ID: 1029328746

View in Genome Browser
Species Human (GRCh38)
Location 7:99833304-99833326
Sequence CCTTTTAAGCATTTCGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 2, 1: 8, 2: 1, 3: 13, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029328740_1029328746 28 Left 1029328740 7:99833253-99833275 CCAGTCGGATTAACATCCAGAGG 0: 1
1: 30
2: 56
3: 66
4: 73
Right 1029328746 7:99833304-99833326 CCTTTTAAGCATTTCGTGGGAGG 0: 2
1: 8
2: 1
3: 13
4: 106
1029328742_1029328746 12 Left 1029328742 7:99833269-99833291 CCAGAGGACTGAGCTCTGAACAA 0: 1
1: 2
2: 43
3: 63
4: 236
Right 1029328746 7:99833304-99833326 CCTTTTAAGCATTTCGTGGGAGG 0: 2
1: 8
2: 1
3: 13
4: 106
1029328739_1029328746 29 Left 1029328739 7:99833252-99833274 CCCAGTCGGATTAACATCCAGAG 0: 1
1: 32
2: 55
3: 72
4: 56
Right 1029328746 7:99833304-99833326 CCTTTTAAGCATTTCGTGGGAGG 0: 2
1: 8
2: 1
3: 13
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029328746 Original CRISPR CCTTTTAAGCATTTCGTGGG AGG Intronic
901623383 1:10607229-10607251 CCTTTTTACCATTGGGTGGGTGG + Intronic
903486986 1:23697055-23697077 CCTTTTGAGCACTACGTGGCTGG - Intergenic
903512675 1:23888090-23888112 CCCTTTAAGCATTTTGAGGTGGG - Intronic
906471548 1:46134779-46134801 ACTTTTCAGCATTTAGTGGTGGG + Intronic
915092268 1:153434874-153434896 CCTTTTAGGCATTTCCGGGCTGG - Intergenic
916419118 1:164619871-164619893 CCTTTTAAATATTTCTTTGGAGG + Intronic
917670315 1:177267730-177267752 CCTCTTAAGCAGTCTGTGGGTGG + Intronic
921076811 1:211706533-211706555 CCTTCTAAGAATTCCCTGGGAGG + Intergenic
923626717 1:235620061-235620083 CCTTTTAAAACTTTCGTTGGAGG + Intronic
924448461 1:244156123-244156145 CCTTTCAAACATCTGGTGGGGGG - Intergenic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1065484061 10:26219727-26219749 CCTATTAATCATTGAGTGGGAGG + Intronic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1069975959 10:72213568-72213590 CCTTTTAATCATTTTTGGGGGGG - Intronic
1071828663 10:89350613-89350635 CCTTTTAAGCATTTCTTGCAGGG + Intronic
1075823576 10:125334640-125334662 AGATTTAAGCATTTCATGGGAGG - Intergenic
1075828010 10:125377146-125377168 CCTTCTAAGCCCTTTGTGGGTGG + Intergenic
1078071281 11:8113199-8113221 TCTTTTAAGCATTCAGTGGCTGG - Intronic
1080307841 11:30855768-30855790 CCTTTTAAACATTTCATCTGCGG + Intronic
1086110332 11:83192341-83192363 CCTTTTAAGCAATTTGTGGCGGG - Intergenic
1087370309 11:97275443-97275465 TCCTTTAAGCATTTCGTGTAGGG - Intergenic
1092536442 12:9392516-9392538 CCTTTTAAGCATTTCATGGGTGG - Intergenic
1092629578 12:10363666-10363688 CCTTTTAAGCATTTCGTGGGTGG - Intergenic
1095369186 12:41446057-41446079 CCTTTTAAGCTTTTTGTTGAGGG - Intronic
1105831948 13:24170405-24170427 CCTTTTAAAATTTTTGTGGGTGG + Intronic
1106015472 13:25865026-25865048 CCTTTGAAGGATTGCTTGGGTGG + Intronic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1114143351 14:19942697-19942719 TCTTTTAAGCATTTCTTGTACGG - Intergenic
1114232834 14:20799711-20799733 CCTTTTAAGCATTTTGAGGCAGG - Intergenic
1115096842 14:29647870-29647892 CCTTTTAAGCAGTTTATGGTGGG + Intronic
1115097191 14:29650653-29650675 CCTTTTAAGCAGTTTTTGGCAGG + Intronic
1115887412 14:37988448-37988470 CCTTTTAAGAATTTTGAGGCTGG + Intronic
1119340361 14:73871904-73871926 GCTTTTAAGGAATACGTGGGAGG + Intronic
1127567416 15:60205408-60205430 GCTTTTTAGCATTTCTTAGGAGG + Intergenic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1133708491 16:8378626-8378648 CCTTTTAAGAATTTCTGGGCCGG + Intergenic
1135227483 16:20674456-20674478 CCTTTTAAGCATTTTGGGGGTGG - Intronic
1137346023 16:47660791-47660813 TTTTTGAAGAATTTCGTGGGTGG - Exonic
1138463654 16:57170382-57170404 CATTTTAAGAGTTACGTGGGAGG - Intronic
1140020436 16:71233257-71233279 CCTTTTTAGCATTTCCAGGTAGG - Intergenic
1149089947 17:52765600-52765622 TCTTTTTAGCATTTCTTGGAGGG - Intergenic
1150061502 17:62072726-62072748 CCTTTGAACCTTTTCTTGGGGGG - Intergenic
1150886599 17:69093568-69093590 ACTTTTAAGCATTTTGGGGCGGG - Intronic
1151414400 17:73952296-73952318 CCGATTCAGCATTTTGTGGGTGG - Intergenic
1153909574 18:9695224-9695246 CCTGTTAGGCATTTCATGAGTGG + Intergenic
1157419359 18:47532048-47532070 CATTTTGGACATTTCGTGGGGGG + Intergenic
1157557964 18:48625210-48625232 TCTGTTAAGCCTTTCATGGGTGG - Intronic
1160558521 18:79741296-79741318 CCTTTTATGCTTTTGGTGGCCGG + Intronic
1164003529 19:21129125-21129147 CCCTTTAAGCATTTTGAGGTGGG - Intergenic
1164081339 19:21864021-21864043 GCTTTTAGGCATTTTGTGGGTGG + Intergenic
1164142372 19:22484250-22484272 ACTTTTAAGCGTTTTGTGGTGGG + Intronic
1165985862 19:39768339-39768361 GTTTTTAAGCATGTTGTGGGTGG - Intergenic
1168587081 19:57602400-57602422 CAATGTAAGCATTTTGTGGGTGG + Intronic
926226958 2:10973583-10973605 CCTTTTAAGGAGTTTCTGGGAGG - Intergenic
926395722 2:12440480-12440502 CCTTTTAATCATTTTGTTGATGG - Intergenic
930034190 2:47075458-47075480 ACTTTTAAGCATTTCCTTGTTGG + Exonic
939186068 2:138862197-138862219 TCTTTTTAGCATGTCATGGGTGG + Intergenic
940869854 2:158850567-158850589 CCTTTTAGTCATTTCCTGGGTGG - Intronic
941588355 2:167387810-167387832 ACTTTTTAGCCTTTTGTGGGAGG - Intergenic
941826936 2:169909132-169909154 CCTTTTAAGGAATTTGTGGCTGG + Intronic
945338000 2:208615733-208615755 CCTTTTAACCATTTTGAGGTGGG + Intronic
1169096496 20:2903879-2903901 CCTTTTAAGGATTTGCTTGGTGG + Intronic
1169905581 20:10600096-10600118 CCTTTTTATCATTTTATGGGAGG - Intronic
1170204516 20:13784286-13784308 CCTTTTAATCATTTTGGGGGGGG - Intronic
1172157067 20:32834520-32834542 CCTTTTAAGCCATTTTTGGGGGG + Intronic
1173054342 20:39596883-39596905 GATTCTAGGCATTTCGTGGGAGG + Intergenic
1176299496 21:5091923-5091945 CCTTTCAAGCGTTTCCTGAGGGG + Intergenic
1176346111 21:5749296-5749318 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1176352925 21:5869880-5869902 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1176498716 21:7575159-7575181 CCTTTTAAGCATTTCATGGGTGG - Intergenic
1176540432 21:8147366-8147388 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1176559383 21:8330411-8330433 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1179857530 21:44170024-44170046 CCTTTCAAGCGTTTCCTGAGGGG - Intergenic
1180860905 22:19081918-19081940 CCTATAAAGCATTTCGTAGATGG - Intronic
1185117895 22:48948547-48948569 CCTTTTATGACTTTAGTGGGTGG + Intergenic
1203245375 22_KI270733v1_random:63793-63815 CCTTTTAAGCATTTCATGGGTGG + Intergenic
949192738 3:1269320-1269342 CCTTTTAAGGAATTCGTTAGTGG + Intronic
955799634 3:62672268-62672290 CCTTCTAAACATCTCCTGGGTGG + Intronic
960299855 3:115989293-115989315 CCTTTTAAGAATGTGGTGTGAGG - Intronic
962289492 3:134121708-134121730 CCCTTTAAGCATTTCCTGTAGGG + Intronic
966383853 3:179373204-179373226 CCTCTTCAGCATTTCGTTTGAGG - Intronic
966628109 3:182041478-182041500 ACTTTCAGGCATTTGGTGGGAGG + Intergenic
967328791 3:188269374-188269396 CCTTTTAAGTATTACCTGGCTGG + Intronic
971110321 4:23577865-23577887 CGTTTAGATCATTTCGTGGGAGG - Intergenic
973067371 4:45812805-45812827 CCTTTTAATCATATCCTGGTTGG - Intergenic
973119549 4:46503695-46503717 CTTTTTTAGCTTTTTGTGGGGGG - Intergenic
980864808 4:138542376-138542398 CCTTTTAAGCTCCTTGTGGGAGG + Intergenic
985809850 5:2074958-2074980 CTTTTTAAGCAATTCCTTGGAGG + Intergenic
995540558 5:113182157-113182179 CCTTAAAAGCATTTCATTGGTGG - Intronic
997807010 5:136927984-136928006 TCTTTTAAGTATTTGGGGGGAGG + Intergenic
998292947 5:140934202-140934224 TCTTTTAAACATTTTGTGTGAGG - Intronic
999171436 5:149598586-149598608 ACTTTTAAGCATTTCCTTGTTGG - Intronic
999857273 5:155608461-155608483 ATTTTTCAGCATTTTGTGGGGGG + Intergenic
1000717662 5:164666476-164666498 CCTCTTCAGCATTGCTTGGGAGG - Intergenic
1004719482 6:18254726-18254748 CTTTTTAAGGATTTAGTGTGAGG - Intronic
1005474944 6:26198768-26198790 CCTTTTAAGGAATACATGGGTGG + Intergenic
1007189252 6:39999152-39999174 CCTTTTAAGCATCTCAAGGGAGG + Intergenic
1009520979 6:64681782-64681804 CCTTTTAAGCTGTTTGTGGCGGG + Intronic
1011562335 6:88633223-88633245 CCTTTTATGTATTCAGTGGGGGG - Intronic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1016986318 6:149898313-149898335 CCTTTCTAGAATTTCGTGGCTGG - Intergenic
1017565423 6:155679777-155679799 CCTTTTAACCATGCCGTGAGAGG + Intergenic
1025781510 7:64605928-64605950 CCTTTTAAGTATTTTGAGGCGGG + Intergenic
1028089388 7:86679382-86679404 CCTTGTTAGCATTTCCTGTGGGG + Intronic
1028557075 7:92135840-92135862 CCTTTTAAGCAGTTTGTGTTGGG - Intronic
1029328746 7:99833304-99833326 CCTTTTAAGCATTTCGTGGGAGG + Intronic
1030076054 7:105737824-105737846 ACTTTTAAGAATTTTGTGGCTGG + Intronic
1032783303 7:135181848-135181870 TCTTTTAAGCATTTTGAGGCAGG - Intergenic
1032997301 7:137462246-137462268 CTTTTTTAGCCATTCGTGGGTGG + Intronic
1034870214 7:154676781-154676803 CCTTTTAAGCATTTTGAGGCAGG + Intronic
1035968417 8:4220771-4220793 CGTTATAAGGATTTCTTGGGTGG - Intronic
1036187512 8:6636879-6636901 CCTTTTACACATTTCCTGGATGG + Intronic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1041993176 8:64019428-64019450 CTTTTTAAACATTTTTTGGGAGG - Intergenic
1042018554 8:64344465-64344487 CCTTTTAAGCTTTTCATTGAAGG - Intergenic
1045424587 8:102052126-102052148 CTTTTAAAGCATTTCATGGTTGG + Intronic
1046284560 8:112078064-112078086 CCTTTTAAGCATTTCTTGCAGGG + Intergenic
1047076811 8:121413258-121413280 GCTGTTAAGCATGTTGTGGGTGG + Intergenic
1055002805 9:71472524-71472546 CTTTTTAAGCATTTTGAGGTGGG + Intergenic
1055439804 9:76326671-76326693 CCCTGTAAGCATTCCCTGGGTGG - Intronic
1203461712 Un_GL000220v1:46865-46887 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic
1190650959 X:52568302-52568324 CCTTTTAAGTAGTTTGTGGCGGG + Intergenic
1190652261 X:52578467-52578489 CCTTTTAAGTAGTTTGTGGCGGG + Intergenic
1197371423 X:125630286-125630308 CCTTTTTAGCATTTCTTGTAGGG - Intergenic
1201371611 Y:13270422-13270444 CCTAGTAAGCATGTTGTGGGTGG - Intronic
1201539149 Y:15087362-15087384 CCTTTTAAGCAGTTAATGGTGGG + Intergenic
1201944175 Y:19493967-19493989 CCTTTTAACAATTTTTTGGGGGG - Intergenic
1202051885 Y:20789915-20789937 CCTTTTAAGCATTTTGAGGCAGG + Intergenic