ID: 1029319035

View in Genome Browser
Species Human (GRCh38)
Location 7:99741149-99741171
Sequence CCCTGGATAAGTACTGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029319035_1029319043 19 Left 1029319035 7:99741149-99741171 CCCTGGGCAGTACTTATCCAGGG No data
Right 1029319043 7:99741191-99741213 AGACAGCATCTCAAAAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029319035 Original CRISPR CCCTGGATAAGTACTGCCCA GGG (reversed) Intergenic
No off target data available for this crispr