ID: 1029321357

View in Genome Browser
Species Human (GRCh38)
Location 7:99763455-99763477
Sequence CTGTATCCACATATGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029321357_1029321362 4 Left 1029321357 7:99763455-99763477 CCTGTGTCCATATGTGGATACAG 0: 1
1: 0
2: 0
3: 13
4: 173
Right 1029321362 7:99763482-99763504 GGGGACATCACACACCACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029321357 Original CRISPR CTGTATCCACATATGGACAC AGG (reversed) Intronic
900485659 1:2921440-2921462 CTGGATGGACAGATGGACACAGG - Intergenic
900485683 1:2921566-2921588 CTGGATGGACAGATGGACACAGG - Intergenic
900485691 1:2921608-2921630 CTGGATGGACAGATGGACACAGG - Intergenic
900485699 1:2921650-2921672 CTGGATGGACAGATGGACACAGG - Intergenic
901266008 1:7911202-7911224 CTGTTTCCAAATATAGACCCTGG - Intergenic
905485734 1:38294892-38294914 CTGTATCCTCATATGGAGGAAGG + Intergenic
906689636 1:47784119-47784141 CTGTTTCCTCATCTGGAAACTGG - Intronic
909167959 1:72252749-72252771 CTGTACCCCCAAATGGACATGGG - Intronic
911545015 1:99206135-99206157 CTGCATCCACATATGGAGGAAGG + Intergenic
914250136 1:145915225-145915247 CTGTATCCCTGTATGTACACTGG + Intronic
914927766 1:151903786-151903808 CTGTATCCATAAAAGGACAGTGG - Intronic
916329815 1:163602558-163602580 CTGTAGCCACCTGTGGATACTGG + Intergenic
916697863 1:167258565-167258587 CTGTATACACATGTGTACACAGG + Intronic
917670744 1:177270995-177271017 CTCCCTCCACATGTGGACACAGG - Intronic
920502276 1:206492928-206492950 TCGGATCCACACATGGACACAGG - Exonic
1063135924 10:3216145-3216167 ATGTATACACACATGCACACAGG + Intergenic
1063956240 10:11270258-11270280 CTCTGTCCACCTGTGGACACGGG + Intronic
1066416295 10:35224393-35224415 CTGTATCCAGCAATGGACCCAGG + Intergenic
1067332751 10:45337230-45337252 ATGTTTCCACATATGGTCAAAGG - Intergenic
1068904077 10:62303074-62303096 ATTAATGCACATATGGACACAGG - Intergenic
1069866028 10:71503373-71503395 CTGTGTGCACAAATGGACAGGGG - Intronic
1070502032 10:77081227-77081249 CTGTTTCCTCATCTGGACACTGG + Intronic
1070725908 10:78790349-78790371 CTATATGAACACATGGACACAGG + Intergenic
1072920581 10:99573652-99573674 CTGTATCCACATCCTGACTCTGG + Intergenic
1073573677 10:104602479-104602501 CAGTATCCATATCTGGAAACTGG - Intergenic
1074754508 10:116614500-116614522 CTGTATCCTCATATGGTAAAAGG - Intergenic
1075771643 10:124942960-124942982 CTGTTTGCACATATGAAAACTGG + Exonic
1078581028 11:12539722-12539744 GTCTATTCACATATGGGCACAGG - Intergenic
1080579709 11:33632233-33632255 CTGTATCCACAGGTGGACTCTGG + Intronic
1082094114 11:48113233-48113255 ATGTATATACATATGCACACAGG - Intronic
1088378079 11:109163316-109163338 CAGTAAGAACATATGGACACAGG - Intergenic
1090242410 11:125193475-125193497 TTGTATGCACACATGCACACTGG - Intronic
1091109885 11:132956104-132956126 ATTTGTCCACATTTGGACACTGG + Intronic
1091747961 12:3004508-3004530 CAGTAGCCACAGATGGGCACTGG + Intronic
1092807507 12:12238459-12238481 ATATATCCACATCTAGACACAGG + Intronic
1099351131 12:81569997-81570019 CTGTTTCCAAATCTAGACACAGG + Intronic
1099735153 12:86557784-86557806 TGGTATCAACATAAGGACACAGG + Intronic
1106486305 13:30175765-30175787 CTATATCCAAAAAAGGACACAGG + Intergenic
1107883800 13:44857074-44857096 CTGTAGCCACATGTGGCCAGGGG + Intergenic
1108209258 13:48121855-48121877 CTGAGTCCACATTTGGAAACTGG + Intergenic
1108729668 13:53221292-53221314 GTGTAACCACATTTGGAAACAGG - Intergenic
1110136504 13:72073777-72073799 CTGTATCCTCACATGGAAGCGGG - Intergenic
1114690070 14:24573332-24573354 CTGTGTCCACATATGGCAAAAGG - Intergenic
1115059405 14:29171526-29171548 CTTTTTCCACATATGGTCAAAGG - Intergenic
1121656070 14:95596616-95596638 CTGTATCCACATATCTCTACTGG + Intergenic
1121672945 14:95726900-95726922 CAATAGCCACATATGGACAATGG - Intergenic
1123475545 15:20590244-20590266 CTGTATACACATACAGACATGGG - Intergenic
1123642466 15:22410119-22410141 CTGTATACACATACAGACATGGG + Intergenic
1124024390 15:25951343-25951365 TTTCATCCACTTATGGACACTGG + Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1125788937 15:42348176-42348198 CTGAATCCTCCTATGGACTCCGG + Exonic
1126375644 15:47994233-47994255 GTGTATCCACATAGGGAAGCTGG - Intergenic
1127066511 15:55245217-55245239 CTGTCTCCACTTATGGAAATGGG - Intronic
1128075891 15:64825308-64825330 CTGTTTCCACGTCTGTACACGGG - Intronic
1128458521 15:67847941-67847963 CTGTATCCACATGTGGAGGTAGG + Intergenic
1131423916 15:92329916-92329938 CTGTATCCTCATATGGCAAAAGG - Intergenic
1131864006 15:96687522-96687544 CTGTTTCCTCATATGTACAATGG - Intergenic
1132106982 15:99070084-99070106 CTGTAGCCACACATGAACATGGG - Intergenic
1132388423 15:101419772-101419794 CTAGATCCCCATATGGACACTGG - Intronic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1133527066 16:6615995-6616017 CTGAATCCATATATAGACGCAGG + Intronic
1136346847 16:29681238-29681260 CCGTTTCCACATCTGGACAATGG + Intronic
1140016063 16:71186781-71186803 CTGTAACCACCTTTGGACTCAGG + Exonic
1140923727 16:79563264-79563286 CTGTAACCACACATGGGCAGCGG - Intergenic
1141007403 16:80365161-80365183 CTGTTTCCACATCTGGAAAATGG - Intergenic
1142680709 17:1546608-1546630 CTGTACCCACACATGGAGGCTGG + Intronic
1148029003 17:44607289-44607311 CTTTATCCACAGATGGGCATTGG - Intergenic
1155287861 18:24309723-24309745 CTGTCTCAACATCTGGAGACTGG - Intronic
1155749273 18:29399554-29399576 CTGTATCCACCTTTAAACACGGG - Intergenic
1156372553 18:36484710-36484732 CTGTGTCTACATATGGCCTCAGG - Intronic
1156570703 18:38249565-38249587 CTATATACACATATAGACATAGG - Intergenic
1158439633 18:57463236-57463258 ATCCATACACATATGGACACTGG - Intronic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160102803 18:75938851-75938873 CTGTATCCACCTTTAAACACAGG - Intergenic
1161965140 19:7543573-7543595 CAGTTTCCCCATATGGACAGTGG - Intronic
1164073319 19:21789351-21789373 ATGTATCCCCATATGAACAAAGG + Intergenic
1166724057 19:45014879-45014901 CTGAATCCAGATTTGGAGACAGG - Intronic
1167412354 19:49352230-49352252 CAGTAGCCACATGTGGGCACTGG - Intronic
925350785 2:3199687-3199709 CTGTGTCCACATCTGGGCAGAGG + Intronic
925895150 2:8465645-8465667 CTCTCTTCACATATGCACACGGG + Intergenic
927002243 2:18809815-18809837 GTTTATCCACAAATGAACACGGG + Intergenic
928723934 2:34149477-34149499 CTGTATCCAGAAATTGCCACCGG - Intergenic
929966226 2:46539233-46539255 CTGTATCCAGTTATGGTCCCGGG - Intronic
931569368 2:63652120-63652142 ATGGTTCCACACATGGACACTGG + Intronic
936386975 2:112039582-112039604 CTGTATCCACCTTTAAACACAGG - Intergenic
939044995 2:137239478-137239500 TTGTATCCACATAAAGATACAGG - Intronic
943630972 2:190251964-190251986 CTGTTTCCTCATATGCAAACTGG - Intronic
945222367 2:207497906-207497928 CTTTATCCACTTAAGGACTCAGG + Intergenic
945504318 2:210619881-210619903 CTATACCCACGCATGGACACAGG + Intronic
946815115 2:223569128-223569150 CTGTATTCACATGTGGAGCCTGG - Intergenic
948580481 2:238984398-238984420 CTGACTACACAGATGGACACTGG - Intergenic
1169386010 20:5150250-5150272 CTGTTTCTAGAAATGGACACAGG - Intronic
1171477807 20:25426893-25426915 ATTTATCCATCTATGGACACTGG + Intronic
1173014066 20:39209078-39209100 CTGTGTCCAGCTTTGGACACAGG - Intergenic
1173113234 20:40215867-40215889 CTGTATCAACCAATGGAGACTGG + Intergenic
1173326238 20:42036202-42036224 CTGTATGCACCAATGGCCACAGG - Intergenic
1174968694 20:55249186-55249208 CTATAAGCACACATGGACACAGG + Intergenic
1175565719 20:59975161-59975183 CTATATCCAAATAAGGTCACAGG - Intronic
1178902236 21:36606813-36606835 CTGCATCCACAGGGGGACACCGG - Intergenic
1179788995 21:43744836-43744858 CTGTTTCCACATTTGGTCACTGG - Intronic
1182600387 22:31458696-31458718 CTGAAGCCACAGAGGGACACTGG - Intronic
1183705582 22:39473340-39473362 AAGTATCCACACATGGAGACGGG + Intronic
1184415201 22:44348109-44348131 CTGCCTCCTCATATGGAAACGGG - Intergenic
949800564 3:7899001-7899023 TGATATCAACATATGGACACAGG + Intergenic
952885192 3:38007709-38007731 CTGTCCCCACATGTGGACAGAGG + Exonic
953550757 3:43900774-43900796 CTGTAGCCTCATATGGCAACAGG - Intergenic
953901543 3:46846566-46846588 CTGCATCCACTCAGGGACACAGG - Intergenic
955155248 3:56410526-56410548 CTGTTTCCACATCTGTAAACTGG - Intronic
959005799 3:101018412-101018434 CTGTGTCCAGATTTGGACTCTGG + Intergenic
959759631 3:109944983-109945005 CTGTCTCCACATAAGAACATGGG - Intergenic
959781755 3:110242244-110242266 CTATAGCCCCATATGGAGACTGG - Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
961042163 3:123685195-123685217 CTGTTTCCACATCTGTACAAGGG + Intronic
962621328 3:137182583-137182605 TTGTATCCAGCTATGGCCACAGG - Intergenic
969837104 4:9850884-9850906 ATGAATGCACAAATGGACACTGG + Intronic
974143049 4:57912464-57912486 GTGTGTGCACATATGCACACAGG + Intergenic
974336024 4:60545444-60545466 CTGTGTCCAAATATGTGCACTGG + Intergenic
974353399 4:60779689-60779711 CTTTATCCAGATTTGGACAGAGG + Intergenic
976752145 4:88460212-88460234 CTGGCTCCACATATACACACAGG - Intronic
978165600 4:105603009-105603031 CTGTCTCCAGATAAGGACTCTGG + Intronic
978771770 4:112464730-112464752 CAGTAGCCACACATGGAAACAGG + Intergenic
978914457 4:114106761-114106783 TAGTACCCACATATGGAAACAGG - Intergenic
983506345 4:168557631-168557653 GTGTTTCCACATTGGGACACAGG - Intronic
986006175 5:3670979-3671001 CTGTATCCACATATGGGGAGGGG - Intergenic
986970730 5:13332929-13332951 CAGTAGCCACATATGGCCAGTGG - Intergenic
988320964 5:29696440-29696462 CAGTATACAGATATGTACACAGG + Intergenic
989539019 5:42597438-42597460 CTGGATCCACCTATGGGCACTGG - Intronic
990033225 5:51287539-51287561 CAGTATCCACTTTGGGACACTGG - Intergenic
990492292 5:56314409-56314431 CTGAATCCATATATGGAAAGAGG + Intergenic
990914819 5:60892684-60892706 CTGCATCCACATCTAGAGACTGG - Intronic
995401336 5:111745292-111745314 CTGTAGCAACACATGAACACTGG - Intronic
995629451 5:114117572-114117594 CTGCATGCAGATATGGACCCAGG + Intergenic
997295649 5:132766738-132766760 CTGTATCCACATCTGCACAAGGG - Intronic
997720859 5:136077512-136077534 CTGTATCCCAATATGGCCCCAGG + Intergenic
1000841201 5:166220658-166220680 CTGTATCCTCATATGGCCAAAGG + Intergenic
1003191301 6:3877741-3877763 CTTCCTCCACATAAGGACACAGG - Intergenic
1003865240 6:10357139-10357161 CTGTAACCACTTAGGAACACAGG + Intergenic
1005214041 6:23504142-23504164 CTCTATCTACATATATACACAGG - Intergenic
1006120198 6:31799739-31799761 CTTTATCCACATATGGGCTCTGG - Intronic
1006827654 6:36948037-36948059 CTGTTTCCACATCTGTACACTGG - Intergenic
1008817202 6:55582201-55582223 CTGTATCCACATGTGTAAAAGGG + Intergenic
1009294314 6:61925936-61925958 CATTATAGACATATGGACACTGG - Intronic
1009958348 6:70485535-70485557 CTGTATCCACTTATTAAAACTGG - Intronic
1011116959 6:83904973-83904995 CAATATCAACATAAGGACACAGG - Intronic
1013342239 6:109226113-109226135 CTGTTTCCACATTTGTACAATGG - Intergenic
1013389670 6:109671000-109671022 CCATATCCACATATGTAGACAGG - Intronic
1014445535 6:121523028-121523050 TCGTATCCACATATGGACTGAGG - Intergenic
1015404704 6:132823904-132823926 CTGTAACCACCAGTGGACACTGG + Intergenic
1017087672 6:150729381-150729403 CAGTAGCCACATGTGGCCACTGG + Intronic
1017829317 6:158111330-158111352 CTGAATTCACATATGAAAACTGG + Exonic
1020381305 7:7549908-7549930 CTATATCCACATATATCCACAGG - Intergenic
1020900615 7:13998697-13998719 CTGTTTCCACATGTGGATAATGG + Intergenic
1023685213 7:42726805-42726827 CTGTGTACAGATGTGGACACTGG - Intergenic
1023867764 7:44246595-44246617 ATGTATACACACATGCACACAGG + Intronic
1029321357 7:99763455-99763477 CTGTATCCACATATGGACACAGG - Intronic
1031322239 7:120345738-120345760 ATTTATCCATAGATGGACACAGG + Intronic
1032001391 7:128267730-128267752 GTGTATGCACAAATGCACACTGG + Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1039730086 8:40265558-40265580 CAGTATGCACATATGGAGGCTGG + Intergenic
1042058776 8:64794553-64794575 CTGTGTCCTCACATGGACAAAGG + Intronic
1042466168 8:69132196-69132218 CAATAACAACATATGGACACAGG + Intergenic
1043251121 8:78074468-78074490 CTGTATTCACATATAAACAGAGG - Intergenic
1044279526 8:90339571-90339593 CTGTATTCTTATAAGGACACTGG + Intergenic
1048813425 8:138309149-138309171 CAATGTACACATATGGACACTGG + Intronic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1051970217 9:22878385-22878407 CTGCATCCACATTTAAACACAGG - Intergenic
1053211925 9:36236831-36236853 CTGTTTCCAAATATTGACGCAGG - Exonic
1053255148 9:36610707-36610729 CTGCATCCACATCAGGATACAGG + Intronic
1054841056 9:69740388-69740410 GTGTATACACATATGTATACAGG + Intronic
1056246630 9:84701850-84701872 GTGTTTTCACATATGTACACTGG + Intronic
1056274218 9:84976934-84976956 CTATATCTACATATACACACAGG - Intronic
1056825638 9:89874624-89874646 CTGTCCACACATAGGGACACAGG + Intergenic
1059880615 9:118684936-118684958 CTTCATCCATCTATGGACACTGG + Intergenic
1060513601 9:124251716-124251738 CTGTATCCTCATCTGTACAATGG + Intergenic
1061165326 9:128919061-128919083 CTGTATCCCCATGTGGACAATGG + Intergenic
1062154992 9:135042740-135042762 CTGTTTCCAAATAGGGTCACAGG + Intergenic
1062571295 9:137186592-137186614 CTCTATCCAGGTAGGGACACTGG + Intronic
1186143320 X:6600319-6600341 CTGTATCCTCACATGGCCAAGGG + Intergenic
1186682030 X:11885126-11885148 ATTTATCCACTGATGGACACTGG - Intergenic
1188554141 X:31392615-31392637 GTGTATGCACACATGCACACTGG + Intronic
1191726032 X:64282308-64282330 TTGGAACCACATGTGGACACAGG + Intronic
1193104811 X:77658648-77658670 CTGTTTTCACATATGTACAATGG - Intronic
1193951456 X:87805482-87805504 CTATATTCACAAATGGGCACAGG - Intergenic
1196017159 X:110952174-110952196 CAGTATCCAGATATGGTCAAGGG + Intronic
1197170666 X:123430332-123430354 CTGTTTCCCCAAATGGTCACTGG + Intronic
1197254808 X:124251514-124251536 TTGTATGCATATATGGACAAAGG + Intronic
1198596647 X:138243334-138243356 GTGTAACCTCGTATGGACACAGG + Intergenic