ID: 1029315631

View in Genome Browser
Species Human (GRCh38)
Location 7:99710700-99710722
Sequence CAGTACATGGAGAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 7, 3: 28, 4: 389}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029315631_1029315637 -5 Left 1029315631 7:99710700-99710722 CCTCCCTCCTTCTCCATGTACTG 0: 1
1: 0
2: 7
3: 28
4: 389
Right 1029315637 7:99710718-99710740 TACTGTCCACTCACCTTATTGGG 0: 1
1: 0
2: 1
3: 5
4: 80
1029315631_1029315636 -6 Left 1029315631 7:99710700-99710722 CCTCCCTCCTTCTCCATGTACTG 0: 1
1: 0
2: 7
3: 28
4: 389
Right 1029315636 7:99710717-99710739 GTACTGTCCACTCACCTTATTGG 0: 1
1: 0
2: 1
3: 2
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029315631 Original CRISPR CAGTACATGGAGAAGGAGGG AGG (reversed) Intronic
900542797 1:3212502-3212524 CAGAACATGGGGACGGAGGCAGG - Intronic
900924636 1:5696701-5696723 CAGTCCATGTGGAAGGAGTGGGG - Intergenic
901079641 1:6576701-6576723 GTGTACAGGGAGCAGGAGGGGGG + Intronic
901228368 1:7628169-7628191 CAGCACATGGAGAAGGAGAAGGG - Intronic
901236445 1:7669961-7669983 CAGAAAGTGGAGGAGGAGGGTGG - Intronic
903232021 1:21927700-21927722 CTGGACTGGGAGAAGGAGGGGGG - Intronic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
903363561 1:22792368-22792390 CAGTTGAGGGAGAAGGAGGGGGG + Intronic
903549920 1:24150691-24150713 CAGTAGGAGGAGGAGGAGGGCGG + Intergenic
903641482 1:24863133-24863155 CAGAAGATGCAGGAGGAGGGTGG - Intergenic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
904607256 1:31704539-31704561 CTGTACTGGGAGGAGGAGGGTGG + Intergenic
904848766 1:33441122-33441144 GAGGACGTGGAGCAGGAGGGAGG + Intergenic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905736004 1:40326315-40326337 GACTACATGGAGAGGGAGAGGGG + Intergenic
905909843 1:41646240-41646262 CAGCCTATGGAGAAGGAAGGAGG + Intronic
906291870 1:44624662-44624684 AAGGACAGGGAGAAGGAGGGAGG + Intronic
907241809 1:53085145-53085167 CAGCACCTGGAGGAGCAGGGTGG - Exonic
907405976 1:54253738-54253760 CAGGACATGGAGGTGGATGGGGG + Intronic
907874965 1:58476870-58476892 CAGTACATGGAGGAAGAGGACGG + Intronic
908641029 1:66223711-66223733 CAGTGCATAGAGAAAGAGGAGGG + Intronic
910604768 1:89071732-89071754 CAGCCCATGGAGAAGCAGGGTGG + Intergenic
910662365 1:89687570-89687592 GAGTAAATGGAGAAGGAAGTGGG + Intronic
910666784 1:89734134-89734156 CAGTACCTGGAAAAGGAGAGAGG + Intronic
912133647 1:106632965-106632987 CAGTCCATGGACAATCAGGGGGG - Intergenic
912311483 1:108625655-108625677 CAGTAGATAGAGAAGGATGTAGG - Intronic
912381115 1:109248790-109248812 CAGGACATGGACAGGGAGGCAGG + Intergenic
914247412 1:145896452-145896474 CAGCACATGGATAAAGAGGTGGG + Intronic
915038396 1:152947445-152947467 CTGAGCAGGGAGAAGGAGGGGGG + Intergenic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
916191405 1:162182064-162182086 TAGTACATGAAGAAGGAAGATGG - Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916491956 1:165309716-165309738 AAGTTCATGGGGAAGGTGGGTGG - Intronic
916523930 1:165591452-165591474 CAGTACTTTGGGAAGGAGGTGGG - Intergenic
917480362 1:175406566-175406588 CAGTCAGTGGAGGAGGAGGGAGG - Exonic
917511257 1:175671027-175671049 CATGACATGGAGATGGAGAGAGG + Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918245707 1:182657356-182657378 CAGTTCATGGACAAGCAGGAGGG - Intronic
919887368 1:201944681-201944703 AAGAAGAGGGAGAAGGAGGGAGG - Intronic
919943029 1:202301423-202301445 CAGTTCAGGGAGGTGGAGGGAGG - Intronic
920387099 1:205576907-205576929 CAGTCCAGGGAGATGCAGGGAGG + Intronic
921897131 1:220412707-220412729 GAGTCCATGGAGTAGGTGGGAGG - Intergenic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
924539207 1:244965422-244965444 CAGGACAGTGAGAGGGAGGGAGG - Intergenic
1063192487 10:3709284-3709306 AAGTAAAGGGAAAAGGAGGGTGG - Intergenic
1063264856 10:4436316-4436338 CAGTAGGTGGAGAAAGAGGGAGG + Intergenic
1065198632 10:23291686-23291708 GAGTGCATGGCTAAGGAGGGGGG + Intronic
1065702818 10:28442216-28442238 CAGTGCTTGGGAAAGGAGGGAGG - Intergenic
1066478699 10:35773816-35773838 TGGAACACGGAGAAGGAGGGGGG + Intergenic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1069328830 10:67265585-67265607 TAGTGCAGGGAGTAGGAGGGAGG - Intronic
1069750304 10:70741177-70741199 AAGGACATGGAGTGGGAGGGGGG - Intronic
1069901798 10:71710707-71710729 CAGTACATGAAGAAGCAGGGAGG + Intronic
1070210714 10:74317709-74317731 CAGTACATTGAGAATGAGAATGG + Intronic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070866646 10:79711328-79711350 CAGGACCTGGAGCAGGAGGAAGG + Exonic
1070880435 10:79849449-79849471 CAGGACCTGGAGCAGGAGGAAGG + Exonic
1072641877 10:97217297-97217319 CATTATATGGAGAAGTAGAGTGG + Intronic
1072797047 10:98364202-98364224 CAATACATGGAGAAAGAAGTAGG - Intergenic
1074792826 10:116908871-116908893 CAGTAAATGGAGAAAGAAGTTGG - Intronic
1075518871 10:123132106-123132128 CCGTCCATGGATAAGGAGGTGGG + Intergenic
1077078577 11:712533-712555 CAGGACTAGGAAAAGGAGGGAGG + Intronic
1077847300 11:6039524-6039546 CAGAACCAGGAGAAGGAAGGAGG - Intergenic
1079109909 11:17599564-17599586 CAGCACTTGGGGAAGAAGGGAGG + Intronic
1079132560 11:17756030-17756052 AAGTGCAAGAAGAAGGAGGGAGG + Intronic
1079511631 11:21217119-21217141 AAGTACAGGGTGAAGGAGGGGGG - Intronic
1080044670 11:27796774-27796796 CAGTACTTGGGGAAGGGTGGAGG - Intergenic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083544545 11:63538650-63538672 CAGGACATGGAGAAGTGGGAAGG + Intronic
1085159028 11:74324025-74324047 CTGTACATTGAGACGGAGGCAGG - Intergenic
1085211532 11:74784454-74784476 CAGTAGAGGGAGAAGGTGTGTGG + Intronic
1086808476 11:91273507-91273529 TGTTACATGGAGAAAGAGGGAGG - Intergenic
1089015450 11:115161636-115161658 CAGCACATGGTGATGGAGGTGGG + Intergenic
1089654678 11:119938442-119938464 CCCAACATGGAGAGGGAGGGAGG - Intergenic
1090838345 11:130469501-130469523 CATTACATGGAGTAGGGGTGGGG - Intronic
1091250662 11:134141427-134141449 CGGTACATGGACAGGGAGAGAGG + Intronic
1091306333 11:134538643-134538665 CTGTGCATGGAGAAGCAGGTTGG + Intergenic
1092065968 12:5589851-5589873 CAGGACATGGAGAAGGACCTAGG + Intronic
1092159356 12:6307575-6307597 CAGTAAATGTGGAAGGAAGGGGG + Intergenic
1095882566 12:47153811-47153833 CAGTTCATGGAGAAGGAAATAGG - Intronic
1095909275 12:47409396-47409418 CAGGACATGAAGTTGGAGGGAGG - Intergenic
1096593217 12:52676135-52676157 AAGTACACGGAGCAGGAGGAAGG - Intronic
1096743709 12:53712375-53712397 CAGCAGACGGAGATGGAGGGAGG - Intronic
1097222934 12:57461237-57461259 CAGTAGAGGGAGAAGGCGGGCGG + Intronic
1097679362 12:62634146-62634168 CAGGTCACGGAGGAGGAGGGAGG - Intergenic
1097883461 12:64706589-64706611 CATTACAGGAAGAAGGAGAGGGG + Intergenic
1097928913 12:65162797-65162819 CAGTACATGGGACAGCAGGGTGG + Intergenic
1098521527 12:71439652-71439674 CAGGACTTGGGAAAGGAGGGAGG + Intronic
1101409909 12:104458814-104458836 CAGTGAAAGGAGAAGGCGGGAGG - Intronic
1101594226 12:106149471-106149493 CAGGGCAGGGAGAAGGAAGGCGG + Intergenic
1102176815 12:110882099-110882121 CAGCACAGGGAGAAGGTGTGTGG + Intronic
1102339779 12:112112507-112112529 TAGGACAGGGAAAAGGAGGGAGG + Intergenic
1103004136 12:117408309-117408331 CAGCTCCTGGGGAAGGAGGGGGG - Intronic
1103770122 12:123315929-123315951 AAGAACATGAAGATGGAGGGAGG + Intronic
1104429391 12:128704570-128704592 CAGTGCAGGGAGAAGAGGGGAGG + Intronic
1104632685 12:130417569-130417591 CACTAGATGGTGAAGGAGGGAGG + Intronic
1106690950 13:32115781-32115803 CACTAGAGGGAGAAGGAGGCTGG - Intronic
1106708935 13:32311204-32311226 CCATAGATGGAAAAGGAGGGAGG + Intronic
1107310703 13:39074034-39074056 CAGCACATTGAGAAGGGGGGTGG - Intergenic
1107336321 13:39359622-39359644 GAATACAAGGAGAAGGAGGTAGG + Intronic
1107385504 13:39904395-39904417 CATTCCATGGAGATGAAGGGTGG + Intergenic
1107527292 13:41245884-41245906 CAGGACAGGGATAAAGAGGGAGG - Intronic
1107961544 13:45563646-45563668 CAGTACATGCAGAAGGGGAGAGG + Intronic
1108128968 13:47276557-47276579 CAAGGCATGGAGAAGGAGGAAGG + Intergenic
1112111910 13:96310632-96310654 AGGGACATAGAGAAGGAGGGAGG - Intronic
1112370844 13:98792076-98792098 GAGTATCTGGAGATGGAGGGTGG + Intergenic
1112874789 13:104023954-104023976 CATCACATGGTGAAAGAGGGAGG + Intergenic
1113711203 13:112466664-112466686 CTGTGCATGGAGAAGCTGGGAGG - Intergenic
1114656162 14:24316767-24316789 CAGTACCTGGAGGAGGAGCAGGG + Exonic
1116609486 14:47049277-47049299 CAGGACATGGAGATGGAGGTGGG + Intronic
1118574223 14:67225458-67225480 CAGCACAGGGAGGAGGAGAGAGG + Intronic
1118621776 14:67620266-67620288 CAGAGAATGGAGAGGGAGGGAGG + Intronic
1119511286 14:75213505-75213527 CAGGACATGGAAACGGAGAGAGG + Intergenic
1120770930 14:88379889-88379911 CAGTAGATTGAGTTGGAGGGTGG - Intergenic
1121074976 14:91060418-91060440 GAGAAGATGGAGGAGGAGGGTGG - Exonic
1121303461 14:92890124-92890146 CAGTTCACTGAGATGGAGGGAGG - Intergenic
1121700748 14:95952269-95952291 CCATTCTTGGAGAAGGAGGGAGG - Intergenic
1122198134 14:100105055-100105077 CAGTAGATGGAGCAGCAAGGAGG - Intronic
1122272912 14:100576347-100576369 CAGTGCATGGAGGAGGAGGGAGG - Intronic
1122293735 14:100693610-100693632 CCGTCCATGGAGAGGGAAGGAGG - Intergenic
1122534552 14:102453039-102453061 CAGTACCTGGCGGAGGAGAGTGG + Intronic
1122646258 14:103196420-103196442 CAGCACATGAAGACGGAGGCAGG - Intergenic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1124140389 15:27072313-27072335 GTGTCCATGGAGAAGGAGGTAGG - Intronic
1125965176 15:43869073-43869095 CAGTACATGGGGTAGGGTGGGGG + Intergenic
1126436662 15:48644902-48644924 CAGCGCCTGGAGAAGGCGGGAGG - Exonic
1127365342 15:58284283-58284305 GGGCACAGGGAGAAGGAGGGAGG + Intronic
1127967395 15:63932608-63932630 CAGTAGCTTGAGAAGGAGGAAGG + Intronic
1128904042 15:71451733-71451755 AGGGACCTGGAGAAGGAGGGAGG - Intronic
1129163420 15:73760821-73760843 CAGTACTTGGAGAGGGAAGTGGG - Intergenic
1129594603 15:76952520-76952542 AAGTTCATGGAGATGGAAGGTGG - Intronic
1130751433 15:86717207-86717229 GAGAACAAGGAGAAGGAGTGGGG + Intronic
1131133307 15:89913529-89913551 CTGTGCAGGAAGAAGGAGGGAGG - Intergenic
1131827307 15:96331753-96331775 CAGAACGTGGAGAAAGAGGGAGG - Exonic
1132535045 16:474631-474653 CAGTAGTGGGAGAAGGAGGGAGG - Intronic
1132765282 16:1531410-1531432 CAGAACAGGGACACGGAGGGAGG - Intronic
1132931384 16:2460705-2460727 CAGCACCTGGAGAAGGCGGGTGG - Intronic
1133075479 16:3277285-3277307 CTGTCCAAGGAGAAAGAGGGGGG + Intronic
1133360347 16:5169045-5169067 CAGTATATGGGGATGGATGGGGG + Intergenic
1134038185 16:11048194-11048216 TAATACATGGAGAAGCACGGGGG - Intronic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137755608 16:50899712-50899734 CAAGACCTGGAGAAGGTGGGAGG - Intergenic
1137876299 16:51999605-51999627 CATTTCAAGGAGAAGGAAGGGGG - Intergenic
1137989395 16:53138016-53138038 AAGTTCCTGGGGAAGGAGGGGGG + Intronic
1138024293 16:53510849-53510871 GAGTACATGGAGATGAGGGGTGG + Intergenic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1140050567 16:71477641-71477663 CAGGCCATTGAGAAGGTGGGTGG - Intronic
1140668263 16:77248001-77248023 CAGTCCATGAAGAAGGACTGAGG - Intronic
1141659718 16:85435428-85435450 CAGTCGAGGGAGAGGGAGGGAGG - Intergenic
1142176604 16:88648168-88648190 CAGTAGGTAGAGAAGGGGGGTGG - Intronic
1142235383 16:88920069-88920091 CACTATCTGGGGAAGGAGGGAGG - Intronic
1142254330 16:89006715-89006737 GAGGAGATGGAGGAGGAGGGAGG - Intergenic
1142254355 16:89006776-89006798 GAGGAGATGGAGGAGGAGGGAGG - Intergenic
1142511124 17:394081-394103 CTGTTCATGGAGAGGGAGCGAGG - Intergenic
1142756755 17:2021034-2021056 CACGAGATGGAGAAGCAGGGAGG + Intronic
1143267682 17:5652718-5652740 CAGTATATGGGGAGGGAGGAAGG + Intergenic
1143712284 17:8743226-8743248 CAGTGCAAGGACAAGGATGGAGG + Intronic
1144718949 17:17454460-17454482 AAGTACCTGGAGTAGGTGGGTGG + Intergenic
1144773445 17:17771960-17771982 CATTAACTGGAGATGGAGGGTGG + Intronic
1144862597 17:18314993-18315015 AAGTAGCTGGAGAAGGCGGGCGG - Exonic
1145020927 17:19430092-19430114 CAAAACAAGGAGAAGCAGGGAGG + Intergenic
1145201535 17:20949700-20949722 AGGTACATGGGGAAGGAAGGCGG + Intergenic
1146736388 17:35242556-35242578 AATTACTAGGAGAAGGAGGGAGG + Intergenic
1146798509 17:35800036-35800058 CAGTGCAGAGAGAGGGAGGGAGG - Intronic
1146827243 17:36033440-36033462 CAGTAAATGGAGCAGCATGGTGG - Intergenic
1147750064 17:42725796-42725818 TAGTACATGGAGAAGCAAAGTGG + Intronic
1148205145 17:45775293-45775315 CAGTCCATGGTGAAGGAAGTAGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1151315596 17:73320147-73320169 CAGTAAAAAGAGAAGGAAGGAGG - Intergenic
1153295025 18:3536828-3536850 GAGAACATGGGGAAGGTGGGAGG + Intronic
1154494193 18:14944012-14944034 CAAGACAAGGAGAGGGAGGGAGG + Intergenic
1155280846 18:24238080-24238102 CAGTACATGGAAAATGATGTTGG - Intronic
1156924832 18:42563645-42563667 GAGTACATGGTGAAGGGGAGTGG + Intergenic
1157654189 18:49369263-49369285 CAGGCAATGGGGAAGGAGGGTGG - Intronic
1158178287 18:54682668-54682690 TAATATATGGAGAAGGAGAGGGG - Intergenic
1158610127 18:58932175-58932197 AAGCACAAGGAGAAAGAGGGAGG - Intronic
1159127329 18:64238777-64238799 CAGGAAATGGAGAAGGGGGTTGG - Intergenic
1159247470 18:65828021-65828043 AACTACGTGGAGAAGGAGGAGGG - Intronic
1160349761 18:78166713-78166735 CAGTATATGTAGATGGAGAGGGG + Intergenic
1162126038 19:8499956-8499978 CACTAAATGGAGAAGTAGGGAGG - Intronic
1162141205 19:8586465-8586487 CAGCACCTGGAGAAAGGGGGCGG + Exonic
1162510629 19:11116083-11116105 CAGTACATGAAGCTGGTGGGAGG - Exonic
1162973800 19:14196791-14196813 CAGGACATGGTGTAGGAGTGTGG - Intronic
1164250274 19:23469629-23469651 GAGGAGATGGAGAAGGAGGGGGG - Intergenic
1164526533 19:29017321-29017343 CCCTCCATGGAGAAGGAGGATGG - Intergenic
1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG + Intergenic
1165144227 19:33721288-33721310 CAGAAGATGGAGAAGGACTGGGG - Intronic
1165781642 19:38438077-38438099 CAGGAGATGGAGCAGGATGGTGG - Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1168082110 19:54017718-54017740 AAGTAAAAGGAGGAGGAGGGAGG - Intergenic
1168514791 19:57002290-57002312 CAATACATGGAGTGGGCGGGTGG + Intergenic
927041416 2:19234413-19234435 CAGTGCTTGGAGAAGGGGGAAGG + Intergenic
928662140 2:33513633-33513655 TAGGACTTGGAGCAGGAGGGAGG - Intronic
928690157 2:33791191-33791213 CAATTTATGGAGATGGAGGGGGG - Intergenic
928979305 2:37121810-37121832 CACGACATGGAGATGGAGGTGGG + Intronic
930620415 2:53637694-53637716 TGGTCCATGGAGAGGGAGGGAGG - Intronic
932412265 2:71554520-71554542 CAGTGCAAGGAGATGGGGGGTGG + Intronic
935736552 2:106111121-106111143 CAGGACAGGGAGAATGAGAGTGG + Intronic
937160857 2:119759858-119759880 GAGGAGGTGGAGAAGGAGGGGGG + Exonic
938794550 2:134706749-134706771 CAGTACATGGGGATGGGAGGAGG + Intronic
940124252 2:150306688-150306710 CAGTATCTGGAGAAGGAGATAGG - Intergenic
940670157 2:156657699-156657721 CTGTACAGGGAGAAGGAGAAGGG + Intergenic
941983389 2:171485350-171485372 CAGTTCCTGGGGAAGGAAGGAGG - Intergenic
942106238 2:172636340-172636362 CATTACATGGTGAGAGAGGGCGG + Intergenic
942398302 2:175575370-175575392 CTTCACATGGAGAGGGAGGGAGG - Intergenic
943354681 2:186837195-186837217 CAGTATATGCAGGAAGAGGGAGG + Intronic
944324036 2:198382555-198382577 AATAACATGGAGCAGGAGGGAGG + Intronic
945040661 2:205741360-205741382 CATTACCTGGTGAAGAAGGGAGG + Intronic
945152098 2:206802590-206802612 CAGTGTATGGAGAGGAAGGGTGG + Intergenic
946149366 2:217753769-217753791 CAGTAACTGGAGAAGGGGGCAGG + Intronic
946254892 2:218435221-218435243 CAGTGAATGTAGTAGGAGGGTGG + Intronic
946919691 2:224566065-224566087 CTGTAGATGGGGAAGGTGGGGGG - Intronic
946980160 2:225204417-225204439 CATTAAAGGGAGAAGGAAGGAGG - Intergenic
947377733 2:229513884-229513906 GAGGACAGGGAGAGGGAGGGAGG - Intronic
948086958 2:235258714-235258736 CAGTGCCTGGAGAAGGGGCGTGG - Intergenic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
949066818 2:241996004-241996026 AAGCACATTGAGAAGGAGGCTGG - Intergenic
1169147411 20:3261931-3261953 CAGAAAATGTGGAAGGAGGGTGG + Intronic
1170160606 20:13306540-13306562 CAGCAAATGGAGAAGGAGAAAGG + Intergenic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1171015826 20:21540910-21540932 CAGGAAATGGAGGAGGAGGTGGG + Intergenic
1171350000 20:24494787-24494809 CAGTACATGGGGAAGGCTGGAGG - Intronic
1171455536 20:25269915-25269937 CTGGCCATGGAGAAGGATGGAGG - Intronic
1173343344 20:42175083-42175105 AAGAACATGGAGAAGGAAGAGGG - Intronic
1175175121 20:57106885-57106907 CAGAACATGGAGGAAGAGAGAGG - Intergenic
1176377562 21:6094050-6094072 CAGCACATGGAGAACGCGGCAGG - Intergenic
1176914433 21:14608242-14608264 CAGGAGATAGAGGAGGAGGGTGG - Intronic
1177219955 21:18179665-18179687 AAGTACAAGGAAAAGGAGAGTGG - Intronic
1177933440 21:27314995-27315017 CAGGACATGGAAAAGGAGACAGG - Intergenic
1178748192 21:35274051-35274073 AAGTGCATTGAGGAGGAGGGGGG - Intronic
1180179298 21:46110952-46110974 CAGGACTTTGATAAGGAGGGAGG - Intronic
1181940998 22:26476876-26476898 CAGTACATGGATGAGGTTGGTGG + Intronic
1182132529 22:27867239-27867261 CAGGAGATGGAGGAGGTGGGGGG + Intronic
1182603379 22:31484942-31484964 CAGTACATAGACAAGGAAGAAGG + Intronic
1182848080 22:33447766-33447788 CAGCACAGGGAGGAGGAGGAAGG + Intronic
1182937685 22:34241207-34241229 CAGTACATGGAGAGGGCATGTGG + Intergenic
1183565158 22:38609149-38609171 CATTACAGGCAGCAGGAGGGAGG + Intronic
1184667519 22:45996690-45996712 CAGGCCGTGGAGCAGGAGGGCGG - Intergenic
1185186266 22:49402339-49402361 CATTACCTGGAGGAGGAGGAAGG - Intergenic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949815203 3:8050876-8050898 CTGTAAATGGTGAAGGAGGGTGG + Intergenic
950482732 3:13254684-13254706 GAGTCCATGGAGGAGGAGGGAGG - Intergenic
951474946 3:23094907-23094929 GAATACATGGAGAAGGAAGGAGG + Intergenic
951679936 3:25284060-25284082 CAGCAAAATGAGAAGGAGGGAGG - Intronic
952498700 3:33938836-33938858 CAGGAGATGGAGAGGAAGGGTGG + Intergenic
952836190 3:37604207-37604229 CTTTAAATGGAGAAGGAGTGGGG + Intronic
953064355 3:39455728-39455750 CTGGAGATGGAGATGGAGGGTGG + Intergenic
954430338 3:50467463-50467485 CAGTAGATGGAGAAGCAAAGCGG - Intronic
955079156 3:55641716-55641738 CAGTAGAAGGAAAAGGAGAGAGG - Intronic
955109222 3:55931114-55931136 GAGGACATGGAGAAATAGGGAGG + Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
956055182 3:65291082-65291104 AAGGCCATGGTGAAGGAGGGGGG - Intergenic
956147837 3:66210116-66210138 TAGAAAAGGGAGAAGGAGGGAGG - Intronic
956630286 3:71310607-71310629 CGGAACATGGAGAGGGAGGCAGG - Intronic
956811289 3:72866339-72866361 TAGAAGATGGAGAAAGAGGGAGG - Intergenic
958542176 3:95492413-95492435 CATTACATAGAGAAAGAAGGAGG + Intergenic
959144938 3:102533183-102533205 GACTACATGGAGAAGGAGGGAGG - Intergenic
959523643 3:107349921-107349943 GACTATATGGAGAAGGAGAGGGG - Intergenic
959563665 3:107812468-107812490 CAGTATATGCAGAAGTAGAGAGG + Intergenic
960357751 3:116674360-116674382 GTGTACATGCAGAAGGAGGTGGG - Intronic
960991220 3:123312951-123312973 CTGAACATGGGGCAGGAGGGAGG + Intronic
961518658 3:127454617-127454639 CAGTACATGGCATATGAGGGTGG + Intergenic
963538012 3:146552384-146552406 CACTTAATGGAGAAGGAGGCTGG + Intergenic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
963603015 3:147393413-147393435 CAGTGCAGGGAGCTGGAGGGAGG - Intronic
963702423 3:148643200-148643222 CAGTTCATAGATAAGGAAGGAGG - Intergenic
966103407 3:176304538-176304560 ATGTACATGTAGGAGGAGGGAGG + Intergenic
967281135 3:187824769-187824791 CAGTATATGCATGAGGAGGGTGG - Intergenic
967312375 3:188118112-188118134 CACTACTTGGAGAATGAGGAGGG + Intergenic
967642884 3:191887909-191887931 CAGTTCATGGAGACGGTGCGAGG - Intergenic
968051248 3:195656479-195656501 CAGTACATGCAGACTGAAGGAGG + Intergenic
968104576 3:195991860-195991882 CAGTACATGCAGACTGAAGGAGG - Intergenic
968199534 3:196740208-196740230 CAGGCCACGGAGAAGGAAGGAGG - Intronic
968302867 3:197629443-197629465 CAGTACATGCAGACTGAAGGAGG - Intergenic
968451978 4:680194-680216 CAGCACGTGGGGCAGGAGGGCGG - Intronic
969208693 4:5669637-5669659 CACTTCATGAAGCAGGAGGGAGG - Intronic
969699575 4:8760798-8760820 CACCACAGGGAGAAGCAGGGAGG - Intergenic
970064859 4:12081680-12081702 CAAGACATGGAGAAGGGGGATGG + Intergenic
972384223 4:38548540-38548562 AAGTACATGGAGAACAATGGAGG + Intergenic
973872766 4:55183021-55183043 CACCACATGGAGGAGGAGGTAGG - Intergenic
975322360 4:73023191-73023213 CCTAAAATGGAGAAGGAGGGAGG - Intergenic
975868128 4:78746940-78746962 AACTACATGGAGTAGGAGAGGGG + Intergenic
977033270 4:91915712-91915734 GAGATCATGTAGAAGGAGGGAGG + Intergenic
977428797 4:96904561-96904583 CTAAACATGGAGAGGGAGGGAGG + Intergenic
979121190 4:116904312-116904334 CAGTTAATGGTGAAGAAGGGAGG + Intergenic
979288829 4:118957433-118957455 TGGTAAATGGAGAGGGAGGGAGG - Intronic
979912695 4:126389472-126389494 CACTTCATGTAGAACGAGGGAGG - Intergenic
979955248 4:126945240-126945262 CAGTATTTGGAGAATGAGTGAGG - Intergenic
981729765 4:147885065-147885087 CAGTAGAGGGTGAAGGAGTGGGG + Intronic
982013163 4:151126417-151126439 CAGTGCTAGAAGAAGGAGGGTGG - Intronic
982807638 4:159786393-159786415 CAGTACAGGGAGAAAGATGTAGG - Intergenic
983531521 4:168814382-168814404 CAGTGCAGGGACAATGAGGGTGG + Intronic
986496697 5:8349331-8349353 CATCCCATGGAGAAGCAGGGAGG - Intergenic
987226540 5:15847623-15847645 CATTATATGGAAAAGGTGGGGGG + Intronic
988187952 5:27890810-27890832 CAGGAGAGAGAGAAGGAGGGGGG - Intergenic
988276286 5:29084993-29085015 CAGAACATAGACAATGAGGGAGG + Intergenic
990758972 5:59107598-59107620 CAGTAGAAGGAGAAGTAGAGGGG + Intronic
991121285 5:63017474-63017496 GATTACATGAAGATGGAGGGTGG - Intergenic
991301338 5:65132113-65132135 CCGTACATTGACAAGGATGGTGG + Intergenic
992071724 5:73154786-73154808 CTGGGAATGGAGAAGGAGGGAGG - Intergenic
995285998 5:110388794-110388816 CAGTACATGCAGAATCGGGGTGG + Intronic
995649892 5:114358684-114358706 GAGTACAGAGAGAAGGAGAGAGG - Intergenic
995972942 5:117994947-117994969 CAGTTCAGGGGGATGGAGGGAGG + Intergenic
996085745 5:119303372-119303394 CAGCAGAGGGAGAAGGAAGGAGG - Intronic
997972939 5:138419166-138419188 CAGTGCAGGGCGGAGGAGGGTGG - Exonic
1000920674 5:167133118-167133140 CAGTAAAGGGGGAAGAAGGGAGG + Intergenic
1002255779 5:177957734-177957756 CAGTAAATGGAAAAGGAGCCAGG + Intergenic
1003301733 6:4889984-4890006 TGGTACATGGTTAAGGAGGGAGG + Intronic
1003861780 6:10328830-10328852 CAGTAAATGAAGCAAGAGGGTGG - Intergenic
1005209723 6:23446718-23446740 CATTACATGGTGAATGCGGGAGG - Intergenic
1005379770 6:25221973-25221995 TAGTACCTGGAGCAGGAGTGAGG + Intergenic
1006111280 6:31747187-31747209 CCGTACATGGAGATGGGGGAAGG - Intronic
1007272130 6:40645887-40645909 CAGCACATGTAGAAGGGGAGGGG + Intergenic
1007829864 6:44629907-44629929 CAAGACCTGTAGAAGGAGGGAGG - Intergenic
1008290831 6:49713779-49713801 CCGTACTAGGAGGAGGAGGGAGG + Intergenic
1008966908 6:57322043-57322065 CAGTGGTTGGAGAAGGAAGGTGG + Intronic
1010198737 6:73264434-73264456 CAGTACAGGAACAAGGAGGCAGG + Intronic
1010370679 6:75103476-75103498 CAGAACATGGGGAAGCAGAGGGG - Intronic
1012438419 6:99239160-99239182 AGCTACATGGAGAAGGAGAGAGG + Intergenic
1013071097 6:106729996-106730018 GAGCAGGTGGAGAAGGAGGGAGG + Intergenic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1013585384 6:111573845-111573867 CAGAAGATGGAGAAGAAAGGGGG + Intronic
1013590170 6:111613109-111613131 CAGGAGGTGGAGGAGGAGGGTGG - Intergenic
1014298078 6:119644767-119644789 CAGTACAAGTAGAAGGAAAGTGG - Intergenic
1014692189 6:124575540-124575562 CACTTCATGCAGAAGCAGGGTGG - Intronic
1014789883 6:125660165-125660187 CAATACATGAAGAAGTAGGAGGG - Intergenic
1014838181 6:126183820-126183842 CGATACGTGGGGAAGGAGGGTGG + Intergenic
1015748337 6:136534933-136534955 CCGTACATGGGGATGGAGAGAGG + Intronic
1015845208 6:137513237-137513259 CAGTTCAAGGAAAAAGAGGGGGG + Intergenic
1015979240 6:138822253-138822275 CATTACATGGGGAAGGAGGCCGG + Intronic
1017919336 6:158857649-158857671 AAGTACATGGTGAGGGAGGCAGG - Intergenic
1018063191 6:160106255-160106277 CACAGCATGGAGGAGGAGGGAGG + Exonic
1018492117 6:164304529-164304551 TAGGACATAGAGAAAGAGGGAGG - Intergenic
1018533429 6:164793289-164793311 AGGCACATGGAGAAAGAGGGAGG + Intergenic
1018949377 6:168369232-168369254 CAGTACATACAGAAGGAGGGAGG - Intergenic
1019023143 6:168935826-168935848 CAGGGCCTGGAGCAGGAGGGAGG - Intergenic
1019032332 6:169024200-169024222 CAGTGCACGGAGGAGCAGGGGGG + Intergenic
1019343860 7:520356-520378 CAGTCTTTGGGGAAGGAGGGGGG + Intergenic
1019860448 7:3653585-3653607 CAGGAAATGGAGAGGGAAGGAGG + Intronic
1020979252 7:15047025-15047047 CACTCCCTGGAGAAGGAGGGAGG + Intergenic
1021011705 7:15476453-15476475 CAGAACATGGATAAGGGCGGTGG + Intronic
1022127470 7:27372274-27372296 CATTACATGGTGAGGGAGGAAGG + Intergenic
1022494237 7:30843308-30843330 CAGCATTTGGAGGAGGAGGGTGG + Intronic
1023601426 7:41885248-41885270 CAGCTCCTGGAGAAGCAGGGAGG + Intergenic
1023727786 7:43162422-43162444 CAGACCATGGAGATGGAGGTTGG - Intronic
1023754932 7:43407655-43407677 CTGTCCATGGTGAGGGAGGGCGG - Exonic
1023867258 7:44244154-44244176 CACTACATGGGGCAGGAAGGAGG + Intronic
1024029248 7:45443278-45443300 CAGTTACTGGAGAAGAAGGGAGG - Intergenic
1024565354 7:50675798-50675820 CAGCACATGGAGATGGGGAGGGG + Intronic
1025009014 7:55380668-55380690 GAGTAATTGGAGGAGGAGGGAGG + Intronic
1027051785 7:75025393-75025415 CAGTCCTTGGGGGAGGAGGGAGG + Intergenic
1027385481 7:77655568-77655590 TGGTACATGGAGAAGTAGGAAGG - Intergenic
1028088800 7:86671851-86671873 CAGTAAATGGATAAGGAGACTGG - Intronic
1028601003 7:92600395-92600417 CAATCCAAGGAGCAGGAGGGAGG + Intergenic
1028686479 7:93594712-93594734 CAGAACGTGGATGAGGAGGGAGG + Intronic
1029315631 7:99710700-99710722 CAGTACATGGAGAAGGAGGGAGG - Intronic
1029321385 7:99763823-99763845 TGGTACATGGAGAAGGAGGGAGG - Intronic
1029629631 7:101742394-101742416 CCGTGTTTGGAGAAGGAGGGGGG + Intergenic
1030849877 7:114470797-114470819 AAAAACATGGAGAAGGAGGATGG - Intronic
1031526308 7:122825114-122825136 CAGTAACTGGATGAGGAGGGAGG + Intronic
1032447664 7:131998623-131998645 CAGGGCATGGAGAAGGAGAGGGG + Intergenic
1033031038 7:137827064-137827086 TAGCACATGAAGAAGGAAGGGGG - Intronic
1033787759 7:144754437-144754459 CAGCTCATAGACAAGGAGGGAGG - Intronic
1034563931 7:151898747-151898769 CAGTACCTGGAGGGGGATGGGGG - Intergenic
1035352060 7:158253982-158254004 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352074 7:158254056-158254078 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352088 7:158254130-158254152 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352120 7:158254281-158254303 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352135 7:158254355-158254377 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352167 7:158254503-158254525 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352196 7:158254651-158254673 CTGAACGTGGAGATGGAGGGCGG - Intronic
1036223354 8:6939245-6939267 CACTACAAGGAGGAGGATGGTGG - Intergenic
1037756022 8:21710535-21710557 CATGGCATGGAGAAGGACGGTGG - Intronic
1041155795 8:54985481-54985503 GAGAAGAGGGAGAAGGAGGGAGG + Intergenic
1041273208 8:56129956-56129978 CAGGAGATGGAGAAGAAGGAAGG + Intergenic
1041456631 8:58067459-58067481 CAGTGGATGGAGGAGGAAGGAGG - Intronic
1041686375 8:60648746-60648768 CAGAAGATGGAGAAGGGAGGAGG - Intergenic
1042853624 8:73241600-73241622 CAGAACCTGGAGGAGGAGGTGGG + Exonic
1044288222 8:90436232-90436254 CAGTACAGAATGAAGGAGGGAGG - Intergenic
1044337719 8:91007195-91007217 CTGTACATGGAGAAGCAAAGTGG - Intronic
1045655066 8:104377983-104378005 CAGTACCTAGGGGAGGAGGGAGG + Intronic
1046759310 8:118004759-118004781 TATTACATGGAGAATGTGGGTGG - Intronic
1046890516 8:119416588-119416610 CAGGAGATGGAGAAGCAGGAAGG - Exonic
1047756611 8:127923747-127923769 GGGCACATGGAGAAGGAGGAAGG + Intergenic
1048282313 8:133114417-133114439 CAGTACTAGGAGAGGGAGGCAGG - Intronic
1048336148 8:133503971-133503993 CTGTACATGGAGAGGAGGGGAGG + Intronic
1048410643 8:134168841-134168863 CAGTTGAAGGATAAGGAGGGTGG + Intergenic
1049010269 8:139882646-139882668 CAGCACAGGGGGTAGGAGGGTGG + Intronic
1049761752 8:144334781-144334803 GAGTGCATGGAGGAGCAGGGAGG - Intronic
1051023930 9:12582668-12582690 CTGTAGATGGAGGAGGTGGGAGG - Intergenic
1051868493 9:21709312-21709334 AAGTCCATGGTGGAGGAGGGAGG - Intergenic
1052138701 9:24949456-24949478 CAGTACATGCAGAAAGTGGGAGG + Intergenic
1052434415 9:28407988-28408010 GAGTACAGCGAGAGGGAGGGAGG + Intronic
1052758720 9:32567799-32567821 CAGTCCAAGGAGAGGGAGAGAGG - Exonic
1053306531 9:36988019-36988041 GAGAAGATGAAGAAGGAGGGAGG + Intronic
1055322985 9:75100348-75100370 GGGCACATGGACAAGGAGGGAGG - Intronic
1056554455 9:87677158-87677180 CAATAAATGGAGAAGGAGGGAGG - Intronic
1057890257 9:98864578-98864600 CTGCAGATGGAGAAGGAAGGAGG - Intergenic
1061413024 9:130431238-130431260 CAGGACAGGGAGAAGGAGCAGGG + Intronic
1061819578 9:133218901-133218923 CAGTCCATGCAGACAGAGGGTGG + Intergenic
1061865786 9:133491152-133491174 GAGGACTTGGAGGAGGAGGGAGG + Intergenic
1185553468 X:1002245-1002267 CAGACCCTGGAGAAGGAGAGGGG + Intergenic
1186921806 X:14290538-14290560 CATTACATAGAGAAGAAGGTGGG + Intergenic
1187492035 X:19761135-19761157 CAGGAGAGGGAGAAGGAGAGAGG + Intronic
1187637628 X:21249320-21249342 CAGGACAGGGATGAGGAGGGAGG + Intergenic
1187795268 X:22996961-22996983 CAATTCATGGAGAAGTATGGAGG + Intergenic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1188823837 X:34805769-34805791 CAGCACATGGTGGAGAAGGGAGG - Intergenic
1190171003 X:48111627-48111649 CTGTAAATGGAGAAGGAGCAGGG + Intergenic
1190183159 X:48211211-48211233 CTGTAAGTGGAGAAGGAGGGAGG + Intronic
1190188871 X:48258900-48258922 CTGTAAATGGAGAAGGGGCGGGG + Intronic
1192207568 X:69106415-69106437 CAGAACAGGCACAAGGAGGGGGG - Intergenic
1193656648 X:84206466-84206488 CAGTACATGAGGAAGGGGAGGGG + Intergenic
1195329011 X:103781207-103781229 CAGGGCATGGGAAAGGAGGGAGG + Intronic
1196124222 X:112082347-112082369 AAGGAGAGGGAGAAGGAGGGAGG + Exonic
1196158246 X:112454389-112454411 TATTACAAGGAAAAGGAGGGAGG + Intergenic
1196505537 X:116436740-116436762 AAGTGCAGGGAGAAGGAGGTAGG + Exonic
1197559826 X:128005794-128005816 CATTCAATGGAGAAGGAGAGTGG - Intergenic
1197967111 X:132076895-132076917 CAGAACATGGAAAAGGAGGGAGG - Intergenic
1198487848 X:137106312-137106334 CAGTACATGCACTAGGAGGCAGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199460337 X:148077097-148077119 CAGTACATGGAAGAGAATGGGGG - Intergenic
1199716338 X:150509567-150509589 CAGAGTATGTAGAAGGAGGGAGG - Intronic
1201060298 Y:10038360-10038382 CAGTACTTCCAGAGGGAGGGAGG + Intergenic
1201949802 Y:19550928-19550950 TAGTAGGTGGAGAAGGAGGTGGG + Intergenic