ID: 1029316597

View in Genome Browser
Species Human (GRCh38)
Location 7:99721097-99721119
Sequence ACAGCTGCTGCAGTTGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029316585_1029316597 30 Left 1029316585 7:99721044-99721066 CCACTGCACCTCTTCCACCGCTC 0: 1
1: 0
2: 1
3: 29
4: 336
Right 1029316597 7:99721097-99721119 ACAGCTGCTGCAGTTGGCTGAGG No data
1029316589_1029316597 4 Left 1029316589 7:99721070-99721092 CCAAACCTCTAGCCCCTCTGACA 0: 2
1: 0
2: 1
3: 15
4: 185
Right 1029316597 7:99721097-99721119 ACAGCTGCTGCAGTTGGCTGAGG No data
1029316594_1029316597 -9 Left 1029316594 7:99721083-99721105 CCCTCTGACAGGGAACAGCTGCT 0: 2
1: 0
2: 0
3: 16
4: 183
Right 1029316597 7:99721097-99721119 ACAGCTGCTGCAGTTGGCTGAGG No data
1029316595_1029316597 -10 Left 1029316595 7:99721084-99721106 CCTCTGACAGGGAACAGCTGCTG 0: 2
1: 1
2: 3
3: 22
4: 235
Right 1029316597 7:99721097-99721119 ACAGCTGCTGCAGTTGGCTGAGG No data
1029316587_1029316597 16 Left 1029316587 7:99721058-99721080 CCACCGCTCTTGCCAAACCTCTA 0: 1
1: 0
2: 3
3: 4
4: 99
Right 1029316597 7:99721097-99721119 ACAGCTGCTGCAGTTGGCTGAGG No data
1029316593_1029316597 -8 Left 1029316593 7:99721082-99721104 CCCCTCTGACAGGGAACAGCTGC 0: 2
1: 0
2: 0
3: 16
4: 164
Right 1029316597 7:99721097-99721119 ACAGCTGCTGCAGTTGGCTGAGG No data
1029316586_1029316597 22 Left 1029316586 7:99721052-99721074 CCTCTTCCACCGCTCTTGCCAAA 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1029316597 7:99721097-99721119 ACAGCTGCTGCAGTTGGCTGAGG No data
1029316592_1029316597 -1 Left 1029316592 7:99721075-99721097 CCTCTAGCCCCTCTGACAGGGAA 0: 2
1: 0
2: 0
3: 11
4: 145
Right 1029316597 7:99721097-99721119 ACAGCTGCTGCAGTTGGCTGAGG No data
1029316588_1029316597 13 Left 1029316588 7:99721061-99721083 CCGCTCTTGCCAAACCTCTAGCC 0: 1
1: 0
2: 1
3: 6
4: 192
Right 1029316597 7:99721097-99721119 ACAGCTGCTGCAGTTGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029316597 Original CRISPR ACAGCTGCTGCAGTTGGCTG AGG Intronic
No off target data available for this crispr