360 CTTAAAGAAATTTAGAGAAAAGG + Intergenic
1193614301 X:83669024-83669046 CTCAAAGATAGCTAGAGAGAAGG + Intergenic
1193840494 X:86403163-86403185 CACAAACAAAAATTGAGAAATGG + Intronic
1193913644 X:87338199-87338221 TTCATACATATATAGACATATGG - Intergenic
1194064483 X:89244629-89244651 CTAAAACAAATATGGAGCAATGG - Intergenic
1194065973 X:89262387-89262409 ATCAAACATATTTATAAAAATGG - Intergenic
1194347745 X:92786626-92786648 CCCATATATATATAGAGAGAGGG - Intergenic
1194681391 X:96858385-96858407 CTCAAACAGATGTGGTGAAATGG + Intronic
1194967071 X:100300417-100300439 CTCCAGCTTATATAGAGAGATGG + Intronic
1195040217 X:101007267-101007289 ATCCAATATATCTAGAGAAATGG + Intergenic
1195091242 X:101461264-101461286 GTCAAATTTATACAGAGAAAAGG - Intronic
1195099379 X:101539620-101539642 CTCAAAAATGTAAAGAAAAAAGG + Intergenic
1195293116 X:103448454-103448476 CTAAAACATAAATTGAGGAAAGG - Intergenic
1195445203 X:104944791-104944813 CTCTAAGATATATACAGAAGAGG - Intronic
1195551889 X:106180940-106180962 CATAAACAGATATAGAGACATGG - Intronic
1195926277 X:110028912-110028934 CTCAAAAATATATAAAGTAAAGG - Intronic
1196715108 X:118803270-118803292 TTCAAACATATATAGAAGTAAGG + Intergenic
1196998437 X:121410075-121410097 CTGAAAAAGATATAAAGAAAAGG - Intergenic
1197334510 X:125195826-125195848 CTGGAACATATATAAAGAATTGG + Intergenic
1197387495 X:125819297-125819319 CTAAAACAAAAATAGACAAATGG - Intergenic
1197523664 X:127533089-127533111 CAAAAACATAAATAGACAAATGG + Intergenic
1197992989 X:132338444-132338466 CAAAAACAAAAATAGAGAAATGG - Intergenic
1198573898 X:137989109-137989131 CTGGAACATAGATAGATAAATGG + Intergenic
1198715011 X:139549293-139549315 CTGAAACAGTTACAGAGAAATGG - Intronic
1198855776 X:141014492-141014514 CTAAAACAAACATAAAGAAAAGG + Intergenic
1198876353 X:141231647-141231669 CTAAAACAAACATAAAGAAAAGG - Intergenic
1198906917 X:141572876-141572898 CTAAAACAAACATAAAGAAAAGG - Intergenic
1198909877 X:141601583-141601605 CTAAAACAAACATAAAGAAAAGG + Intronic
1198917209 X:141686556-141686578 CTAAAACAAACATAAAGAAAAGG - Intronic
1199334445 X:146601484-146601506 ATCAAACATAGATGGATAAATGG - Intergenic
1199366628 X:146993534-146993556 CAGAAACAATTATAGAGAAATGG - Intergenic
1200279591 X:154765228-154765250 TCCAAACATTTAAAGAGAAAGGG - Intronic
1200718654 Y:6578711-6578733 CTAAAACAAATATGGAGCAATGG - Intergenic
1200783889 Y:7241639-7241661 CTCAAAAATAAATAAATAAATGG + Intergenic
1200978272 Y:9236851-9236873 CTCAAAAATGTATACAGAAATGG + Intergenic
1201603404 Y:15757113-15757135 CTCAAACATAACTATAAAAATGG - Intergenic
1201751861 Y:17441041-17441063 CCAAAACATATCTAGACAAATGG - Intergenic
1201853941 Y:18520215-18520237 CTCTAACATATTTAAATAAAGGG + Intergenic
1201879380 Y:18800169-18800191 CTCTAACATATTTAAATAAAGGG - Intronic