ID: 1029310958

View in Genome Browser
Species Human (GRCh38)
Location 7:99663804-99663826
Sequence ATAAAGAAGGAGATTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 779
Summary {0: 1, 1: 0, 2: 3, 3: 70, 4: 705}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029310958_1029310963 -10 Left 1029310958 7:99663804-99663826 CCTTCCCCAATCTCCTTCTTTAT 0: 1
1: 0
2: 3
3: 70
4: 705
Right 1029310963 7:99663817-99663839 CCTTCTTTATTTCTACCAAATGG 0: 1
1: 0
2: 4
3: 21
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029310958 Original CRISPR ATAAAGAAGGAGATTGGGGA AGG (reversed) Intronic
900747388 1:4370262-4370284 AAAAAGAAAGAAATTGGGGATGG + Intergenic
900932855 1:5747714-5747736 AGGAAGAAGGAGATGGAGGAGGG + Intergenic
901218654 1:7569807-7569829 ATAATGATGGTGATTGGTGATGG - Intronic
901243603 1:7710719-7710741 ATAGAGGAGGAGAGTGGGGTGGG - Intronic
901480167 1:9519658-9519680 AAAAAGAGGGAGGTTGGGGAGGG + Intergenic
901897569 1:12327482-12327504 ATAAAAAAGGAGGGTGGGGGTGG - Intronic
902365986 1:15974869-15974891 ATAAAGAAGCAGACTGGGCCGGG - Intronic
902388703 1:16090449-16090471 ACAGATAAGGAGATTGGGGTAGG - Intergenic
903131167 1:21280360-21280382 ATAAAGAAACAGACTGGGGTGGG + Intronic
903367238 1:22812512-22812534 AGAATGAAGGAAATTGGGGGCGG + Intronic
903747233 1:25595849-25595871 ACAGAGAAGGAGGTTGGGAATGG + Intergenic
903790576 1:25890210-25890232 CAGAAGAAGGAGCTTGGGGAAGG + Intronic
904132309 1:28284039-28284061 ATAGATAAGGAAATTGAGGAGGG - Intergenic
904424234 1:30413310-30413332 ATAATGAAGAAGATTGGGGAGGG + Intergenic
904797696 1:33069822-33069844 ATATAGAATGAGAGTGGGGAAGG - Intronic
905293105 1:36936591-36936613 ATAAAGCTGGAGAATGGGAATGG - Intronic
907555449 1:55339766-55339788 TTACAGGAGGAAATTGGGGATGG - Intergenic
907644397 1:56227453-56227475 ACAAAGTAGGAAAATGGGGAAGG + Intergenic
908185431 1:61648253-61648275 ATAAAGAAGGAGATGTGGCAAGG + Intergenic
909620339 1:77660196-77660218 ATAAAAAAAAATATTGGGGAGGG - Intronic
910243904 1:85118789-85118811 AGGAAGAAGGAGGTTGGGGAAGG + Intronic
910399209 1:86821639-86821661 AAGAAGATGGAGATTGGAGATGG - Intergenic
911218345 1:95219973-95219995 GTACAAAAGGAGAGTGGGGAAGG - Intronic
911376773 1:97061162-97061184 ATAAAGAGGGTTTTTGGGGATGG + Intergenic
911405165 1:97428160-97428182 ATAAACAAAGAGGTTGGGCAAGG - Intronic
911452693 1:98085018-98085040 ATAATGAAAGAGATAGGGAATGG - Intergenic
911975426 1:104488780-104488802 TTACAGAAGGAGGTTGGGTAAGG - Intergenic
912556395 1:110519212-110519234 ATTACGAATGAGATTGGGCATGG - Intergenic
912918193 1:113839238-113839260 AAAAAGAAGAAGATTGAGCATGG - Intronic
912962169 1:114206017-114206039 ATAAAGCAGGAGAGTGTGGAGGG + Intergenic
913062495 1:115220988-115221010 ATAAAGAGAGAGAGTGGGGGTGG + Intergenic
915186101 1:154106279-154106301 ATAAATAAAAAGATTGGGAAGGG + Intronic
915582146 1:156820233-156820255 ACAAATAAATAGATTGGGGAAGG - Intronic
915597535 1:156904114-156904136 AGAAGGAAGGAGATTAAGGAAGG - Intronic
915715078 1:157937816-157937838 ATGAAGAATGAGCTTGGAGAGGG + Intergenic
915918447 1:159956173-159956195 ACAAAGAAGGAGGCTGGGCAAGG + Intergenic
916240265 1:162632363-162632385 ATTAGGAAGGGGGTTGGGGAGGG - Intronic
916344464 1:163772240-163772262 GAAGAGAAGCAGATTGGGGAGGG + Intergenic
916810354 1:168300261-168300283 CGAAGGAAGGAGAATGGGGAAGG + Intronic
917577976 1:176344344-176344366 AGAAAAAATGAGATTTGGGAGGG - Intergenic
917674557 1:177306334-177306356 ATAAGGAAGGTGATGGGGAATGG + Intergenic
917680255 1:177358753-177358775 AGAAAGAAAGAGAGTGGGGGAGG + Intergenic
917790842 1:178497807-178497829 ATTAATAAGCAGATCGGGGAGGG + Intergenic
918083776 1:181227988-181228010 ATGAAGAAGGAGAAATGGGATGG - Intergenic
918669019 1:187189842-187189864 CTTAAGCAGGAAATTGGGGATGG - Intergenic
918754662 1:188324231-188324253 ATAGTGAAGGAGATTGGGGCAGG + Intergenic
919076580 1:192820758-192820780 ATAATGAAATATATTGGGGAGGG + Intergenic
919430698 1:197487724-197487746 ATAATGAAGGATTTTGGAGAAGG + Intergenic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
919666793 1:200300252-200300274 ATAAGGAAGGAGAGTAGTGAAGG - Intergenic
919767711 1:201138068-201138090 AGAAAGGATGAGATTGGGAATGG - Intronic
920065921 1:203269672-203269694 AAAAGGAAGGAGAGTGGGGTGGG + Intronic
920079110 1:203359473-203359495 AAGAAGTAGGAGATGGGGGAGGG - Intergenic
920281268 1:204845576-204845598 TTAAAGGAGGAGATTTGGGGTGG + Intronic
920776871 1:208947264-208947286 AGAAGGAAGGAGGGTGGGGAGGG + Intergenic
920880715 1:209877971-209877993 ATAAAGATTCTGATTGGGGAAGG + Intergenic
921425023 1:214991574-214991596 ATAAAGAAGGAGGTATGGGTTGG - Intergenic
921447926 1:215268508-215268530 ATAACGAAGTATCTTGGGGATGG + Intergenic
921627212 1:217389993-217390015 ATAAAGATGAAGATTAGGGAGGG + Intergenic
922036923 1:221857913-221857935 ATAAAGAAGGGAGTTGGGGTGGG + Intergenic
922509960 1:226157155-226157177 AAAAGGAAAGAGACTGGGGAAGG - Intronic
922985480 1:229863057-229863079 AAAAAGAAGGAGATTCTGGCTGG - Intergenic
922995927 1:229961443-229961465 AAAAAGCAGGGGCTTGGGGAGGG + Intergenic
923492189 1:234493771-234493793 GGGAAGAAGGAGAGTGGGGAAGG + Intergenic
1063903537 10:10760272-10760294 ATAAAGAGGGGGACTGGGGTAGG - Intergenic
1065826646 10:29578593-29578615 ATAAAGAAGAACATTTAGGAAGG - Intronic
1066187183 10:33021591-33021613 ATAAAGAAGGAAATGGAGGCTGG + Intergenic
1066249278 10:33617221-33617243 CTAAAGAAGGGGGTTGGGGAGGG + Intergenic
1066364099 10:34760149-34760171 AAAAAAAGGTAGATTGGGGAGGG - Intronic
1067005134 10:42653736-42653758 ATAAAGAAGGACATTGAGATAGG + Intergenic
1068436178 10:56994040-56994062 ATAAAGAAGGTGGTAAGGGAAGG - Intergenic
1068475179 10:57515294-57515316 ATAAATAAGTATATTGGGCAGGG - Intergenic
1068894173 10:62181311-62181333 ATACAGAGTGAGTTTGGGGATGG + Intergenic
1069580399 10:69562136-69562158 GCAAAAAAGGATATTGGGGAAGG + Intergenic
1069915380 10:71783839-71783861 GTAAAAAAGGATATTGGGAAGGG - Intronic
1070761957 10:79029504-79029526 AAAAAGAAAGAGATTAGGCAGGG - Intergenic
1071427037 10:85569033-85569055 AAAAAGAGAGAGATTGGGTAGGG - Intergenic
1071479322 10:86052693-86052715 ATAGAGAAGAAGAATGGGAAAGG + Intronic
1071507132 10:86239479-86239501 ATAAAAAATGAGACTTGGGAGGG + Intronic
1071708567 10:88026268-88026290 ATAAAGAAGGATCTTGGGCAAGG - Intergenic
1071858606 10:89650164-89650186 CTCAGAAAGGAGATTGGGGAAGG + Intergenic
1071981519 10:91008638-91008660 ATACTTAAGGTGATTGGGGAGGG - Intergenic
1072603892 10:96961024-96961046 GTTAGGAAGGAGATTGGGGTGGG + Intronic
1073036861 10:100570026-100570048 ATAAAGAGGGACTTGGGGGAGGG + Intergenic
1073139400 10:101237424-101237446 AGGAAGAAGAAGATGGGGGAGGG - Intergenic
1073167994 10:101474822-101474844 AAAAAGACGGAAAATGGGGAAGG - Intronic
1073546882 10:104356939-104356961 ATAATGAAGAAGAATGGGTATGG - Intronic
1073712273 10:106057206-106057228 ATAAAGAAGGGGAAAGGGAAAGG - Intergenic
1073849215 10:107595015-107595037 ATACTGAATGAGATTGTGGAAGG + Intergenic
1074115002 10:110449918-110449940 ATTAAGAAGGAAATTGGGCCGGG + Intergenic
1075762971 10:124870635-124870657 AAAAAGAAAGAGACTGGGCATGG + Intergenic
1075808133 10:125204786-125204808 AGACAGTAGGAGAGTGGGGAGGG + Intergenic
1076456774 10:130605337-130605359 AGAGAGAAGCAGCTTGGGGAGGG + Intergenic
1077582568 11:3426204-3426226 TTAAAGGAGGAGATTGGTCAGGG + Intergenic
1077899377 11:6477067-6477089 ATCAAGAAAGACATTGGGAAGGG - Exonic
1078488068 11:11742306-11742328 AGAGAGAAAGGGATTGGGGAGGG - Intergenic
1078574176 11:12484743-12484765 ATCAAGTAGGAGTTTGGGAAAGG + Intronic
1078655939 11:13239121-13239143 ATAAAACAGGAAGTTGGGGAAGG - Intergenic
1078833696 11:15003987-15004009 ATAAAAAATGAGAATGGGAATGG - Intronic
1079461687 11:20685804-20685826 AAAAAGCAGAAGACTGGGGAAGG + Intronic
1079666212 11:23109202-23109224 ATAGAGAAGGAGGTTGGAGATGG + Intergenic
1079750838 11:24194797-24194819 AAAAAAAAGGAGACTGGGCATGG + Intergenic
1079946013 11:26741536-26741558 ATAAATAGGAAGAATGGGGATGG - Intergenic
1080111490 11:28572987-28573009 ATAAAGAAGGAGGTGGGGGTGGG + Intergenic
1080272850 11:30468930-30468952 ATAAGGAAGGTAAGTGGGGAAGG - Intronic
1080406978 11:31988065-31988087 AGAATGCAGGAGAGTGGGGATGG - Intronic
1080607556 11:33876196-33876218 ACAAAGAAGGATAACGGGGATGG - Intronic
1080826204 11:35851449-35851471 ATCAAGAGGGAGCTTGGGCAGGG + Intergenic
1081212932 11:40358269-40358291 CAAAAAAAGGAGTTTGGGGAGGG - Intronic
1081805702 11:45889104-45889126 ATAACGAAATAGCTTGGGGATGG + Intronic
1081878541 11:46428175-46428197 AAGAAGAAGGGGAATGGGGAGGG + Intronic
1082722903 11:56700758-56700780 ATAAAGCAGGGGCTTGGAGATGG - Exonic
1082726261 11:56740546-56740568 ATAAAGCAGGGGCTTGGAGATGG - Intergenic
1083597475 11:63925274-63925296 ACAAAAAAGGGGAATGGGGATGG - Intergenic
1083909280 11:65696581-65696603 AAAAAAAAGGAGACGGGGGATGG + Intergenic
1084239472 11:67809028-67809050 TTAAAGGAGGAGATTGGTCATGG + Intergenic
1084441791 11:69178863-69178885 AGAAAGAAGGAGGGCGGGGAGGG + Intergenic
1084772577 11:71353312-71353334 AAAATGAAGGAGGTTGGGGCTGG - Intergenic
1084832953 11:71783823-71783845 TTAAAGGAGGAGATTGGTCAGGG - Intergenic
1085344474 11:75759223-75759245 AAAAAGGGGGAGCTTGGGGAAGG + Intergenic
1086457073 11:86969531-86969553 AGGAAGAAGGAGAAAGGGGATGG - Intergenic
1086761711 11:90639387-90639409 AGAAAAAAGGAGAGTGGGGGTGG + Intergenic
1087051982 11:93895654-93895676 AGCAAGAAGGAGAAGGGGGAGGG + Intergenic
1087751562 11:102012764-102012786 TAAAAGGTGGAGATTGGGGATGG + Intergenic
1087933132 11:104001336-104001358 ATAAAGAAGCACATAGGGTAAGG - Intronic
1088199584 11:107317152-107317174 ATTAAAAAGGAGATTTGGGCCGG - Intergenic
1088447401 11:109946790-109946812 ATAAAATAGGAGCCTGGGGAGGG + Intergenic
1089140523 11:116280456-116280478 CTGGAGAAGGAGATTGGGGGAGG - Intergenic
1089157353 11:116412743-116412765 GCAAAGAAAGAGACTGGGGAGGG - Intergenic
1089417241 11:118302367-118302389 AAAAAGATGGAGATTTGGGCAGG - Intergenic
1089551679 11:119284202-119284224 ATAAAGAAAGAGATCGATGACGG - Intronic
1089586020 11:119510179-119510201 AGAAGGGAGGAGTTTGGGGAAGG - Intergenic
1089803940 11:121065431-121065453 AGAAAGAAGGAGAATTGGAATGG - Intronic
1089821844 11:121235725-121235747 ATTAAAAAGAAAATTGGGGAGGG + Intergenic
1089949978 11:122516498-122516520 ATTTAGAAGGAGGTTGGAGAAGG - Intergenic
1089991822 11:122868716-122868738 AAAAAGAAGGAGGCTGGGTACGG + Intronic
1090050644 11:123375628-123375650 ATAAAGAGGAAGTTTGGAGAAGG + Intergenic
1090535057 11:127631884-127631906 ATAAAGAAGGAGATTTGTCATGG + Intergenic
1091420179 12:331526-331548 GAAAAGAAGGAAATGGGGGAAGG + Intronic
1091874429 12:3921790-3921812 AGAAAGAAGGATATTGCTGAAGG + Intergenic
1092203480 12:6601622-6601644 AAACAGAAGGGGTTTGGGGAAGG - Intronic
1092611223 12:10175247-10175269 ATAAAGATGGAAATAGGAGAGGG - Intronic
1093195461 12:16125086-16125108 AGAAAGAAGGAGAGAAGGGAGGG - Intergenic
1093436413 12:19139883-19139905 ATAAAGAAAGACTTGGGGGATGG + Intronic
1093578011 12:20757148-20757170 ATAAAGAGGGAGATGGAAGAGGG - Intergenic
1093767172 12:22978268-22978290 ATAAAAAATGAAATTAGGGAAGG + Intergenic
1093837527 12:23853062-23853084 GAAAAGAAGGATAGTGGGGATGG + Intronic
1094013729 12:25838582-25838604 AAAAATAAGGAGGTTGGAGAAGG - Intergenic
1094544406 12:31391159-31391181 AGAAAGTAGGAGATTGGGGGAGG - Intronic
1094627161 12:32135071-32135093 ATAAAGGAGGGGAGCGGGGAAGG - Intronic
1095152863 12:38816374-38816396 ATAAAGAAAGAAATGGGGGAAGG + Intronic
1095341206 12:41090831-41090853 ATAAAGAAGGTGATTAAAGAGGG + Intergenic
1095362870 12:41365174-41365196 ATAATAAAAGATATTGGGGATGG + Intronic
1095837490 12:46654484-46654506 ATAAAGCAGGAGAAAAGGGAAGG - Intergenic
1097306033 12:58069985-58070007 ATACAGAAGGAAATGGAGGAAGG + Intergenic
1098469378 12:70826129-70826151 AGAAAGAAGGAGGATAGGGAGGG + Intronic
1099082332 12:78201016-78201038 AGAAAGAGAGAGAGTGGGGAGGG - Intronic
1099099868 12:78425349-78425371 ATTAAGAAGGGGATGAGGGAGGG + Intergenic
1099304590 12:80937745-80937767 AAAAAGGAGGAGATTGGGGGCGG + Exonic
1099907255 12:88786152-88786174 CTAAAGAAGAACATTGGAGAAGG + Intergenic
1100017981 12:90035183-90035205 AGAATGAGGGAGAGTGGGGAGGG + Intergenic
1100220379 12:92498507-92498529 AAAAAGAAGGAAATTGGCAAAGG + Intergenic
1100320099 12:93482879-93482901 AAAAAGAACCAGATTGGGCAAGG - Intronic
1100534609 12:95496458-95496480 ACAATGGAGGAAATTGGGGAGGG - Intronic
1101344125 12:103869601-103869623 AGAGAGAGAGAGATTGGGGAAGG - Intergenic
1101548372 12:105738474-105738496 AAAAAGAAGGGGATTGGCAAGGG + Intergenic
1101549028 12:105744723-105744745 AAAAAGAAGGGGATTGGCAAGGG + Intergenic
1101994457 12:109514898-109514920 AAAAAGAAGAAGAAAGGGGATGG - Intronic
1102092623 12:110204804-110204826 ATAATGAAGGATATTTGAGATGG - Intronic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102308799 12:111827666-111827688 ATAAATAAAAAGATTGGGCACGG - Intergenic
1102535558 12:113577923-113577945 ATGGAGATGGAGATTGGGGGAGG - Intergenic
1103131972 12:118477107-118477129 AGAAAGGAGGAGAGGGGGGAAGG - Intergenic
1104536294 12:129621133-129621155 ATGAGGAAGGATATGGGGGATGG - Intronic
1104754911 12:131262929-131262951 AGAAAGAAGGAGAAAGGGCATGG + Intergenic
1105457524 13:20555167-20555189 AGAAAGAAAGAAAATGGGGAGGG - Intergenic
1105508254 13:21029798-21029820 AAAAAAAAAGATATTGGGGATGG + Intronic
1105561021 13:21491015-21491037 GGAAAGGAGGAGATTTGGGATGG - Intergenic
1105898575 13:24738851-24738873 AGATAGGAGGAGATTGGGGCTGG + Intergenic
1106726637 13:32493213-32493235 AAAAAGAAAGAGACTGGGCACGG - Intronic
1108783530 13:53866952-53866974 AGAAAGAGGAAGATAGGGGAGGG + Intergenic
1109218192 13:59614076-59614098 ACAAAGATGGGGATAGGGGAGGG - Intergenic
1109536478 13:63728564-63728586 AGAAAGAAGGGGAGTGGGGAAGG - Intergenic
1109752880 13:66719419-66719441 ATTATGAAAGAGATTGAGGAGGG + Intronic
1110081673 13:71321421-71321443 ATAAAGAAGGAGAAAGAAGATGG + Intergenic
1110420735 13:75304800-75304822 AGGAAGAAGGAGAATAGGGAGGG + Intronic
1110601220 13:77376570-77376592 ATAAAGAATGAGATTGATGGGGG + Intergenic
1110641703 13:77831943-77831965 GGAAAGAAGGAGATGGAGGAGGG - Intergenic
1110700383 13:78540620-78540642 AAGAAGAAGGAGGATGGGGAGGG - Intergenic
1111625606 13:90781540-90781562 ATAAAGTAGAATATTGGGGAGGG + Intergenic
1111869442 13:93812070-93812092 ATAAAGAGGGAGATCTGGGCTGG + Intronic
1112883130 13:104133977-104133999 GTAAAGAAGGAGATGGGGATGGG + Intergenic
1112894963 13:104287428-104287450 AGAAAGCAGGAGATTGGTAAGGG + Intergenic
1113250433 13:108446499-108446521 ACAAAGGTGGATATTGGGGAAGG + Intergenic
1113596193 13:111535286-111535308 ATAAAGAAGGTGGGCGGGGAGGG - Intergenic
1113913954 13:113860161-113860183 ACAAAGAAAGAGATGGGGGAAGG + Intronic
1114525388 14:23364771-23364793 AAGAAAAAGGAGAATGGGGAGGG + Intronic
1115132824 14:30073662-30073684 ATAAAAAATGAGATTTGGGTAGG - Intronic
1116877102 14:50123099-50123121 ATAAATAGGGTGATTAGGGAAGG + Intronic
1117058833 14:51940166-51940188 AAAAAGAAGAGGAGTGGGGACGG + Intronic
1118313935 14:64713751-64713773 AAAAAAAAGGAAATGGGGGAAGG - Intronic
1118508521 14:66443851-66443873 AGAGAGAAAGAGTTTGGGGAAGG + Intergenic
1119140196 14:72260508-72260530 ATCTAGGAGGAGATTGTGGAGGG + Intronic
1119359112 14:74033016-74033038 AGAAAGAAGGAGGATGAGGAAGG - Intronic
1119489064 14:75014364-75014386 ATGAAGCTGGAGAATGGGGAGGG - Exonic
1119558828 14:75573810-75573832 TTAAACAAGGAGAATGGGGCCGG - Intergenic
1119609478 14:76049686-76049708 AGAAAGAAGGGGGTTGGGGGTGG - Intronic
1119903760 14:78283142-78283164 AAGAAGAACGAGATTAGGGAAGG + Intronic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1119978956 14:79058099-79058121 CTAAAGTAGGAGATGCGGGAAGG + Intronic
1120574105 14:86159317-86159339 AAAAAGAAGGAGATCTGGGAAGG - Intergenic
1120620877 14:86763112-86763134 ATAAAGAAGCACATGGGGGCCGG + Intergenic
1120962256 14:90136090-90136112 ACCAAGAAGGAGATTGGGCTGGG + Intronic
1121037041 14:90714882-90714904 ATAGAGATGAAAATTGGGGAGGG - Intronic
1121883032 14:97517302-97517324 GTAAAGAAGAGGGTTGGGGAAGG - Intergenic
1122013680 14:98774739-98774761 AGAAAAAGGCAGATTGGGGAAGG - Intergenic
1122452928 14:101825826-101825848 TTTAAGAAGGAAGTTGGGGAAGG + Intronic
1122777005 14:104122552-104122574 AGAAAGAAGGAGGGAGGGGAGGG - Intergenic
1124996500 15:34728068-34728090 ATTTAGATGGAGAATGGGGAGGG - Intergenic
1125670623 15:41469819-41469841 ATAAAAAAGGAACGTGGGGACGG - Intronic
1125718659 15:41834712-41834734 AGAAAGAAGAAGACAGGGGATGG - Intronic
1125782532 15:42282684-42282706 ATTAAGGAGCAGATTGGGGAAGG - Intronic
1125800140 15:42438498-42438520 ATAGAATAGGAGAATGGGGAGGG - Intronic
1126506955 15:49416153-49416175 ATAAACAAGTAGATTGGTGGGGG - Intronic
1126510309 15:49464049-49464071 ATACAGCAGGTGTTTGGGGATGG - Intronic
1126987193 15:54325818-54325840 ATAAAAAGAGAGATTGGGCAAGG + Intronic
1128206015 15:65852657-65852679 AAAAGGAAGGAGGTTGGGCATGG + Intronic
1128253290 15:66178785-66178807 AGAGAGAAGGAGAGTGGGGGTGG + Intronic
1128375965 15:67076241-67076263 ATAGAGAAGGTGATGGGGGAGGG - Intronic
1129711612 15:77823126-77823148 GTAAAGAGGGAGATCGGGGTGGG - Intergenic
1129990104 15:79954718-79954740 AAAAAGAGGGAGTATGGGGATGG + Intergenic
1130062409 15:80579270-80579292 ATCAGGAAGGAGAATGGGAAAGG + Intronic
1130751019 15:86713206-86713228 ATTATGAAAGAGTTTGGGGAAGG + Intronic
1130971872 15:88739966-88739988 ATAATGGAGAAGAATGGGGATGG + Intergenic
1131081713 15:89542097-89542119 GTTAAGAAGGAGATTGGGGTGGG + Intergenic
1131349286 15:91682315-91682337 ATAAAGATGGAAATTTGGAAAGG - Intergenic
1131938190 15:97531195-97531217 ATAAAGAAGGAAAATGAGGTAGG + Intergenic
1133106674 16:3515068-3515090 GTAAAGAAGCAAATTGGGGCTGG + Intronic
1133872211 16:9699592-9699614 ATAAGAAAGGAGATTGGGTGAGG + Intergenic
1133904371 16:10008209-10008231 CCAAATAAGGGGATTGGGGAAGG - Intronic
1133904461 16:10009132-10009154 ATAAAGAAGGTGATTTTGAAAGG + Intronic
1134318659 16:13142879-13142901 ATAAAAAAGGAAATTAGGAAGGG - Intronic
1134924323 16:18145633-18145655 AAAAAGAAGAAAATTTGGGATGG + Intergenic
1135126148 16:19810813-19810835 AAAAAGAAAGAAAATGGGGATGG + Intronic
1135354380 16:21757307-21757329 ACAAGGAAGGAGAGTGGGGCTGG - Intronic
1135452871 16:22573447-22573469 ACAAGGAAGGAGAGTGGGGCTGG - Intergenic
1135532373 16:23265661-23265683 ATAAGCAAGAAGATGGGGGAAGG - Intergenic
1136452783 16:30363423-30363445 ATAGAGAATGTGAGTGGGGATGG - Intronic
1136935373 16:34458440-34458462 ACAAAGAAGGAGTTAGGGGTGGG - Intergenic
1136938208 16:34496067-34496089 ACAAAGAAGGAGTTAGGGGTGGG - Intergenic
1136961610 16:34852490-34852512 ACAAAGAAGGAGTTAGGGGTGGG + Intergenic
1136964445 16:34890130-34890152 ACAAAGAAGGAGTTAGGGGTGGG + Intergenic
1136968592 16:34944824-34944846 ACAAAGAAGGAGTTAGGGGTGGG + Intergenic
1137905267 16:52315188-52315210 AGACGGAAGGAGATTGGGGATGG - Intergenic
1139228698 16:65259097-65259119 ATGAAGAAGGAGAGTGTTGAGGG + Intergenic
1139308094 16:66005265-66005287 ATAAAGAAAGAAAGTGAGGAGGG - Intergenic
1139351400 16:66338468-66338490 AGAAAGAGGGAGAGTGGGGGAGG + Intergenic
1139440089 16:66962232-66962254 ATAAAGGAGGTGGTTGGGTATGG + Intronic
1139726187 16:68900858-68900880 AGGAAGAAGGAAATAGGGGATGG + Intronic
1139743200 16:69053263-69053285 CTAAATAGGGAGAATGGGGAGGG - Intronic
1140277748 16:73526009-73526031 TAAAAGAAGGTGGTTGGGGACGG + Intergenic
1140698383 16:77558257-77558279 ATAGAGAATGGGATTGGGGCAGG + Intergenic
1141289447 16:82704144-82704166 ATAAAGAAAGAGGTGGGGGTGGG + Intronic
1141475964 16:84273676-84273698 ACAAAGAAGGTGATTGGGGCTGG + Intergenic
1142189197 16:88709833-88709855 TTAAAGATGGAGATTGGCAAAGG + Intronic
1142758591 17:2030030-2030052 ATAAAGGAGGAGATAGGGGCGGG - Intergenic
1143126650 17:4645709-4645731 AGAAAGAGGGAGAGTGGGGAGGG - Intergenic
1143434894 17:6916069-6916091 ATTCAGAAGGAGATTCAGGAGGG + Intronic
1143992905 17:10981761-10981783 AAAAACAAGGAGATTATGGAGGG + Intergenic
1144285159 17:13767021-13767043 ATAAAGAATGGGAATTGGGAGGG + Intergenic
1146234877 17:31149792-31149814 ATGAAGGAGGAGCTTGAGGAGGG + Intronic
1146421806 17:32693862-32693884 AGAAAAAAGGAGAGTGGGGCCGG + Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146575664 17:33988990-33989012 ATAAATAAGGAAGTTGTGGAAGG - Intronic
1146686338 17:34844009-34844031 ATAAAGAAGGTGGTTGGGGTAGG + Intergenic
1147212146 17:38877886-38877908 ATGAGGAAGGAGAGAGGGGAGGG + Intronic
1147375446 17:40020073-40020095 ATATAAAAGGCAATTGGGGAGGG + Intronic
1147498214 17:40937605-40937627 ATAAAGAAGCAGTCTGGGGGCGG + Intronic
1149087706 17:52738953-52738975 ACCAACAAGGAAATTGGGGAGGG - Intergenic
1149939337 17:60846224-60846246 ATAAAGAAGTAGAATGGGGCTGG - Intronic
1150142526 17:62742308-62742330 ATAAGGAAGGAGGCTGGGCATGG - Intronic
1150875782 17:68968794-68968816 CTAAAGAAGGAGATGGGGCCAGG - Intergenic
1150996910 17:70329225-70329247 ACAAAGAAAAAGAATGGGGAGGG + Intergenic
1151840317 17:76612979-76613001 AGAAAGAGGGAAATTGGGGCAGG + Intergenic
1152698744 17:81808813-81808835 ATAAAGAGGGAGCTGGGGGCCGG - Intronic
1153143341 18:2000365-2000387 TCAAAGAAGGAGATAGGAGATGG + Intergenic
1153378342 18:4407229-4407251 AAAAACAAGGTAATTGGGGATGG + Intronic
1153664698 18:7358473-7358495 ATAAAGAAAGAAATTGGGCCGGG + Intergenic
1154991426 18:21601206-21601228 GTAAAGAAGGAGGGTGGGGCCGG + Intergenic
1155063034 18:22245552-22245574 ATAAACAAGGTGATGGAGGAAGG - Intergenic
1155407582 18:25506197-25506219 ATAAGGAAGGAAAGAGGGGAAGG - Intergenic
1155587445 18:27383486-27383508 GGAAAGAGGGAGATTGGAGAAGG - Intergenic
1156279720 18:35625058-35625080 ATAAAGAATAACATTGGGGGTGG + Intronic
1156343317 18:36232626-36232648 ATAAAGAAGGGGATAGGGAGAGG - Intronic
1156379518 18:36545099-36545121 ATAAAGAAGGAGAGGGAGGGAGG - Intronic
1156438099 18:37155389-37155411 ATACAGAGGAGGATTGGGGAAGG - Intronic
1157287741 18:46388663-46388685 ATGAAGAAGGGGCTTGGGGCTGG + Intronic
1157416480 18:47507662-47507684 CTATAGAAGGAGGGTGGGGAGGG + Intergenic
1157566553 18:48682592-48682614 AGATAGAAGGGGATAGGGGAAGG - Intronic
1157772704 18:50363559-50363581 ATAAAGAAGGAAGTTTGGGCTGG - Intergenic
1157847286 18:51015767-51015789 ATAGAGAATTAGATTGGGGGAGG - Intronic
1158841369 18:61391905-61391927 GTAATGAAGGAGATGGAGGAAGG - Intronic
1159086536 18:63798609-63798631 ATCAAGAACGTGATTGGTGAAGG + Exonic
1159762859 18:72450176-72450198 ATAAAGAAGGATCTAGGGAACGG + Intergenic
1160072954 18:75644536-75644558 ATATAGAGAGAGATTGGGTATGG + Intergenic
1160965472 19:1745357-1745379 GAAGAGAAGGGGATTGGGGAGGG - Intergenic
1161033783 19:2072768-2072790 AAAATGGAAGAGATTGGGGAGGG + Exonic
1161195148 19:2982550-2982572 AAAAAAAAGGAGGTGGGGGATGG + Intronic
1162215070 19:9127390-9127412 AGAAAGAAAGAGAGGGGGGAAGG - Intergenic
1162392324 19:10397008-10397030 ATCAGGAAGGTGGTTGGGGAAGG - Intronic
1163006972 19:14402988-14403010 ATAAGTAATGAGGTTGGGGAAGG - Intronic
1163207240 19:15812618-15812640 GGAAAGAAGGAGAGTGAGGAAGG + Intergenic
1163400707 19:17090869-17090891 GGAAGGAAGCAGATTGGGGATGG - Intronic
1164403782 19:27923696-27923718 TTAACGAGAGAGATTGGGGATGG + Intergenic
1164782614 19:30905698-30905720 ACAAAAAGAGAGATTGGGGAAGG - Intergenic
1164907574 19:31979794-31979816 TGAAAGAAGGAGTTTGGGGTGGG - Intergenic
1165314194 19:35044907-35044929 AGAAAGAAGGAAACGGGGGAAGG + Intronic
1165742132 19:38210812-38210834 AGAAAGGAGGAGAAGGGGGATGG - Intergenic
1166337985 19:42120514-42120536 TTAAAAAAGGAGATTAGGGCTGG - Intronic
1166644894 19:44524574-44524596 ATAAAGAAAAAGAGTGGGTAGGG - Intronic
1166933941 19:46319888-46319910 TTACAGAAGGAGCTTGGGAAGGG + Intronic
1167328328 19:48838135-48838157 AAAAAAAAGAAGATTGGGGGTGG + Intronic
1167418137 19:49387932-49387954 AAAAAGAAAGAAATGGGGGACGG + Intergenic
1167574959 19:50313577-50313599 ACAAAGAGGGTGCTTGGGGAGGG + Intronic
1167608262 19:50493215-50493237 AGGTAGAAGGAGAATGGGGAGGG + Intergenic
1167672720 19:50863464-50863486 ATAAATAAAGTGATTGGGCACGG - Intronic
1167805796 19:51783952-51783974 ATTATGATGGAGATTTGGGAGGG - Intronic
1168075274 19:53978042-53978064 AGAGAGAAGGGGTTTGGGGAAGG + Intronic
925513163 2:4649905-4649927 AGAAACAAGGGGATTGGGAATGG + Intergenic
925695124 2:6568381-6568403 ATAAAGCAGGAAAGTGGAGATGG - Intergenic
925855379 2:8124231-8124253 ATAAAGAAGGGAAATGGGGCCGG - Intergenic
926025848 2:9544085-9544107 ATAAAGAAGGGGTTTGGGAAAGG - Intronic
926562601 2:14434473-14434495 ATAAAGCATGAGACTGAGGAGGG + Intergenic
926814313 2:16785334-16785356 AGAAAGTAGGAGCTTGGGGCAGG + Intergenic
927372165 2:22368809-22368831 ACAAAGAGAGAGAATGGGGAGGG + Intergenic
927525116 2:23732807-23732829 AGAAAGATGGAGATTGAAGATGG - Intergenic
928353336 2:30583878-30583900 ATAAACAAGAAGATAAGGGAAGG + Intronic
928482883 2:31701012-31701034 ATTAAAAAGGAGACTGGGCACGG + Intergenic
928954273 2:36845989-36846011 ATGAAGATTGAGTTTGGGGAGGG - Exonic
929415694 2:41744899-41744921 AAAAAGAGAGAGATTGGGCAGGG - Intergenic
929747645 2:44675466-44675488 AGAAAGAAGGAGAACAGGGAGGG - Intronic
929882949 2:45853156-45853178 ATAAGAAAGGAGAATGGGGAGGG - Intronic
930175045 2:48292972-48292994 AAAAAGAAGGAGGCTGGGCAGGG + Intergenic
930494479 2:52124300-52124322 AAAGACAAGGAGATGGGGGAAGG - Intergenic
931541517 2:63334683-63334705 ATAACCAAGGAGATTGTGAAAGG - Intronic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
935500885 2:103836907-103836929 ATAAAGAATAAGCTTAGGGAAGG + Intergenic
936506916 2:113115472-113115494 GGAAAGAAGGAGGTAGGGGAAGG - Intronic
936883071 2:117279373-117279395 ATAATGAGGGAGGTTGGAGAAGG - Intergenic
936899557 2:117468113-117468135 CTAAAAGAGAAGATTGGGGAGGG - Intergenic
937642189 2:124226262-124226284 ATAAAGAAGGAGATAGGTGTTGG - Intronic
937666628 2:124495393-124495415 ATTAAAAAGTAGATTTGGGAGGG + Intronic
937687627 2:124715783-124715805 AGAAAGAAGGAGATTGGATATGG + Intronic
938412343 2:131075482-131075504 AAAAAGAAAGAAAGTGGGGATGG - Intronic
938772547 2:134512716-134512738 AGAAAGAGGGAGAATGGTGAAGG + Intronic
938801986 2:134772154-134772176 CAAAAGAAGCAGATTTGGGAGGG + Intergenic
939115659 2:138057394-138057416 AGAAAGAAAGAGAGAGGGGAAGG - Intergenic
941650100 2:168083214-168083236 AAAAAAAAGGAGAATGTGGAAGG - Intronic
941782615 2:169461059-169461081 ATAAAAATGGTGACTGGGGAGGG + Intergenic
941977346 2:171419892-171419914 AGAAACAGGGAGTTTGGGGAAGG - Intronic
942632941 2:177971636-177971658 AGAGAGAAGGAGATGGGGGAAGG + Intronic
943751854 2:191517441-191517463 ATAAACAAGGAGATAGAGGCTGG + Intergenic
945827173 2:214736398-214736420 ATTGGGAAGGAGATTTGGGAAGG - Intronic
945946817 2:216002760-216002782 ACAAAGAAGGAGAATGGGGAGGG - Intronic
946145080 2:217724474-217724496 GTAAAGAGGGAGAATGGTGAGGG + Intronic
946439283 2:219681436-219681458 AATAAGAAGGAGATAGGGAACGG - Intergenic
946749102 2:222875286-222875308 AAAATCAAGAAGATTGGGGACGG + Intronic
946901166 2:224373256-224373278 AGAAAGAAGGAGAAAGGGGAAGG - Intergenic
946907171 2:224428634-224428656 ATAAAGAGAGAGAATGGGGCGGG - Intergenic
946942284 2:224782234-224782256 ATAAAAAAGGAGTTTGGGGGAGG - Intronic
947707422 2:232287686-232287708 ATTAAGAAGGAAAATGGGGCTGG - Intronic
947908609 2:233785782-233785804 ATAAAGGAGGTGATTGGGAGAGG + Intronic
948095338 2:235328994-235329016 ATTGAGAAGGGGATTGAGGAGGG + Intergenic
948433743 2:237938000-237938022 ATAATTTAGGAGGTTGGGGAGGG + Intergenic
1168798281 20:626837-626859 AGAATGAAGGAGAGTGGTGATGG - Intergenic
1168845379 20:940945-940967 ATACAAAAGGAGTTTGGTGAAGG + Intergenic
1169607137 20:7334398-7334420 ATACAGAAGGGAACTGGGGAAGG + Intergenic
1169651598 20:7874372-7874394 GCAAAGAGGGAGATTGGGCAGGG - Intergenic
1169953924 20:11080485-11080507 ATAAAGAAAGAGATTTGATAGGG - Intergenic
1170064361 20:12294493-12294515 ATAAAAAAAGAGAGTGGAGAGGG + Intergenic
1170506347 20:17029752-17029774 AAAAAGAAGGAGATCTGGGGAGG + Intergenic
1170664858 20:18378050-18378072 ATGAAGAAGGAGATGGGGGAAGG + Intergenic
1170991997 20:21311266-21311288 ATAAAGATAGAAAGTGGGGAGGG - Intronic
1171253600 20:23669035-23669057 AGCAAGAAGGAGATGGGAGATGG - Intergenic
1171269152 20:23799862-23799884 AGCAAGAAGGAGATGGGAGATGG - Intergenic
1171293347 20:23995012-23995034 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1172166969 20:32905464-32905486 AGAAATAAGGACATTGGGGCTGG + Intronic
1173037773 20:39429003-39429025 GTAAAAAAGAAGGTTGGGGATGG - Intergenic
1173572595 20:44087165-44087187 GTAAAGACGGAGTTCGGGGAAGG - Intergenic
1173865489 20:46309743-46309765 ATGGAGATGGAAATTGGGGAAGG - Intergenic
1174670114 20:52299153-52299175 AAAAAGAAAGAAATTGGGAATGG + Intergenic
1174855627 20:54042618-54042640 CTAAGGAAGGAAATTTGGGATGG + Intronic
1175382889 20:58576028-58576050 ATGAAGCATGAGCTTGGGGACGG - Intergenic
1175594790 20:60222374-60222396 ATAAAGAAGGAAAGCAGGGAGGG - Intergenic
1175606422 20:60315500-60315522 ATAAGGCTGGAGAGTGGGGAGGG + Intergenic
1175744793 20:61448465-61448487 ATTATGAAGGAGATTGGAGGAGG - Intronic
1177497512 21:21909265-21909287 AAAAAGAATAAGATTGGGCAGGG + Intergenic
1178346728 21:31835172-31835194 ATTAAGAAGAAAATAGGGGAAGG + Intergenic
1179384801 21:40931989-40932011 TTAATAAAGGAGATTGGGGTTGG + Intergenic
1179558536 21:42196067-42196089 AGAAAGGGGGAGAGTGGGGAGGG + Intergenic
1180094695 21:45550526-45550548 ATAAACAGGGAGATTTGGGCAGG + Intergenic
1180735115 22:18010740-18010762 AGAAAGAAGGAGAATTGAGAAGG + Intronic
1180762022 22:18217722-18217744 AGACAGAAAGAGATTGGGCATGG + Intergenic
1180773645 22:18406888-18406910 AGACAGAAAGAGATTGGGCATGG - Intergenic
1180804994 22:18656432-18656454 AGACAGAAAGAGATTGGGCATGG - Intergenic
1180805749 22:18712976-18712998 AGACAGAAAGAGATTGGGCATGG + Intergenic
1180824408 22:18852727-18852749 ATGGGGAAGGAGGTTGGGGAGGG + Intronic
1180831480 22:18909170-18909192 AAGAAACAGGAGATTGGGGAAGG + Intronic
1181069702 22:20325604-20325626 AGACAGAAAGAGATTGGGCATGG - Intergenic
1181124833 22:20695881-20695903 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181188326 22:21121821-21121843 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1181192744 22:21153813-21153835 AGACAGAAAGAGATTGGGCATGG - Intergenic
1181210872 22:21288672-21288694 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181216698 22:21338761-21338783 AGACAGAAAGAGATTGGGCATGG + Intergenic
1181398636 22:22638216-22638238 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1181418550 22:22779674-22779696 AAAAAGAAGGAGAGAAGGGAAGG + Intronic
1181501369 22:23317572-23317594 ATGGGGAAGGAGGTTGGGGAGGG - Exonic
1181650784 22:24257843-24257865 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181706598 22:24652896-24652918 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1182039685 22:27227168-27227190 AAAAAGAAGGTAATTGGGAATGG - Intergenic
1182102967 22:27670686-27670708 AGAAAGAAGCAGGCTGGGGAAGG - Intergenic
1182329781 22:29543046-29543068 ATAAAGAAGGGGATGGGGCTGGG + Intronic
1182806383 22:33074172-33074194 ATAAAGAAGAAGAGTGAGGAGGG - Intergenic
1182817934 22:33183668-33183690 AAAAAGAAGGAAATTTGTGATGG + Intronic
1183029861 22:35095479-35095501 ATGGAGAAGGAGGTTGGGAATGG + Intergenic
1183720758 22:39560143-39560165 ATGATGAAGGAGACTGGGGGAGG - Intergenic
1184252779 22:43270248-43270270 ATAATGAAGTAGCTTGTGGATGG - Intronic
1184328970 22:43813565-43813587 ATAAAGAAGGCAAATGGGGAGGG - Intergenic
1184331983 22:43833203-43833225 AGAAAGCAGGAGCTGGGGGAGGG - Intronic
1203216075 22_KI270731v1_random:6758-6780 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1203235475 22_KI270731v1_random:147862-147884 AGACAGAAAGAGATTGGGCATGG - Intergenic
1203274546 22_KI270734v1_random:78631-78653 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1203281564 22_KI270734v1_random:134441-134463 AAGAAACAGGAGATTGGGGAAGG + Intergenic
949447971 3:4155470-4155492 AAAAGGAAGGAGATAAGGGACGG + Intronic
949523770 3:4882732-4882754 ATAAATAAGGAGAAAGGGAAAGG + Intronic
949825750 3:8163411-8163433 ATTAAGAAGGAGATAGAGGCAGG + Intergenic
950037077 3:9893966-9893988 ATAGAGAAGTAGACTGGGTATGG + Exonic
950144689 3:10640651-10640673 ATAAGGAAAGAGTGTGGGGAAGG + Intronic
950248257 3:11441641-11441663 AAAAAAAAGGAGAAAGGGGAAGG - Intronic
950361886 3:12455248-12455270 AGAAGGAAGGACATTGGGGTGGG - Intergenic
950750112 3:15121781-15121803 AAAAAGAAGGAAGGTGGGGAGGG + Intergenic
951008305 3:17645896-17645918 ATAGAGTAGGAGATCGGGAAGGG - Intronic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
952588356 3:34920506-34920528 ATTAAGAAGGAGAATGAGAATGG - Intergenic
952875629 3:37941977-37941999 TTAAGTAAGGGGATTGGGGAGGG + Intronic
953039016 3:39238257-39238279 AGGAAGAAGGAGATTGAGAAAGG - Intergenic
953336421 3:42098151-42098173 AGAAAGGAGGGGAGTGGGGATGG - Intronic
953854680 3:46492189-46492211 AGAAAGAAAGAGAGTGTGGAAGG + Intergenic
953910719 3:46891584-46891606 AAGAAGAAGGATAGTGGGGAGGG + Intronic
954294010 3:49664221-49664243 AGAAAAAAGGAGGTTGAGGAAGG - Intronic
955161130 3:56466928-56466950 GTAAAGAAGGAATTGGGGGAGGG - Intronic
955169774 3:56551897-56551919 ACAAAGAGGTAGGTTGGGGAAGG - Intergenic
955507339 3:59645435-59645457 AGAGAGAAGGAGCTTGGTGAAGG + Intergenic
956136397 3:66103175-66103197 ATAAAGAAGTAAATGGGGGCTGG - Intergenic
956852905 3:73247307-73247329 ATAAATATGGAAATTGAGGATGG + Intergenic
957030666 3:75236641-75236663 AAAAACCAGGAGATTTGGGAGGG + Intergenic
957055394 3:75438779-75438801 TTAAAGGAGGAGATTGGTCAGGG + Intergenic
957156898 3:76555416-76555438 AGAAAGAAGGAGAAGGGGAAGGG + Intronic
957162365 3:76626502-76626524 ATAAAGAAGTATTTTGTGGAAGG + Intronic
957703259 3:83746220-83746242 AAAAAGACAGAGATTTGGGAGGG + Intergenic
957794385 3:84984566-84984588 ATAAAGCTGGAGACTGTGGAGGG - Intronic
957891154 3:86361025-86361047 ATATAGAAGGGTATTGAGGATGG + Intergenic
958485849 3:94706863-94706885 AGAAAGAAGGAGAGTGGGAGAGG + Intergenic
959727408 3:109560147-109560169 ATCATGAAGGACCTTGGGGAAGG - Intergenic
960238223 3:115309771-115309793 AGACAGAAGTAGATTGGTGATGG - Intergenic
960288217 3:115853618-115853640 GAAAAGAAGGTGATTGAGGAAGG + Intronic
960533565 3:118792541-118792563 GGGAGGAAGGAGATTGGGGAAGG + Intergenic
960581071 3:119279413-119279435 AAAAGGGAGGAGATGGGGGAAGG - Intergenic
961115353 3:124324359-124324381 ATAGAGAGGAAGAATGGGGAGGG - Intronic
961846725 3:129771181-129771203 TTGGATAAGGAGATTGGGGATGG + Intronic
961986895 3:131144389-131144411 ATACAAAAGCAGATTGGGGGTGG - Intronic
962069329 3:132017040-132017062 AGAAAGAAGGAGCTGGGGAAAGG + Intronic
962124510 3:132601565-132601587 ATAAAGAATGGGTTGGGGGAAGG + Exonic
962930373 3:140030428-140030450 AGACAGAAGGAGAGTGGGTAGGG + Intronic
962951643 3:140225171-140225193 ATAAAGCAGCAGGTGGGGGAAGG - Intronic
963235578 3:142952754-142952776 AAAAACAAGAAGAGTGGGGAGGG + Intronic
963237688 3:142971858-142971880 ATAAAGAAAGGGATTAGGAATGG + Intronic
963508494 3:146217965-146217987 AGAGAGAAGGAGATGGGGAAGGG + Intronic
964516913 3:157520839-157520861 ATAATGAAGCATATTAGGGATGG - Intronic
964847075 3:161055766-161055788 AGAGAGAGAGAGATTGGGGAGGG - Intronic
967069219 3:185947356-185947378 AGGAAGAAGGAGTTTGGGCAGGG + Intergenic
967215754 3:187208764-187208786 CTAAAGGAGGATATTGGGCATGG + Intergenic
967288705 3:187898531-187898553 ATAAAGAAGGATTATGTGGAGGG + Intergenic
967435542 3:189441786-189441808 ACAAAAAAGAAGCTTGGGGATGG + Intergenic
969154382 4:5197132-5197154 ATGAAGAAGGACAATAGGGAGGG + Intronic
969245637 4:5930930-5930952 ATAAAGAAGGAAAGAAGGGAGGG + Intronic
969816119 4:9688735-9688757 TTAAAGGAGGAGATTGGTCAGGG - Intergenic
970015485 4:11507848-11507870 AGAAAGAGAGAGAGTGGGGAGGG + Intergenic
970597414 4:17613141-17613163 ATAAATAAGAAGGTTGGGCACGG + Intergenic
970751021 4:19361527-19361549 ATAAAGAAAGAGATATGGAATGG - Intergenic
971120532 4:23699550-23699572 AAAAAAAAGGAGATTAGGTAGGG + Intergenic
971251415 4:24975986-24976008 AAAAAGAAGGAGAAGGGAGAGGG + Intronic
972191655 4:36599882-36599904 AAAAGGAATGAGATTGTGGAGGG + Intergenic
972493407 4:39609941-39609963 ATAAGGAATGAGAATAGGGAGGG - Intronic
972602555 4:40585975-40585997 ATAGAGAAGGAGCTTGGTGTTGG - Intronic
973017731 4:45162755-45162777 ATAAAGAAGGAAACTTTGGAAGG - Intergenic
973259253 4:48144713-48144735 ATAAATAGGGAAATTGGGGTTGG - Intronic
974556843 4:63461651-63461673 AGAGAGAAGGAGAAGGGGGAAGG + Intergenic
975359385 4:73450189-73450211 CCAAAGGAGGAGAATGGGGAAGG - Intronic
975399537 4:73918579-73918601 ATATGGAAGGGGATTGGGCATGG + Intergenic
976046702 4:80956736-80956758 AGAGAAAAGGAGATTGGGCATGG - Intronic
976353630 4:84088686-84088708 AGAAAGAATAACATTGGGGAAGG + Intergenic
976598890 4:86919619-86919641 AAAAAGAAGCAGAATGGGGCCGG - Intronic
976863423 4:89694265-89694287 ATGGAGGAGGAGTTTGGGGAGGG - Intergenic
977211602 4:94224412-94224434 ATACATAATGAGATTGGGAATGG + Intronic
977237375 4:94525044-94525066 ATTATGGAAGAGATTGGGGAGGG - Intronic
977368174 4:96100011-96100033 ATAAAGAAGGATATAGTGAAAGG + Intergenic
977569073 4:98611291-98611313 ATAAAGGAGGAAATTGTGCAAGG - Intronic
977573110 4:98650158-98650180 ATAATGAAGGACCATGGGGAAGG + Intronic
977726296 4:100300670-100300692 CAAATCAAGGAGATTGGGGAAGG - Intergenic
977800516 4:101224705-101224727 ATAAATAAGGAAATCGGGGCAGG + Intronic
978350421 4:107815628-107815650 ACAATGAAGGAGATTGGGAATGG + Intergenic
978745446 4:112189088-112189110 ATAAAGAATTAGATTGGGCCGGG + Exonic
979346325 4:119591817-119591839 AGAAGGAAGGAGAATGGGGAGGG + Intronic
981658107 4:147135224-147135246 AAAAAGTAGGAGAAAGGGGAAGG - Intergenic
981723241 4:147822469-147822491 AGGAAGAAGGAGGTAGGGGAGGG + Intronic
981916261 4:150036795-150036817 GTAAAGAAATAGATTGGAGAGGG - Intergenic
982099441 4:151953742-151953764 ATAGAGAAGGGGTGTGGGGAAGG - Intergenic
983593352 4:169439801-169439823 ATATAGAAAGAAATAGGGGAAGG + Intronic
984070306 4:175103258-175103280 AGAAAGAAGGAGAAGGGGAAGGG + Intergenic
984115097 4:175670346-175670368 AGAAATAAGAAAATTGGGGATGG + Intronic
984153402 4:176163407-176163429 ATAAAGGATAAGATTGTGGAAGG + Intronic
984490894 4:180433212-180433234 AGAAAGAAAGAAATTGGGGCTGG - Intergenic
984560717 4:181265691-181265713 AGAAAGAATGAGATGTGGGAAGG + Intergenic
984632615 4:182076496-182076518 ATAAAGAAGGAGAAAGAGGCTGG - Intergenic
984951396 4:185010463-185010485 ACAAAGAAGGAGATGGGGAAGGG + Intergenic
985102040 4:186468040-186468062 GGGAAGAAGGAGAGTGGGGAAGG - Intronic
985164279 4:187076031-187076053 ATAAAGAACATGATTGGGGCTGG + Intergenic
985269114 4:188177423-188177445 AAAAAAAAGGAGATGGGGGCAGG + Intergenic
985871420 5:2560235-2560257 ATAAGCAAGGAGATTGGGAGAGG - Intergenic
985897630 5:2758304-2758326 TTAAAGAGGGAGAGTGGGCATGG + Intergenic
986032423 5:3906599-3906621 ATAAAGAGACAGATTGAGGAGGG + Intergenic
986045730 5:4035844-4035866 ATAAAGATAGAGATTTGCGAGGG + Intergenic
986278325 5:6301431-6301453 GTAAGGAAGGAGAGTGGAGAGGG + Intergenic
986333630 5:6736549-6736571 TTAAAGATGGAGAGAGGGGAAGG - Intronic
986674860 5:10175042-10175064 ATACACAAGGACAGTGGGGAAGG + Intergenic
986769588 5:10959930-10959952 ATAAAAAGAGAGATTGGGCAGGG - Intergenic
986808934 5:11335519-11335541 ATAAATAAGGACTTTGAGGATGG + Intronic
986869134 5:12027272-12027294 AAAAAAAATGAGATTTGGGAGGG - Intergenic
986876846 5:12121920-12121942 ATAAAGAGGGAGATGAGGAAGGG + Intergenic
987277490 5:16377028-16377050 ATAAAGAAGGCTATTGGAGGAGG - Intergenic
988654948 5:33200499-33200521 ATATTGAAGGAGATGGGGAAAGG - Intergenic
988857883 5:35246988-35247010 AGAAAGAAGGAAATGGGGGAAGG + Intergenic
989275387 5:39582563-39582585 ATTAAAAAGTAGTTTGGGGAAGG - Intergenic
989417827 5:41201146-41201168 ATAACGTAGTAGCTTGGGGATGG - Intronic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990258623 5:53997660-53997682 ATGAAGGAGGTGAATGGGGAAGG + Intronic
990598776 5:57336651-57336673 AAAAAGGTGGAGAATGGGGAGGG - Intergenic
990731331 5:58812176-58812198 AAAAAGAAAGAGATGGGGGCTGG + Intronic
990789320 5:59458859-59458881 ATAAAATATGAGATTGGGGAAGG - Intronic
991277399 5:64865510-64865532 ATAAAGTAGGACTTTGGGAATGG + Intronic
991598084 5:68324702-68324724 ATATAGGAGGAGACTGGGGGCGG - Intergenic
992081017 5:73234288-73234310 AAAAAGATGGAGGTGGGGGAAGG - Intergenic
992153161 5:73926467-73926489 ATGAAAAAGGAGGTTTGGGAGGG - Intronic
992210434 5:74474401-74474423 ATAAGGAAGGAGCATGGAGAAGG + Intergenic
992877722 5:81074312-81074334 ATAAAGAAGGGAATGGGAGAAGG + Intronic
993354715 5:86891847-86891869 AAAAAGAAGCAGATTTGTGAGGG - Intergenic
993379957 5:87195577-87195599 ATAAATTAGGAGATTGGCAAAGG - Intergenic
993854367 5:93055158-93055180 ATAGAGATGGAGAATGGGAATGG - Intergenic
994766467 5:103924139-103924161 ATAAAGTAAGTGATTGAGGAGGG - Intergenic
995401960 5:111752514-111752536 AAAAAGACAAAGATTGGGGAGGG - Intronic
996313092 5:122129043-122129065 ATAAAGCAGGAAAATGTGGAAGG - Intergenic
996825015 5:127672835-127672857 AAAAAGATTAAGATTGGGGAAGG + Intergenic
997281209 5:132647277-132647299 ATGAAGAAGCAGATTTTGGATGG - Intergenic
998096388 5:139397843-139397865 ATAAAGCAGGATGTTGGGCATGG - Intronic
998269799 5:140696273-140696295 AAAAATAAGGAGATTGTGGCTGG + Intronic
998558089 5:143145401-143145423 ATAAAGAGAGAGAGTGAGGACGG - Intronic
998800125 5:145860761-145860783 ATAAAGAAACAGATTGGGAGAGG - Intronic
998919207 5:147049271-147049293 AGAAAGAAGGAAATTGAGGATGG + Intronic
999291184 5:150427597-150427619 ACCAAGAAGGAGAATGGGGAAGG - Intergenic
999831190 5:155321910-155321932 ATGAACAAGGAGATGGGGGAGGG - Intergenic
1000113862 5:158135190-158135212 ATAGGGAAGGAGAGAGGGGATGG + Intergenic
1000354782 5:160384012-160384034 ATAAAGAAGGAATATGGGGCTGG + Intergenic
1002669582 5:180855742-180855764 AGTAAGAAGGAGGTGGGGGATGG - Intronic
1003252003 6:4436983-4437005 ATAAAGAAGTACATAGGGTAAGG - Intergenic
1003482387 6:6545917-6545939 CTGGAGAAGGAGCTTGGGGATGG - Intergenic
1003602891 6:7534268-7534290 ATAGAGCAGGAGCTGGGGGAAGG - Intergenic
1003865589 6:10359721-10359743 ATAAAGAAGGAGAGAAGGAAAGG - Intergenic
1004542282 6:16562403-16562425 AGAAAGAAGGGGAATGGGGAAGG + Intronic
1004765267 6:18719810-18719832 ATAAAGAGGAAGATTGGGCCCGG - Intergenic
1005471127 6:26163689-26163711 AAAAAGAAAGAGAAAGGGGAAGG + Intronic
1005506971 6:26477899-26477921 ATAAAGAAAGAGGTGAGGGAGGG - Intergenic
1005585111 6:27268743-27268765 AGAAAGAGGAAGATTGTGGACGG + Intergenic
1006911505 6:37566384-37566406 AGAGAGAAGGGGAGTGGGGAGGG + Intergenic
1007754238 6:44088538-44088560 ATGAAGAAGGAGGCTGGGCACGG - Intergenic
1007756486 6:44102857-44102879 ATAGTGAAGGAGAATGGGGTAGG - Intergenic
1008000801 6:46357831-46357853 ATAAAGAAGCAGCTAGGGCAAGG + Intronic
1008338551 6:50336435-50336457 ATAATGACAGAGATTGAGGATGG - Intergenic
1008424260 6:51338528-51338550 CTAAAGAAGAAGATGGGGAAGGG - Intergenic
1008458215 6:51736769-51736791 ATAAAATGGGAGATTGGAGAGGG - Intronic
1008543638 6:52566750-52566772 AGAAAGAAGGAGATATGGGAGGG - Intronic
1008690230 6:53970841-53970863 ATTAAAAAGCTGATTGGGGAAGG + Intronic
1009031015 6:58058119-58058141 AAAGAGAAGGAGGTGGGGGAAGG + Intergenic
1009051379 6:58280722-58280744 AGAAAGAAGGAGAATTGGGAAGG + Intergenic
1010024919 6:71204132-71204154 AGGAAGAAAGAGAGTGGGGAAGG + Intergenic
1010561684 6:77358870-77358892 ATAAAGAAGGAGACTAAAGAAGG + Intergenic
1011038982 6:83010048-83010070 ACATAGGAGGAGGTTGGGGAGGG + Intronic
1011163426 6:84418876-84418898 AGATAGAGGGAGATTTGGGATGG - Intergenic
1011572206 6:88750230-88750252 AAAAAGAAGGGGGTTGGGGTGGG + Intronic
1011874570 6:91941556-91941578 ATAAAAAAGGAGATTGCAGAGGG + Intergenic
1012396345 6:98801800-98801822 AATAAGTAGGAGATTGGGAATGG + Intergenic
1012539696 6:100347622-100347644 ATAAAACAGGAGGTGGGGGAGGG - Intergenic
1012651757 6:101762525-101762547 AGAAAGAAAGAAATTGGGGCTGG - Intronic
1014014199 6:116511007-116511029 AGAAAGAGGGAGAGTGGGAAGGG + Intronic
1014344799 6:120254614-120254636 AAAGAGGAGGAGATGGGGGAGGG + Intergenic
1014648199 6:124002461-124002483 ATGAAGTAGGAGATTGGTAAGGG - Intronic
1014742576 6:125163424-125163446 ATAAAGAAGTAAATTGGGCATGG + Intronic
1014881081 6:126725400-126725422 ATAAAGGAGGAGAAAGGGGCAGG + Intergenic
1014916427 6:127155075-127155097 ATAAAACAGGAGAATGGGAAAGG - Intronic
1015163964 6:130182618-130182640 AGAAAGAAGGAGGGAGGGGAGGG + Intronic
1015275285 6:131377741-131377763 TTGAAGAAGGAGAAAGGGGAGGG - Intergenic
1015296353 6:131597787-131597809 ATGAATAAGGAAATTGGGGCTGG + Intronic
1015314783 6:131806354-131806376 ATATAGTAGAAGATTGGGGCCGG - Intergenic
1015326877 6:131933478-131933500 ATTAAGAAGGAGAATGAGGGTGG + Intergenic
1015900756 6:138063293-138063315 AGAAAGAAAGAGAGAGGGGAAGG + Intergenic
1015979419 6:138823914-138823936 ATAAAGAATGGGTTGGGGGAAGG + Intronic
1016779582 6:147943415-147943437 TTCAAGAAGCAGATTGGGGTGGG - Intergenic
1017035368 6:150262422-150262444 ATGAAGAAGGAGGGTGGGGAAGG - Intergenic
1017256868 6:152343453-152343475 AAAAAGAAAGAGAATGGGGCCGG - Intronic
1018705060 6:166458005-166458027 CTACAGAAGGAGCTTGTGGATGG + Intronic
1019007697 6:168815561-168815583 AGAAACAAGGAGAATGTGGATGG - Intergenic
1019495487 7:1337766-1337788 AGAAAGAAGGAGAGAGAGGAGGG - Intergenic
1020835849 7:13149488-13149510 ATAAAGAAGCTTATTGGAGAAGG + Intergenic
1021585717 7:22205435-22205457 ATAGAGAAGGAAATTGTGGGTGG - Intronic
1022095995 7:27142216-27142238 AGAGAGAAGGAAATTCGGGAGGG - Intronic
1022203465 7:28139969-28139991 AAAGAGACGGAGGTTGGGGAGGG + Intronic
1022252591 7:28623176-28623198 ATAAAGAAGTAGATGGGGACAGG - Intronic
1022287405 7:28967021-28967043 ACAAAGAAAGAAATGGGGGATGG + Intergenic
1023063703 7:36353769-36353791 ATAAACAAGGAGGCTGGGTATGG - Intronic
1023609267 7:41957340-41957362 AGAAAGCAGGAGAGTGGGCAAGG - Intergenic
1023734494 7:43222925-43222947 TTCAAGAAGGAGATGTGGGATGG - Intronic
1024371865 7:48594764-48594786 ATAATGAAGGAGGTTCGGGAAGG + Exonic
1025091586 7:56068672-56068694 AAAAAGAATGAGATTAGAGAGGG - Intronic
1025716067 7:63956657-63956679 AAAAATAAGGAGACTGGGCATGG - Intergenic
1025767354 7:64468035-64468057 ATTAAAAAGGAGATGGGGGCTGG + Intergenic
1025833985 7:65078814-65078836 AAAAAGAATGAGATTAGAGAGGG - Intergenic
1025903755 7:65768331-65768353 AAAAAGAATGAGATTAGAGAGGG - Intergenic
1026179387 7:68025375-68025397 AGAAAGAAGGAGAGTGGCTAGGG - Intergenic
1026264685 7:68785875-68785897 AAAAAGAAGAAGGTTGGGGCCGG + Intergenic
1026277755 7:68895052-68895074 AGAAAGAAGGAGGGTAGGGAAGG - Intergenic
1026634531 7:72069783-72069805 AGATAGAGGGAGATTGGGTAGGG - Intronic
1026975521 7:74495457-74495479 ATGAAGAAGGTGAATGGTGAGGG - Intronic
1027768424 7:82375683-82375705 ATAAAGAAGTAGATTTTTGAGGG + Intronic
1028074602 7:86496439-86496461 AGAAAGAAAGACAGTGGGGAGGG + Intergenic
1028216405 7:88139119-88139141 ATAAAGAGGGACTTTGGGGCTGG + Intronic
1028478551 7:91278355-91278377 GTAAAGAATGAGAATGTGGAAGG - Intergenic
1029182811 7:98716484-98716506 ATAAAGACGGAGAGTGCGGGAGG + Intergenic
1029274047 7:99393737-99393759 ACAAAAAAGGAGATGGGGGTGGG - Intronic
1029310958 7:99663804-99663826 ATAAAGAAGGAGATTGGGGAAGG - Intronic
1029526472 7:101097645-101097667 ATTAGGAAGGAGGTTTGGGAGGG + Intergenic
1029732005 7:102444648-102444670 AAAAAGAAGAAGCCTGGGGAAGG - Intronic
1030356109 7:108544229-108544251 ATAAAGAAGGACATTGGGCCAGG + Intronic
1030867782 7:114720729-114720751 TTAAAAAAGGAGATTTGGAAAGG - Intergenic
1030915055 7:115302865-115302887 GTAAAGAGAGAGATTGGGCAGGG - Intergenic
1031327526 7:120420451-120420473 AAAAAGAAAGAGCTTGGTGATGG + Intronic
1031425772 7:121603815-121603837 ATAAAGAAGGCTAAGGGGGATGG - Intergenic
1031732992 7:125320864-125320886 ATAGAGAAAGAGAGTGAGGAGGG - Intergenic
1032671950 7:134091971-134091993 ATAAAGAGATATATTGGGGATGG - Intergenic
1032988198 7:137361979-137362001 AAAAGGAAGGAAAATGGGGAGGG - Intergenic
1033431890 7:141296792-141296814 ATAAAAGAGGAGATGGGAGACGG - Intronic
1034088710 7:148344410-148344432 ATAGAGGAGGTGATTGGAGAAGG - Intronic
1035086031 7:156258700-156258722 ATAAAGAGGGAGATTTGGACAGG - Intergenic
1035417598 7:158703770-158703792 ATGAGGAAGGAGTTTGGGGACGG - Intronic
1035982553 8:4389648-4389670 ATAAAGGTGGAGTTTAGGGAGGG - Intronic
1036148746 8:6278698-6278720 ATAATGAAAGATATTGGGGATGG + Intergenic
1036771532 8:11581740-11581762 AAAAGGAAGGAAATTGGGGCTGG + Intergenic
1036985461 8:13523955-13523977 ATTAAGTAGGAGAGAGGGGATGG + Intergenic
1037469627 8:19194680-19194702 ATAAAGAAGAAGAATGACGAGGG + Intergenic
1037523383 8:19701963-19701985 ATAAAGGAGCAATTTGGGGATGG - Intronic
1037653745 8:20865445-20865467 AGAAAGAAGGAAAAAGGGGAAGG - Intergenic
1037912023 8:22749136-22749158 AGTAGGAAGGAGAGTGGGGATGG + Intronic
1038540044 8:28384743-28384765 AGGAAAAACGAGATTGGGGAAGG - Intronic
1039509912 8:38083027-38083049 ATAAAGAAGGACATTGAGATAGG - Intergenic
1039611267 8:38921219-38921241 ACAAAGGAGGAGAATGGAGAGGG - Intronic
1039763358 8:40601520-40601542 AGAAAGAGGGAGAAAGGGGAAGG + Intronic
1040581436 8:48701797-48701819 ATGAAGATGCAGATTGTGGAGGG + Intergenic
1040895158 8:52359761-52359783 ATAAAGCAGGGTATTGGAGATGG + Intronic
1041250866 8:55933930-55933952 ATAAAGAAGGAGCTTTGGCCAGG + Intronic
1041633573 8:60116613-60116635 ATAAAAAAGGAGAATGAGGGTGG - Intergenic
1042008884 8:64216374-64216396 ATAAAAAAGGAAATTGGGCTGGG + Intergenic
1042601726 8:70505622-70505644 ATAAAGAGGGAGGAAGGGGAAGG - Intergenic
1042816555 8:72883654-72883676 AAAGAGAATGGGATTGGGGAGGG - Intronic
1043202292 8:77385462-77385484 AAAAAGAAGGTGCTTTGGGAAGG - Intergenic
1043448005 8:80338458-80338480 AAAAAGAATGAGTTTGGGGTGGG - Intergenic
1043485655 8:80696751-80696773 ATAATGTAAGATATTGGGGATGG + Intronic
1043998221 8:86844929-86844951 ATAGAGAAAGAGATAGGGGTAGG + Intergenic
1044041005 8:87368343-87368365 ATAAAAAAGTAGATTGGGCATGG + Intronic
1044535713 8:93354520-93354542 ATTAAGAAGGAGGTTGTGGGTGG - Intergenic
1044541797 8:93416770-93416792 ATTAAGAAAGAGATTGTGTATGG + Intergenic
1044806784 8:96016600-96016622 AGAAAGTAGGGGATGGGGGAAGG + Intergenic
1044822166 8:96161710-96161732 ATGCAGAAGGAACTTGGGGAAGG - Intergenic
1044878997 8:96702766-96702788 TTACAGAAGGAGAAAGGGGAGGG - Intronic
1045674971 8:104597540-104597562 GTAAAGAAGGAGATTTGCGAGGG + Intronic
1046603432 8:116344014-116344036 ATAAAAAAGGAGAGAGGGAAAGG + Intergenic
1047147499 8:122220529-122220551 TTATAGAAGGAGATTGGATAAGG - Intergenic
1047157162 8:122332282-122332304 AAAGAGAAGGAGAGTGGGGGTGG - Intergenic
1047852312 8:128870367-128870389 AGAAAGAAGGAAAGAGGGGAAGG - Intergenic
1048766363 8:137848630-137848652 AAAGAGAAGGATATTGGGGCCGG + Intergenic
1048779024 8:137980855-137980877 AAAATGAAGGAGAGTGGGGTTGG - Intergenic
1048852224 8:138656186-138656208 AAACAGAAGGAGAGTAGGGATGG - Intronic
1049133341 8:140869647-140869669 ATAGAGAATGAAATTGGGAATGG + Intronic
1049148560 8:141019773-141019795 ATAAAGAAGGAGATCATGGGGGG - Intergenic
1049397707 8:142409282-142409304 AAAGAGAAGGAGAGAGGGGAAGG + Intergenic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1051388930 9:16542382-16542404 AGAGAGAAGAAGATGGGGGAGGG + Intronic
1051848468 9:21479740-21479762 CTGAAGAAGGAGATTAGGGTGGG - Intergenic
1052017371 9:23484704-23484726 ATAAAGAAGAAAATAGGGGGAGG + Intergenic
1052690775 9:31814161-31814183 AGAAAGAAAGAGATGGGGAATGG + Intergenic
1055312564 9:74998200-74998222 ATGAACAAGGTGATTGGGGATGG - Intronic
1055510723 9:76993396-76993418 ATAAAAGATGAGAGTGGGGATGG - Intergenic
1056142369 9:83695486-83695508 ATAAAAAAGGGGACTGGGCATGG - Intronic
1056499407 9:87193070-87193092 AGAAAGAGGGAGAATGGGCAGGG + Intergenic
1057454092 9:95191651-95191673 ATGAAAAAGGGGCTTGGGGATGG - Intronic
1057717930 9:97509841-97509863 ATAAAAAAGCAAATTGTGGAAGG - Intronic
1057738787 9:97692364-97692386 ATAATGAAGGAGGTAAGGGAAGG - Intronic
1057752373 9:97803319-97803341 AAAAGGAAGGAGATGGGGAAGGG + Intergenic
1057777942 9:98026056-98026078 AGAAAGAAAGAAATTGGGGAAGG + Intergenic
1057852142 9:98574028-98574050 GAAAAGAAGGAGATCAGGGAAGG + Intronic
1057884265 9:98817789-98817811 AGAAATAATGAGATTGAGGAGGG + Intronic
1058551345 9:106118530-106118552 AAAAGGAGGGAGATTGGGAAGGG + Intergenic
1058568632 9:106315062-106315084 ATAGAAAAGGAATTTGGGGAGGG - Intergenic
1058782442 9:108351889-108351911 ATACAGAAGGAGATAGGTGAGGG - Intergenic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1059694317 9:116716237-116716259 AGGAAGACGGAGAGTGGGGATGG + Intronic
1059718677 9:116937288-116937310 ATAAGGAAGGAGGTGGGAGAAGG - Intronic
1059900066 9:118914466-118914488 AGAAAGAAGGAAAGTGGGGATGG - Intergenic
1060035196 9:120249418-120249440 ACAAAGCAGCAGTTTGGGGAGGG - Intergenic
1060456682 9:123805153-123805175 TTAAATAAGGTGATTAGGGAAGG - Intronic
1060584006 9:124774649-124774671 ATCAAGAAAGGGCTTGGGGAGGG + Intergenic
1060674322 9:125498817-125498839 AAAGGGAAGGAGAGTGGGGAGGG - Intronic
1061397679 9:130352454-130352476 GGATAGAAGGAGATTTGGGAGGG + Intronic
1061510021 9:131054757-131054779 AAAAAGAAAGAGAGAGGGGAAGG + Intronic
1061739094 9:132686448-132686470 ACAAAGGAGGAGGTTGGGGAAGG - Intronic
1062050630 9:134444725-134444747 AGAAGGAAGGAGAAGGGGGAAGG - Intergenic
1062638357 9:137503420-137503442 AGAAAGAAGGAGAATGAGGAGGG + Intronic
1185472169 X:390535-390557 ATAAAAAGCGAGAATGGGGAGGG + Intergenic
1185545438 X:940231-940253 AGAAAGAAGGAGAGAGGAGAGGG - Intergenic
1185574945 X:1163833-1163855 ATAAAGAAAGAGAGAAGGGAGGG + Intergenic
1186573362 X:10739180-10739202 AGCAAAAAGAAGATTGGGGAAGG + Intronic
1186677594 X:11835380-11835402 AGAAAGAAGGAGATGGAGGAGGG - Intergenic
1186729255 X:12391184-12391206 ATGAATAAGGAGATGGGGGTGGG - Intronic
1186852086 X:13590607-13590629 AGAGAGAAGGAGGTTGGGGCAGG - Intronic
1187254748 X:17632145-17632167 AAAGAGAAGGAGAATGTGGAAGG + Intronic
1187416138 X:19094900-19094922 AAAAAGAAGGAGAAAGTGGACGG - Intronic
1187540553 X:20189165-20189187 AAAAACAAGGAGTATGGGGAAGG - Intronic
1187877475 X:23816257-23816279 ATAAATAAGGTAAATGGGGAAGG - Intergenic
1188018213 X:25128148-25128170 AATAAGAAGGAGATTGGGAGAGG + Intergenic
1188068130 X:25686632-25686654 ATATATAAGGACATTGGAGAAGG - Intergenic
1188812999 X:34675704-34675726 ATCAAGAAGGTGTTTGGCGAAGG + Intergenic
1189341026 X:40204692-40204714 AAAAAGAAGGAAATTGAGGCTGG - Intergenic
1189423902 X:40881264-40881286 AGAAAGAAGGAAGCTGGGGAGGG + Intergenic
1190048705 X:47133146-47133168 AAAAAGAAGTAGACTGGGGCCGG + Intergenic
1190712219 X:53079194-53079216 ATAAAGAAGGGAAAGGGGGATGG - Exonic
1190815220 X:53923731-53923753 GTAAAGAATGGGATTGGGGCAGG + Intergenic
1191833230 X:65437281-65437303 ATAGAGCAGGGGAGTGGGGATGG - Intronic
1192433879 X:71130319-71130341 ACAAACAAGGATATAGGGGAGGG + Intronic
1193186123 X:78514766-78514788 ATAAACAAGGAAATTGAGAAAGG + Intergenic
1193448037 X:81629295-81629317 AGAAAGAAAGAGAGTGAGGAAGG - Intergenic
1193574698 X:83183636-83183658 ATAAAATAGGAGAATGGGAAAGG - Intergenic
1194434220 X:93849762-93849784 ATAAAGAAGGGGCTTCGAGATGG - Intergenic
1194530372 X:95040482-95040504 ATATAGAAGAAGATATGGGAAGG - Intergenic
1194755158 X:97730746-97730768 ATGAAGAAGGACATAAGGGAGGG - Intergenic
1194946371 X:100073393-100073415 ATAGAGCAGAACATTGGGGAAGG + Intergenic
1194972568 X:100360157-100360179 ATAAATAATGGGATTGGGGTTGG - Intronic
1196436184 X:115676686-115676708 ATAAAGAAGCAGCTTGGGTACGG + Intergenic
1196894315 X:120319954-120319976 CTGAAGAATGACATTGGGGAAGG - Intergenic
1196945346 X:120818990-120819012 ACAAAGAAAGAGACTTGGGAAGG + Intergenic
1197119619 X:122875008-122875030 TTTAAAAAGGACATTGGGGAGGG - Intergenic
1197209441 X:123816798-123816820 AAAAAGAAGGAAGTTGGGGAAGG + Intergenic
1198394621 X:136208952-136208974 AGAAAGAAGGGGGTGGGGGAGGG + Intronic
1198466738 X:136910204-136910226 AAAGAGAAGGAGATGGGAGAGGG - Intergenic
1199145729 X:144363945-144363967 ATAGAGAAAGAGATAGGGGTAGG + Intergenic
1199530054 X:148836556-148836578 ATAAAGTAGGGATTTGGGGAAGG - Intronic
1199783170 X:151081949-151081971 ACACAGAAGGAGAATGGAGAAGG + Intergenic
1199854739 X:151751209-151751231 ATGAACAAGAAGATTGTGGAGGG - Intergenic
1199855566 X:151756325-151756347 ACAAAGAATGACATGGGGGAAGG - Intergenic
1200016142 X:153165038-153165060 GGAGAGAAGGAGAGTGGGGAGGG + Intergenic
1201253854 Y:12088120-12088142 ACAAAGAAAGAGAGAGGGGAGGG - Intergenic
1201593641 Y:15641935-15641957 ATTGAGATGGAGAGTGGGGAGGG + Intergenic