ID: 1029323108

View in Genome Browser
Species Human (GRCh38)
Location 7:99782614-99782636
Sequence GTGACCTCCACTACGGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 1, 2: 2, 3: 6, 4: 71}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029323102_1029323108 29 Left 1029323102 7:99782562-99782584 CCTCTGTGTCCAGGCTTCAAGCA 0: 1
1: 3
2: 68
3: 1876
4: 23850
Right 1029323108 7:99782614-99782636 GTGACCTCCACTACGGGGCCAGG 0: 1
1: 1
2: 2
3: 6
4: 71
1029323103_1029323108 20 Left 1029323103 7:99782571-99782593 CCAGGCTTCAAGCAGATGAGATG 0: 2
1: 3
2: 0
3: 20
4: 178
Right 1029323108 7:99782614-99782636 GTGACCTCCACTACGGGGCCAGG 0: 1
1: 1
2: 2
3: 6
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029323108 Original CRISPR GTGACCTCCACTACGGGGCC AGG Intronic
900226236 1:1534828-1534850 GTGCCCGCCACTGCGGGGCCAGG + Intergenic
901713089 1:11131051-11131073 GTGAGCTCCCCTAGGAGGCCGGG - Intronic
901795497 1:11677154-11677176 GGGACCTTCCCTATGGGGCCCGG - Intronic
903787378 1:25870312-25870334 GTGACCTCTACTATGGGACTGGG + Intronic
920039333 1:203085509-203085531 GTGACCTCCGCTACCGGGGCGGG - Exonic
924775270 1:247111653-247111675 GCGACCCCCACCACGGGCCCCGG - Exonic
1069834987 10:71302616-71302638 GTCACCTCCCCTAAGGGACCCGG - Exonic
1074565947 10:114578039-114578061 GTGACCTGCATTTAGGGGCCTGG - Intronic
1076533827 10:131163131-131163153 GTGGCCTCCACCCCGGTGCCCGG - Exonic
1077162903 11:1121729-1121751 GTGTCCTCCACTCCCAGGCCAGG + Intergenic
1079012480 11:16840713-16840735 GTGACCTCCATCAAGAGGCCAGG - Intronic
1104600605 12:130150837-130150859 GTGACCTGCACCAAGGTGCCTGG - Intergenic
1104901424 12:132191288-132191310 GTGAGCTCCAGCACGGGGACTGG + Intergenic
1104901431 12:132191321-132191343 GTGAGCTCCAGCACGGGGACTGG + Intergenic
1124196812 15:27638962-27638984 GTGACCTGCACTACCCAGCCCGG + Intergenic
1125431028 15:39593597-39593619 GTAAACTCCACCACAGGGCCTGG + Exonic
1133249962 16:4474418-4474440 GTGACCTCCTCGCCGCGGCCTGG + Exonic
1136605627 16:31331487-31331509 GTGACATCCGCGTCGGGGCCTGG - Intronic
1141464386 16:84196497-84196519 GTGGCCACCACTACGGAGCTAGG - Intronic
1142190114 16:88713565-88713587 GTGACCTCCCCTACCTGGCAGGG + Intronic
1143954576 17:10658377-10658399 GTGGCCTCCACTTCGGGGCTTGG - Intergenic
1147936491 17:44014363-44014385 GCTACGTCCACTACGGGGACTGG - Exonic
1148128044 17:45246929-45246951 GTGACCTGCAGTGGGGGGCCCGG - Exonic
1151398547 17:73841022-73841044 GTGACCTCCACATCAGAGCCAGG + Intergenic
1152087234 17:78227733-78227755 GCCACCTCCACTACAGGGCTGGG - Intergenic
1152298094 17:79480043-79480065 GTGCCATCCACTACGGCTCCTGG - Intronic
1162379099 19:10321392-10321414 GTGCCCTCCACTCAGGGCCCAGG - Intronic
926133423 2:10319710-10319732 GGGAGCTCCACCAAGGGGCCAGG - Intronic
933271671 2:80239483-80239505 TAGACCTCCACTGCGGGGCTTGG - Intronic
941740366 2:169029036-169029058 GTGCTCTCCACTCCCGGGCCTGG - Intronic
1173880332 20:46406776-46406798 GAGGCCTCCACTAGGGGGGCGGG - Intronic
1173971207 20:47153754-47153776 GTGCCATCCACTAAGAGGCCTGG + Intronic
1174888914 20:54368425-54368447 GTGGCCTCAAATAGGGGGCCAGG - Intergenic
1175291039 20:57875445-57875467 GTGACCTGCAATACGAGGGCTGG + Intergenic
1175654813 20:60760832-60760854 GTGAGCCTGACTACGGGGCCAGG - Intergenic
1176021695 20:62965449-62965471 CAGACCTCCTCTAGGGGGCCTGG + Intronic
1178314788 21:31558942-31558964 GGGATCTCCGCGACGGGGCCGGG + Exonic
1179919314 21:44499086-44499108 GGGACCTCAACTTCTGGGCCCGG - Exonic
1182774285 22:32819373-32819395 TTGGCCTCCAATATGGGGCCGGG - Intronic
1183190225 22:36317695-36317717 GGGACCTCCACTCCAGGGGCAGG + Intronic
1183545600 22:38453618-38453640 GTGACCTCCAAGGCGGGCCCTGG - Intronic
1184775275 22:46619996-46620018 CTGACCTCCACATCAGGGCCCGG - Intronic
1185278107 22:49958508-49958530 CTGCCCTCCACTCCAGGGCCAGG + Intergenic
1185296786 22:50058540-50058562 GTGACCTCCACAGGGGGGCGCGG - Intergenic
950188176 3:10958284-10958306 GTGTCCTCCACTCAGGGTCCTGG - Intergenic
952882634 3:37994298-37994320 GCGACCTGCACTACTGGGTCGGG + Exonic
954701376 3:52452622-52452644 GAGACCTCCACTCTGTGGCCTGG - Intronic
957855375 3:85869802-85869824 GTGCCCGCCACCACGGGGCCTGG + Intronic
963275030 3:143321277-143321299 ATGACCTCCACTGCGGAGCAAGG + Intronic
969531421 4:7733074-7733096 GTGTCCTCCACTAGGGGGGAGGG - Intronic
983794240 4:171840328-171840350 GAGACCTCAACTATGGGCCCAGG - Intronic
988964298 5:36401119-36401141 GTGGCCTCCACTATGTGGCAGGG - Intergenic
997691568 5:135830981-135831003 GTGACCTCCTGTGAGGGGCCTGG + Intergenic
1002440111 5:179259837-179259859 GTGTCCTCAACCTCGGGGCCTGG + Intronic
1005898731 6:30199073-30199095 GTCAGCCCCACTACGGAGCCTGG - Exonic
1019055765 6:169222246-169222268 GTGAACTCCACCACGGGGACGGG - Exonic
1019061336 6:169260154-169260176 ATGACCTCCACTCCAGGGCAGGG - Intergenic
1019338722 7:497476-497498 GTGACCGCCACCACGGCACCAGG + Intronic
1023565522 7:41520704-41520726 GTGACCTCCCCTACGGGATGGGG + Intergenic
1029312266 7:99678272-99678294 GTGACCTCCACGGTGGGGCCAGG + Intronic
1029314416 7:99698361-99698383 GTGACCTCCACTGTGGGGCCAGG + Intronic
1029318200 7:99733678-99733700 GTGACCTCCACTAGGGGGCCAGG + Intronic
1029320055 7:99750857-99750879 GTGACCTCCACTGTGGGGCCAGG + Intergenic
1029323108 7:99782614-99782636 GTGACCTCCACTACGGGGCCAGG + Intronic
1031013648 7:116549272-116549294 GTGTCCACCACTTTGGGGCCAGG + Intronic
1033497107 7:141910124-141910146 GTGACCTCCACCCTGGGTCCAGG - Intronic
1033867679 7:145713031-145713053 GTGACCACCACCACTGGGACTGG + Intergenic
1034442325 7:151092226-151092248 GTTCCCTCCACTTCTGGGCCAGG - Intronic
1049105798 8:140611749-140611771 GTGACCTCGAGTAGGGTGCCGGG + Intronic
1049242009 8:141542793-141542815 GAGACCTCCAGCAAGGGGCCAGG - Intergenic
1053614892 9:39754657-39754679 GTGCCCTCCAGTGTGGGGCCAGG - Intergenic
1053873070 9:42513930-42513952 GTGCCCTCCAGTGTGGGGCCAGG - Intergenic
1053899682 9:42781990-42782012 GTGCCCTCCAGTGCGGGACCAGG + Intergenic
1054238625 9:62587733-62587755 GTGCCCTCCAGTGTGGGGCCAGG + Intergenic
1054261963 9:62875603-62875625 GTGCCCTCCAGTGTGGGGCCAGG - Intergenic
1054269260 9:62952822-62952844 GTGCCCTCCAGTGTGGGGCCAGG + Intergenic
1054552756 9:66622255-66622277 GTGCCCTCCAGTGTGGGGCCAGG + Intergenic
1057303825 9:93901358-93901380 GTGTCCTCCACTCCAGGCCCAGG + Intergenic
1060641305 9:125241380-125241402 GCGGCCTCCACGACGGGGCTGGG - Intergenic
1189340007 X:40197779-40197801 GTGAGCTGCGCTACTGGGCCTGG + Intergenic
1190063225 X:47223961-47223983 CTGTCCCCCACCACGGGGCCTGG - Intronic