ID: 1029311068

View in Genome Browser
Species Human (GRCh38)
Location 7:99665358-99665380
Sequence CTGCATGTATAGTGGAAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 203}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029311068 Original CRISPR CTGCATGTATAGTGGAAGGA CGG (reversed) Intronic
900896801 1:5488328-5488350 ATGAATGGATAGTTGAAGGATGG - Intergenic
901917419 1:12510567-12510589 GTGCATGCAGAGAGGAAGGAAGG + Exonic
901919418 1:12525730-12525752 CTGCTTGTGGACTGGAAGGAAGG + Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
911184230 1:94887330-94887352 CTGAATGAATAGGGGGAGGAGGG - Intronic
911762400 1:101631379-101631401 CTGCTTGAATAAAGGAAGGAAGG - Intergenic
912521761 1:110250544-110250566 CTGCATGGTTGGTGTAAGGAAGG + Intronic
915707134 1:157855438-157855460 AAGGATGTAAAGTGGAAGGAGGG + Intronic
916152740 1:161811678-161811700 ATGGATGGATAGTGGATGGATGG - Intronic
916152746 1:161811705-161811727 ATGGATGGATAGTGGATGGATGG - Intronic
916558789 1:165915184-165915206 CTGCATGGAGACTGGAAAGAGGG + Intergenic
916963642 1:169913358-169913380 CTGCATGTATAAGACAAGGAAGG + Intergenic
917961037 1:180144862-180144884 CTGCATGTTTGGAGTAAGGAAGG - Intergenic
918551131 1:185743871-185743893 TTGAATAGATAGTGGAAGGAAGG + Intronic
919350825 1:196451725-196451747 CTTCATGTTTAGGGGAATGAAGG + Intronic
922792793 1:228319321-228319343 ATGGATGAATAGTGGATGGAGGG - Intronic
923245824 1:232131109-232131131 CTGCATGTTCACTAGAAGGATGG + Intergenic
924662541 1:246034954-246034976 CTGCATATATTGGGGGAGGAAGG - Intronic
1063633925 10:7762845-7762867 CTTAATGTACAGTGGAAGAAGGG + Intronic
1064428953 10:15255004-15255026 CTGCATGAATGGGGGAAGGGAGG - Intronic
1067096607 10:43305358-43305380 TTGCATGTATAATGGAAGCAGGG + Intergenic
1067546798 10:47197605-47197627 CTGCAGGTATAGCGGTTGGAGGG - Intergenic
1068807687 10:61217351-61217373 TTCCATGTATGGTGGGAGGATGG + Intergenic
1070104576 10:73419174-73419196 CTACATGTGGAGGGGAAGGATGG - Intergenic
1070964742 10:80523040-80523062 CTTCATCTATGGTGGAGGGAAGG + Exonic
1071715843 10:88094491-88094513 TTGGCTGCATAGTGGAAGGAAGG - Intergenic
1071904015 10:90153109-90153131 TTGCATGCATAATGGAAGCAGGG - Intergenic
1073236855 10:102024119-102024141 CTGTATTTCTAGTGGAAGGAGGG - Intronic
1074141187 10:110674172-110674194 CTGCAAACATATTGGAAGGAAGG + Intronic
1075596177 10:123730948-123730970 CTGACTATATAGTGCAAGGAAGG - Intronic
1076138746 10:128063275-128063297 CTGCAGTGATAGTGGGAGGAAGG - Intronic
1080556446 11:33421673-33421695 CTCCATGTTTTGAGGAAGGAAGG + Intergenic
1082991935 11:59214212-59214234 CTGTATGCATCCTGGAAGGAAGG + Intergenic
1087701180 11:101438462-101438484 TTTCATGTATGGTGTAAGGAAGG - Intergenic
1089302466 11:117506970-117506992 CTGCATTTCTAGCGGGAGGAAGG - Intronic
1089419839 11:118323261-118323283 CTGTATGTTTAATGAAAGGATGG + Intergenic
1089648651 11:119897211-119897233 CTACATGCAGAATGGAAGGATGG + Intergenic
1089747956 11:120630093-120630115 CTGCAAGTAAAGTGGCTGGAAGG + Intronic
1091395053 12:149306-149328 TTGCATGTGCAGTGGGAGGAAGG + Intronic
1091874493 12:3922524-3922546 CTGCTTGTCAAGTGGAAGGCTGG - Intergenic
1091949275 12:4579564-4579586 CTGCATGTGGACTGGAGGGAGGG + Intronic
1092021643 12:5207621-5207643 CTGCATCTAAAGTGGGCGGAGGG + Intergenic
1093189022 12:16053781-16053803 TTGCATATATGGTGTAAGGAAGG - Intergenic
1094640125 12:32266195-32266217 CTGCAGCAATGGTGGAAGGAGGG + Intronic
1096185504 12:49577907-49577929 CTCCATGAAATGTGGAAGGATGG - Intronic
1100195905 12:92244149-92244171 CTGCAGGAACAGTGGCAGGAGGG - Intergenic
1102718635 12:114996969-114996991 GTGCTTATATAGTGGAAAGAGGG + Intergenic
1104968082 12:132518507-132518529 ATGCATGCATGGTGGATGGATGG - Intronic
1108480125 13:50860867-50860889 TTTCATGTATGGTGTAAGGAAGG - Intergenic
1108613817 13:52110973-52110995 CTTCCTTTACAGTGGAAGGAGGG + Intronic
1108911225 13:55553788-55553810 CTCCATGTGTAGTGGAAAAATGG - Intergenic
1109831186 13:67791165-67791187 CCGCATGTGCACTGGAAGGATGG - Intergenic
1116370914 14:44130591-44130613 GTGCATGTCTAGAGGAGGGAGGG + Intergenic
1116954550 14:50910774-50910796 CTGCAGGAAAAGTGGAAGGAAGG - Intronic
1120703301 14:87722282-87722304 CTGCCTCTATAGTGAAAGAAAGG - Intergenic
1121978365 14:98428175-98428197 CTGGCTGTATAGAGTAAGGAAGG + Intergenic
1125033241 15:35093708-35093730 CTCCATAAATAGTGGAGGGATGG + Intergenic
1125970907 15:43910970-43910992 AAGCATTTATAGTGCAAGGAGGG - Intronic
1127214531 15:56810597-56810619 CCGCAAGTACACTGGAAGGATGG + Intronic
1127656395 15:61060330-61060352 CAGAATGAGTAGTGGAAGGAAGG - Intronic
1129976539 15:79826952-79826974 CTGTATATATAGTGGCAGGAAGG - Intergenic
1134058595 16:11185479-11185501 GTGCATGTATGTTGGATGGATGG + Intergenic
1134382549 16:13741241-13741263 CTGCCTGTATTGTGGAAACAAGG + Intergenic
1135486594 16:22870971-22870993 CTGCATGACTAGTTGAAGTATGG - Intronic
1137405629 16:48187091-48187113 CTGCATGGACAGTGGAGGTAAGG + Intronic
1138268521 16:55678024-55678046 TTGCATGGATAGTGGAGGGAAGG - Intronic
1141657965 16:85426172-85426194 ATGGATGTATAGTGGATAGATGG + Intergenic
1142045828 16:87924705-87924727 GAGCATGTTTAGTGTAAGGAAGG + Intronic
1142124129 16:88401783-88401805 GTGGATGGATAGTGGATGGATGG + Intergenic
1143642055 17:8204807-8204829 GTGTATGTATAGGGGAAAGAAGG - Exonic
1143844654 17:9764968-9764990 CTGCAGTGATGGTGGAAGGAAGG - Intergenic
1145978733 17:28999088-28999110 CTGAATGGAGAATGGAAGGATGG + Intronic
1146504726 17:33395005-33395027 GTGCATGGATGGTGGAGGGAGGG - Intronic
1147988965 17:44321885-44321907 CTGCATGTGTAGAGGCAGGGAGG - Intronic
1148969592 17:51468183-51468205 CTGCTTTTATAGTGGAAGTGGGG + Intergenic
1151353383 17:73544626-73544648 ATGGATGGATAGTGGATGGATGG + Intronic
1152301830 17:79499370-79499392 ATGAATGAATAGTGGATGGATGG - Intronic
1153298051 18:3566612-3566634 ATGGATGGATAATGGAAGGATGG + Intronic
1154383396 18:13872178-13872200 CTTGAAGGATAGTGGAAGGAAGG - Intergenic
1158474604 18:57768975-57768997 CTTCATGGAAAGTGGAAGGCGGG - Intronic
1158511069 18:58091110-58091132 CAGCTTGCATGGTGGAAGGAAGG - Intronic
1158652155 18:59297829-59297851 CTCCCTGTCTAGTGGAAGGGAGG - Intronic
1161635940 19:5388874-5388896 CTGAATGTAAAGTGGACTGAAGG + Intergenic
1165152867 19:33771234-33771256 CTGCATGGGTAGGGGATGGAGGG + Intronic
1165228129 19:34368475-34368497 CTGCCTGTCTAGTGGATAGAGGG + Intronic
1165545430 19:36531151-36531173 ATGCATTTATAATGGAAGGAAGG + Intergenic
1166935601 19:46330608-46330630 ATGCATGGATGGTGGATGGATGG + Intronic
1166988068 19:46674234-46674256 CTGCCTGAAAAGAGGAAGGATGG - Intergenic
1167294018 19:48639048-48639070 GTGCATCTGCAGTGGAAGGAGGG + Exonic
926577418 2:14597440-14597462 CTGCAGGTAAGCTGGAAGGATGG + Intergenic
928270876 2:29853595-29853617 CTGCATGGAGAGTGGTAGGTAGG - Intronic
929312850 2:40445698-40445720 CTGCATGTCCAGGGGAAGAAAGG + Intronic
930883212 2:56295486-56295508 CCGCATGGCTAGTGGAAAGAAGG + Intronic
931106364 2:59060997-59061019 CTGTGTGTATAGTGAAAGGAGGG - Intergenic
932246295 2:70199524-70199546 ATGCAGTGATAGTGGAAGGAAGG + Intronic
933665003 2:84957770-84957792 CTGGATGCTTAGAGGAAGGAAGG - Intergenic
933945980 2:87286537-87286559 CTGCATGTGGAGTTGAGGGAGGG + Intergenic
933973469 2:87489244-87489266 CTGGATGTCTAGTGCAAGGCTGG - Intergenic
934573013 2:95383979-95384001 CTGCATGGAGAGAGGAAGGGAGG - Intronic
935377458 2:102413947-102413969 CCGCATGTTCATTGGAAGGACGG + Intergenic
935407087 2:102720487-102720509 CTCCATGAATATTGGAAGGTTGG - Intronic
936320256 2:111460969-111460991 CTGGATGTCTAGTGCAAGGCTGG + Intergenic
936334233 2:111575049-111575071 CTGCATGTGGAGTTGAGGGAGGG - Intergenic
937064627 2:119008318-119008340 CTCCATCTAGAGTTGAAGGATGG + Intergenic
938089260 2:128420402-128420424 CCGCAAGTATAGTGGAGGGAAGG - Intergenic
938781782 2:134591053-134591075 CTACATGTACATTAGAAGGATGG + Intronic
939001127 2:136736118-136736140 CTGCAACCTTAGTGGAAGGAAGG + Intergenic
941439991 2:165522807-165522829 CTGCATGTACTGTGGAAGAAAGG - Intronic
946827708 2:223695754-223695776 CAGCAGCTATAGCGGAAGGAAGG - Intergenic
947383681 2:229569846-229569868 CTGTATGTATAATGGATGGATGG + Intronic
949065827 2:241989898-241989920 ATGCATGGATGGTGGATGGATGG - Intergenic
949065893 2:241990182-241990204 ATGCATGGATGGTGGATGGATGG - Intergenic
949065905 2:241990234-241990256 ATGCATGGATGGTGGATGGATGG - Intergenic
1168836984 20:884051-884073 CTGGATCCATAGTGGAAGGCTGG - Intronic
1175687954 20:61045088-61045110 GTGGATGGATAGTGGATGGATGG - Intergenic
1176134705 20:63517293-63517315 CAGTATGTATATTGGATGGAAGG - Intergenic
1177957027 21:27611001-27611023 CTACATGTAAAGGGAAAGGATGG - Intergenic
1180913166 22:19467563-19467585 CAGTATGTCCAGTGGAAGGAGGG - Intronic
1184299102 22:43544459-43544481 CTGCCTGCAAGGTGGAAGGAAGG + Intronic
1185193323 22:49452523-49452545 GTGGATGGATGGTGGAAGGATGG + Intronic
950741730 3:15057572-15057594 ATGCATCTATAGTGAAAGAAGGG + Intronic
953099692 3:39811771-39811793 CTGCGTGTATGGTGGTAGAAGGG + Intronic
954918096 3:54165497-54165519 CTCCATATATTGAGGAAGGAAGG + Intronic
955733404 3:62011131-62011153 CTGCATGCGCACTGGAAGGATGG - Intronic
955752710 3:62198856-62198878 CTACATGCATAGTGGAAAAAAGG + Intronic
957752034 3:84432997-84433019 CTGCATGTATTCTTGAATGATGG + Intergenic
959387704 3:105732769-105732791 CTGCATGAGTTGAGGAAGGATGG - Intronic
959455315 3:106552716-106552738 CCGCATGTACAGTGTCAGGAGGG + Intergenic
962095668 3:132289898-132289920 ATGCAGGTACAATGGAAGGAGGG + Intergenic
963065656 3:141261628-141261650 GTGCATGGTTAGTGAAAGGAGGG - Intronic
966745220 3:183268370-183268392 CTGACTGTAAAGTGGAAGGTGGG + Intronic
967736132 3:192954626-192954648 TTTCATGTATAGTGAAAGGTAGG + Intergenic
968803622 4:2758442-2758464 GAGCATGGATATTGGAAGGAGGG - Intergenic
969324555 4:6433638-6433660 CTGCATGTATAGTTGAACCCAGG - Intronic
969612209 4:8233708-8233730 ATGGATGGATAATGGAAGGATGG - Intronic
969612220 4:8233766-8233788 ATGGATGGATAATGGAAGGATGG - Intronic
971992904 4:33924433-33924455 CTGCATGCCCACTGGAAGGATGG - Intergenic
973865034 4:55104107-55104129 CTGCATGAAGAGTGGGATGATGG - Intronic
974087992 4:57281575-57281597 CTACATGTGTGGTGGAGGGATGG + Intergenic
974951780 4:68591841-68591863 GTGCATGTTTAATGAAAGGAAGG + Intronic
976978437 4:91193011-91193033 TTGCATGTATAGTTTGAGGAAGG - Intronic
978016912 4:103755140-103755162 CTGTATGTATAGTGTTAGCAGGG - Intergenic
978037522 4:104014000-104014022 CTGCATGTAGTCTGCAAGGATGG + Intergenic
979014644 4:115418451-115418473 CTGCATGTACACTGGATGGATGG + Intergenic
980323548 4:131310225-131310247 AAGCATGCATAGTGGAATGAAGG - Intergenic
980939085 4:139255580-139255602 CTGGATCTATAGGGGAGGGAAGG + Intergenic
983796746 4:171873855-171873877 CTGAATGTGGAGTTGAAGGAGGG + Intronic
984075366 4:175170945-175170967 CTGTATCTGCAGTGGAAGGAAGG - Intergenic
986178166 5:5369545-5369567 CTGCACTTATGGTGGAGGGAAGG + Intergenic
987264303 5:16235998-16236020 CTGCATGTCTAGGGGAGGAAAGG - Intergenic
987908446 5:24109230-24109252 CTTCATGTCTAATGGAAGGGGGG + Intronic
988888316 5:35583871-35583893 CAGCATGGATAGTGGAATGGAGG + Intergenic
990306097 5:54495281-54495303 CAGCATACATAGTGGAATGATGG + Intergenic
991126583 5:63076526-63076548 ATGCAGGTAGAGTTGAAGGAAGG - Intergenic
992594259 5:78329803-78329825 ATGGATGTATAGTAGATGGATGG - Intergenic
996606643 5:125330618-125330640 CTGGATGTAAAGTGGGAGAAGGG + Intergenic
998622188 5:143807036-143807058 CTGCATGTATAGTATTAGGAAGG - Intergenic
999204977 5:149841328-149841350 CTGCAAGGAGAGTGGGAGGAGGG + Intronic
1000136947 5:158362155-158362177 CTCCAATGATAGTGGAAGGAAGG - Intergenic
1001236199 5:170031693-170031715 CCACATGTTGAGTGGAAGGATGG + Intronic
1003036732 6:2646507-2646529 GTGCATGTGTAGTGGGAGGGTGG + Intergenic
1003824028 6:9932414-9932436 CTACAAGTATATTGGCAGGATGG + Intronic
1004886722 6:20058406-20058428 CTGAATGTGTAGGGGAGGGATGG + Intergenic
1009279647 6:61731538-61731560 CTACATGTATTGTGGAAGTTTGG - Intronic
1009711606 6:67329366-67329388 CTGCAGTAAGAGTGGAAGGAGGG + Intergenic
1010749197 6:79599322-79599344 CTTCATGTTTAGTGCAAGAAAGG - Intergenic
1012143293 6:95650372-95650394 CTGCATGCACACTGGAAGAATGG + Intergenic
1017296162 6:152797071-152797093 CTACAAATATAGTAGAAGGAGGG - Intergenic
1017770426 6:157639940-157639962 CTGCATGTAATGTGGAAGGAGGG + Intronic
1018595201 6:165471710-165471732 CTGCATTTATTTTGAAAGGAGGG - Intronic
1022369172 7:29754318-29754340 CTGCCTGTCTAGTGGCAGGCAGG - Intergenic
1023752818 7:43388198-43388220 CTGGATGTGGAGTGGATGGATGG - Intronic
1023894185 7:44418368-44418390 TTGTATGTATAGAGTAAGGAGGG + Intronic
1024268231 7:47622691-47622713 ATACATGTAGAGAGGAAGGAAGG - Intergenic
1024738871 7:52334475-52334497 CTTCATGTGTAGGGAAAGGAGGG + Intergenic
1025120124 7:56294735-56294757 ATGGATGGATAGTGGATGGATGG + Intergenic
1025776987 7:64568884-64568906 CTGCATATATTGGGGAAGCAGGG + Intergenic
1025791193 7:64688427-64688449 TTGTATGTTTAGTGGAAGGGGGG + Intronic
1027461074 7:78454333-78454355 TTTCATGTATAGAGAAAGGAAGG - Intronic
1027755435 7:82205022-82205044 CTGCATGTACAGTGTCAGCAGGG - Intronic
1028049533 7:86164582-86164604 ATTCATGTATAGTGTAAGGTAGG + Intergenic
1028667574 7:93364298-93364320 CTGCATGTCTAGGGGCAGGGTGG - Intergenic
1028968733 7:96832395-96832417 ATGCATGTATAGTGCCAAGAAGG + Intergenic
1029311068 7:99665358-99665380 CTGCATGTATAGTGGAAGGACGG - Intronic
1029316104 7:99715951-99715973 CTGCACGCATAGAGGAAGGATGG - Intronic
1029321765 7:99768547-99768569 TTGCATGCATAGAGGAAGGATGG - Intronic
1029330469 7:99849479-99849501 CTGTGTGTATAGCAGAAGGAAGG + Intronic
1030435790 7:109518346-109518368 TTTAATGTATAGTGGAAAGAAGG + Intergenic
1030623883 7:111822309-111822331 CTCAATGTATAGAGGAAGAAGGG - Intronic
1037155147 8:15690670-15690692 TTTTATGTATAGTGTAAGGAAGG + Intronic
1037318595 8:17622847-17622869 CTGCAGGTACACTGAAAGGATGG - Intronic
1039032440 8:33324983-33325005 CTGCCAGTATTGTTGAAGGAAGG - Intergenic
1040614945 8:49025727-49025749 CTGCATGCAGAAAGGAAGGATGG + Intergenic
1040752715 8:50729709-50729731 CTGTATGTAAAGAGGAAGGGAGG + Intronic
1041107831 8:54459039-54459061 TTGCCTGCACAGTGGAAGGAAGG - Exonic
1041670325 8:60485299-60485321 CAGCCTGTATAGGGGAAGGCAGG + Intergenic
1044899695 8:96931062-96931084 CTGCATGTATGTTTGATGGAAGG - Intronic
1045472819 8:102527524-102527546 CTGCATGTTTATGGGAGGGATGG + Intergenic
1049054703 8:140226667-140226689 CTCAATGTGTTGTGGAAGGAGGG - Intronic
1049856940 8:144868120-144868142 CTGCCTGGAAAGGGGAAGGAAGG + Intergenic
1056403140 9:86247866-86247888 CTGCCTCTATAATGGAAGGTAGG - Intronic
1056602862 9:88060083-88060105 CAGCATGAAAAGTGGATGGATGG + Intergenic
1057132620 9:92664635-92664657 CTGCCTGTAAAGGGGAAGCAGGG + Intronic
1059465492 9:114466622-114466644 CTGCAAGTGTAGTGGGGGGAAGG + Intronic
1059963524 9:119590973-119590995 TTACATTTATAATGGAAGGAAGG + Intergenic
1061710816 9:132486639-132486661 CAGCATGTTTAGGGGAATGAGGG - Intronic
1061980958 9:134103406-134103428 CTGGATGGATGGTGGATGGATGG - Intergenic
1061980978 9:134103491-134103513 CTGGATGGATGGTGGATGGATGG - Intergenic
1185581126 X:1212145-1212167 ATGGATGGATAGTGGATGGATGG + Intronic
1185822048 X:3214955-3214977 GTGTATGTGTAGTGGAGGGAGGG + Intergenic
1186284261 X:8027019-8027041 ATGCATGGATGGTGGAAGGAAGG - Intergenic
1192617793 X:72646041-72646063 CTGCATGTATAGAGGGAGGTGGG + Intronic
1193929511 X:87534582-87534604 CTACATGTTATGTGGAAGGATGG + Intronic
1194201961 X:90962984-90963006 TTTTATGTATAGTGTAAGGAAGG - Intergenic
1196904302 X:120417037-120417059 CTGCATGTATTTTGGAACAAGGG + Intergenic
1197347565 X:125343436-125343458 TGGCATGTATATTGGAAGAAAGG + Intergenic
1197509800 X:127356502-127356524 CTGCTTGTGCACTGGAAGGATGG + Intergenic
1199439482 X:147852379-147852401 CAGCAAGTACAGTGGAAGGCTGG - Intergenic
1200547797 Y:4538436-4538458 TTTTATGTATAGTGTAAGGAAGG - Intergenic
1201221327 Y:11773623-11773645 CTGCATGTGCACTGGAAAGATGG - Intergenic
1201305900 Y:12550345-12550367 ATGGATGGATAGTGGATGGATGG + Intergenic