ID: 1029318200

View in Genome Browser
Species Human (GRCh38)
Location 7:99733678-99733700
Sequence GTGACCTCCACTAGGGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 1, 2: 2, 3: 9, 4: 88}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029318194_1029318200 -3 Left 1029318194 7:99733658-99733680 CCAACATGTTTGTCCTTCAAGTG 0: 1
1: 0
2: 1
3: 11
4: 175
Right 1029318200 7:99733678-99733700 GTGACCTCCACTAGGGGGCCAGG 0: 1
1: 1
2: 2
3: 9
4: 88
1029318192_1029318200 28 Left 1029318192 7:99733627-99733649 CCTTGTGTCCAGGCTTCAAGCAG 0: 1
1: 2
2: 1
3: 21
4: 235
Right 1029318200 7:99733678-99733700 GTGACCTCCACTAGGGGGCCAGG 0: 1
1: 1
2: 2
3: 9
4: 88
1029318191_1029318200 29 Left 1029318191 7:99733626-99733648 CCCTTGTGTCCAGGCTTCAAGCA 0: 1
1: 1
2: 2
3: 147
4: 2762
Right 1029318200 7:99733678-99733700 GTGACCTCCACTAGGGGGCCAGG 0: 1
1: 1
2: 2
3: 9
4: 88
1029318193_1029318200 20 Left 1029318193 7:99733635-99733657 CCAGGCTTCAAGCAGATGAGATG 0: 2
1: 3
2: 0
3: 20
4: 178
Right 1029318200 7:99733678-99733700 GTGACCTCCACTAGGGGGCCAGG 0: 1
1: 1
2: 2
3: 9
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029318200 Original CRISPR GTGACCTCCACTAGGGGGCC AGG Intronic
900226236 1:1534828-1534850 GTGCCCGCCACTGCGGGGCCAGG + Intergenic
900352199 1:2240468-2240490 GGGACCTCCTCATGGGGGCCAGG - Intronic
901713089 1:11131051-11131073 GTGAGCTCCCCTAGGAGGCCGGG - Intronic
901795497 1:11677154-11677176 GGGACCTTCCCTATGGGGCCCGG - Intronic
902241714 1:15094396-15094418 GTGGCATCCCATAGGGGGCCCGG - Intronic
902717631 1:18283404-18283426 CTGTCCTCCCCAAGGGGGCCTGG - Intronic
903787378 1:25870312-25870334 GTGACCTCTACTATGGGACTGGG + Intronic
904713520 1:32449315-32449337 GAGGCCACCACTAGGGGGCGGGG + Intergenic
917683528 1:177392323-177392345 GTGGCCTCCACTGGGGGCCATGG + Intergenic
920039333 1:203085509-203085531 GTGACCTCCGCTACCGGGGCGGG - Exonic
1069786966 10:70994670-70994692 GCCACCTTCACTAGGGGGCAAGG - Intergenic
1069834987 10:71302616-71302638 GTCACCTCCCCTAAGGGACCCGG - Exonic
1070574404 10:77666663-77666685 GTGGCCCACACTGGGGGGCCTGG + Intergenic
1074565947 10:114578039-114578061 GTGACCTGCATTTAGGGGCCTGG - Intronic
1079012480 11:16840713-16840735 GTGACCTCCATCAAGAGGCCAGG - Intronic
1081682996 11:45021952-45021974 GTGGCCTCCATCAGGGGGCAGGG + Intergenic
1092000778 12:5030263-5030285 GTCACCTCCAGCAGGTGGCCTGG + Intergenic
1104571997 12:129933882-129933904 GTCATCTCCACTAGCAGGCCAGG - Intergenic
1104600605 12:130150837-130150859 GTGACCTGCACCAAGGTGCCTGG - Intergenic
1112565033 13:100545420-100545442 GTGCCCTCCTCCAGGGGCCCTGG - Intronic
1118328812 14:64800226-64800248 ATGCCAGCCACTAGGGGGCCAGG + Intronic
1119431066 14:74568212-74568234 GTGTCCTGCACAAGGGTGCCAGG - Intronic
1121651544 14:95562578-95562600 GTGACCTATGCTAGGGGGTCAGG - Intergenic
1123032169 14:105457054-105457076 CTGCCCTCCACTGGGGCGCCCGG - Intronic
1123927732 15:25134775-25134797 GCCACCACCACTAGGGTGCCAGG + Intergenic
1127749678 15:62022180-62022202 CAGACATCCACTAGGGGGCTTGG - Intronic
1129156671 15:73722444-73722466 AGGGCCTCCACTGGGGGGCCAGG + Intergenic
1129693150 15:77724989-77725011 GTGACCAGCACTGGGAGGCCTGG - Intronic
1132691722 16:1184580-1184602 CTGCCTTCCACCAGGGGGCCTGG - Intronic
1140406348 16:74713979-74714001 GTCACATCCACTTGGTGGCCAGG - Exonic
1142185855 16:88694437-88694459 GTGGCCTCCATGAGGGGACCTGG + Intergenic
1143954576 17:10658377-10658399 GTGGCCTCCACTTCGGGGCTTGG - Intergenic
1145027362 17:19478289-19478311 GTGCCCTGCACTGGGGGTCCTGG + Intergenic
1145288213 17:21522233-21522255 GAGACCCCCACCAGGGGCCCTGG - Intergenic
1145389427 17:22444210-22444232 GAGACCCCCACCAGGGGCCCTGG + Intergenic
1148128044 17:45246929-45246951 GTGACCTGCAGTGGGGGGCCCGG - Exonic
1148287976 17:46413101-46413123 GTGACTTCCAGTTGGGGGCGTGG + Intergenic
1161253768 19:3295159-3295181 GTGGCCTCCAGTAGAGGGGCAGG - Intronic
1162379099 19:10321392-10321414 GTGCCCTCCACTCAGGGCCCAGG - Intronic
1167724221 19:51199860-51199882 GGGACCTCTTCTTGGGGGCCTGG + Intergenic
926133423 2:10319710-10319732 GGGAGCTCCACCAAGGGGCCAGG - Intronic
933375452 2:81474426-81474448 GTTACCACCACTAGGCTGCCTGG - Intergenic
1173880332 20:46406776-46406798 GAGGCCTCCACTAGGGGGGCGGG - Intronic
1173971207 20:47153754-47153776 GTGCCATCCACTAAGAGGCCTGG + Intronic
1174888914 20:54368425-54368447 GTGGCCTCAAATAGGGGGCCAGG - Intergenic
1175731664 20:61358371-61358393 CTGACCTCCACGAGGGGCTCAGG + Intronic
1175760103 20:61556709-61556731 GGGACCTCCACTGGGGGCACTGG - Intronic
1175826393 20:61938657-61938679 ATGAGCTCCACCAGGGGCCCCGG + Exonic
1176021695 20:62965449-62965471 CAGACCTCCTCTAGGGGGCCTGG + Intronic
1182487352 22:30647432-30647454 GTGACCTCTACTGGGGGCCATGG + Exonic
1182774285 22:32819373-32819395 TTGGCCTCCAATATGGGGCCGGG - Intronic
1183590410 22:38776405-38776427 GTGACTCTCACTAGGGGGCTGGG - Intronic
1183680567 22:39326480-39326502 GGGTCCTCCTCAAGGGGGCCAGG + Intergenic
1184624376 22:45712168-45712190 GTGACCTCCCCTGGGGGCACAGG + Intronic
1185287602 22:50009515-50009537 GTGGCCGCCCCCAGGGGGCCTGG - Intronic
1185296786 22:50058540-50058562 GTGACCTCCACAGGGGGGCGCGG - Intergenic
950188176 3:10958284-10958306 GTGTCCTCCACTCAGGGTCCTGG - Intergenic
952338288 3:32423820-32423842 GTGACCTGCACCTGGGGGGCTGG - Intronic
952788059 3:37175939-37175961 CCGACCTCGGCTAGGGGGCCGGG - Intronic
954701376 3:52452622-52452644 GAGACCTCCACTCTGTGGCCTGG - Intronic
957855375 3:85869802-85869824 GTGCCCGCCACCACGGGGCCTGG + Intronic
961946523 3:130695815-130695837 GGGACATCCACTAGGGGTCTTGG + Intronic
967105948 3:186255156-186255178 GTAACCTCCCCGAGGGGGACTGG + Intronic
969531421 4:7733074-7733096 GTGTCCTCCACTAGGGGGGAGGG - Intronic
973822695 4:54676882-54676904 GTGAAGTGCACTAGGAGGCCAGG - Intronic
974317542 4:60301760-60301782 CAGACATCCACTAGGGGTCCTGG - Intergenic
981537305 4:145813487-145813509 CAGGCCTCCACTAGGGGTCCGGG + Intronic
982925658 4:161334468-161334490 ATGACTTCAACCAGGGGGCCAGG + Intergenic
983794240 4:171840328-171840350 GAGACCTCAACTATGGGCCCAGG - Intronic
984668632 4:182455971-182455993 GTCTCCCCCACTAGGGGGACAGG + Intronic
988964298 5:36401119-36401141 GTGGCCTCCACTATGTGGCAGGG - Intergenic
989258395 5:39391491-39391513 GTGGGGTCCACTAGGGTGCCAGG + Intronic
996421810 5:123270803-123270825 CTGACCTCAACTGGGAGGCCAGG + Intergenic
997691568 5:135830981-135831003 GTGACCTCCTGTGAGGGGCCTGG + Intergenic
998870227 5:146544425-146544447 GTGACTGTCACTAGGAGGCCAGG - Intergenic
1001647250 5:173291142-173291164 GTCACCTCCAGTCGGGGGCATGG - Intergenic
1003183271 6:3810043-3810065 GTAACCTTGACTAGGTGGCCTGG - Intergenic
1004537186 6:16514506-16514528 TTTATCTCCACTAGAGGGCCAGG + Intronic
1019055765 6:169222246-169222268 GTGAACTCCACCACGGGGACGGG - Exonic
1021957472 7:25840363-25840385 GTGACCTGGACAAGGTGGCCTGG - Intergenic
1023418161 7:39950888-39950910 TTGACCTCCAGAGGGGGGCCCGG - Exonic
1023713533 7:43020067-43020089 GTGACCTCCTCTAGGCCCCCAGG + Intergenic
1028620454 7:92821185-92821207 CTGACCTACACCAGGTGGCCTGG - Intronic
1029312266 7:99678272-99678294 GTGACCTCCACGGTGGGGCCAGG + Intronic
1029314416 7:99698361-99698383 GTGACCTCCACTGTGGGGCCAGG + Intronic
1029318200 7:99733678-99733700 GTGACCTCCACTAGGGGGCCAGG + Intronic
1029320055 7:99750857-99750879 GTGACCTCCACTGTGGGGCCAGG + Intergenic
1029323108 7:99782614-99782636 GTGACCTCCACTACGGGGCCAGG + Intronic
1029653090 7:101906909-101906931 CTGACCTCCAAAAGGGGTCCGGG - Intronic
1031013648 7:116549272-116549294 GTGTCCACCACTTTGGGGCCAGG + Intronic
1033497107 7:141910124-141910146 GTGACCTCCACCCTGGGTCCAGG - Intronic
1036548908 8:9799723-9799745 GTGAGCCCCACAAGGAGGCCAGG + Intergenic
1049105798 8:140611749-140611771 GTGACCTCGAGTAGGGTGCCGGG + Intronic
1049242009 8:141542793-141542815 GAGACCTCCAGCAAGGGGCCAGG - Intergenic
1053614892 9:39754657-39754679 GTGCCCTCCAGTGTGGGGCCAGG - Intergenic
1053873070 9:42513930-42513952 GTGCCCTCCAGTGTGGGGCCAGG - Intergenic
1054238625 9:62587733-62587755 GTGCCCTCCAGTGTGGGGCCAGG + Intergenic
1054261963 9:62875603-62875625 GTGCCCTCCAGTGTGGGGCCAGG - Intergenic
1054269260 9:62952822-62952844 GTGCCCTCCAGTGTGGGGCCAGG + Intergenic
1054552756 9:66622255-66622277 GTGCCCTCCAGTGTGGGGCCAGG + Intergenic
1056024777 9:82482498-82482520 GTCACCTGCACTAGGTGGCTGGG - Intergenic