ID: 1029320704

View in Genome Browser
Species Human (GRCh38)
Location 7:99756877-99756899
Sequence TAGTCCTAAAGCCATTAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029320704_1029320712 24 Left 1029320704 7:99756877-99756899 CCCACCTAATGGCTTTAGGACTA No data
Right 1029320712 7:99756924-99756946 GGAAGAATTTGGAAAAGAAAAGG No data
1029320704_1029320709 -7 Left 1029320704 7:99756877-99756899 CCCACCTAATGGCTTTAGGACTA No data
Right 1029320709 7:99756893-99756915 AGGACTAAATTATTCAGGAAGGG No data
1029320704_1029320711 13 Left 1029320704 7:99756877-99756899 CCCACCTAATGGCTTTAGGACTA No data
Right 1029320711 7:99756913-99756935 GGGAAAATAAAGGAAGAATTTGG No data
1029320704_1029320708 -8 Left 1029320704 7:99756877-99756899 CCCACCTAATGGCTTTAGGACTA No data
Right 1029320708 7:99756892-99756914 TAGGACTAAATTATTCAGGAAGG No data
1029320704_1029320710 3 Left 1029320704 7:99756877-99756899 CCCACCTAATGGCTTTAGGACTA No data
Right 1029320710 7:99756903-99756925 TATTCAGGAAGGGAAAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029320704 Original CRISPR TAGTCCTAAAGCCATTAGGT GGG (reversed) Intergenic
No off target data available for this crispr