ID: 1029336472

View in Genome Browser
Species Human (GRCh38)
Location 7:99904182-99904204
Sequence ATCTATGTCTTTAAGTAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 385}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029336472_1029336474 13 Left 1029336472 7:99904182-99904204 CCATTTTACTTAAAGACATAGAT 0: 1
1: 0
2: 4
3: 39
4: 385
Right 1029336474 7:99904218-99904240 GTAACATATCAGGTAACCAATGG No data
1029336472_1029336473 3 Left 1029336472 7:99904182-99904204 CCATTTTACTTAAAGACATAGAT 0: 1
1: 0
2: 4
3: 39
4: 385
Right 1029336473 7:99904208-99904230 AAAATTCTAAGTAACATATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029336472 Original CRISPR ATCTATGTCTTTAAGTAAAA TGG (reversed) Intronic
900828664 1:4948271-4948293 ATTTATGTCTTTAATTAAGGAGG - Intergenic
906182279 1:43832375-43832397 TTCTATCACTTTAAGAAAAAAGG - Intronic
907337290 1:53708462-53708484 ATCTATGAATTCAATTAAAAGGG - Intronic
908056419 1:60292059-60292081 ACTTAGGTCTTTATGTAAAAGGG - Intergenic
909508324 1:76420587-76420609 CTCTCTGTCTTTCAGTTAAAGGG + Intronic
910202904 1:84718308-84718330 ATATATGTCTCTAAGAAATATGG - Intergenic
910743577 1:90548572-90548594 GTATATGTCTTTTAGTAAGAAGG - Intergenic
911228576 1:95334827-95334849 ATCTATGTATTTAATAAAATAGG + Intergenic
911757915 1:101581961-101581983 ATCTATGCCTTTTTGTCAAAAGG - Intergenic
912276880 1:108268194-108268216 ATATATATGTTTAAGTAGAATGG + Intergenic
912291349 1:108426161-108426183 ATATATATGTTTAAGTAGAATGG - Intronic
912913278 1:113785148-113785170 ATCTTTGTTTTTAACAAAAAAGG - Intronic
914695682 1:150077073-150077095 ATATATGTTTTTAACAAAAAGGG + Exonic
916430343 1:164721946-164721968 TTCTATTTCTTTCACTAAAATGG - Intronic
917403792 1:174681707-174681729 GTTTATGTTTTTGAGTAAAAGGG + Intronic
917609149 1:176668783-176668805 ATATATGTCGTCAAGTATAAGGG - Intronic
918335308 1:183504763-183504785 ATCTGTGTCTGAAAGTAAGAGGG - Intronic
921768485 1:219003811-219003833 ATATATGTCTTTATATAAAAAGG + Intergenic
921968083 1:221114717-221114739 AGTTATTTCATTAAGTAAAAAGG + Intergenic
922625006 1:227031115-227031137 ATCTTTGTTTTTCAGTAAACAGG - Intronic
922742044 1:228019427-228019449 TTCTAAGTCTCCAAGTAAAAAGG + Intronic
924370431 1:243342624-243342646 ATTTATGTCTATGAATAAAATGG - Intronic
924405026 1:243734907-243734929 ATCTAAGTTTTTAACAAAAAAGG - Intronic
1063259403 10:4368606-4368628 ATCCATGACTTTCAGTAAAGTGG - Intergenic
1064545236 10:16443607-16443629 ATTTATGTAATTAGGTAAAAAGG + Intronic
1065677133 10:28188582-28188604 TTCCATGTCTTTGAGTGAAAAGG + Intronic
1065680670 10:28228344-28228366 ATCTATCACTTTAAGGATAAAGG + Intronic
1066351327 10:34639970-34639992 ATCTATGTTTGTATGTAACATGG - Intronic
1067104899 10:43359969-43359991 ATTTATATTTTAAAGTAAAATGG - Intergenic
1068823080 10:61400935-61400957 ATCTATGTATCTATGTTAAAGGG + Intergenic
1069810072 10:71152411-71152433 ATCCATGTGTATAAGTGAAATGG - Intergenic
1070238330 10:74653986-74654008 TTCTATGTCATAAAGAAAAAAGG + Intronic
1070363703 10:75715448-75715470 ATATATGTATTTAAAAAAAAAGG - Intronic
1071955828 10:90758398-90758420 ATCAATGGCATGAAGTAAAAAGG + Intronic
1072460957 10:95618047-95618069 AACTATGTCTTATAGTAAAGAGG + Intronic
1072494342 10:95940706-95940728 ATCTATGACTTTAAAAATAAAGG + Intergenic
1072832907 10:98678184-98678206 AACTATGACTTTCAGTATAAAGG + Intronic
1073995342 10:109309263-109309285 ATCTATTTCTGTGAGCAAAAGGG + Intergenic
1074504595 10:114057449-114057471 AGCTATATCGTTAAATAAAATGG - Intergenic
1076025020 10:127104704-127104726 ACCTGTGTCTTTAAGTAAGAGGG - Intronic
1076088758 10:127659874-127659896 ATCTATGTATTTATGTTAACAGG + Intergenic
1078265432 11:9752897-9752919 ATATTTTTTTTTAAGTAAAATGG + Exonic
1078295319 11:10062542-10062564 ATGTATGTCTTTTTTTAAAATGG - Intronic
1079216498 11:18517371-18517393 ATTTATGTCTATAATTAATATGG + Intronic
1080202436 11:29688420-29688442 ACCTATTCCTTTAACTAAAAAGG + Intergenic
1080500413 11:32865502-32865524 ATATTTGTCTTAAAGTAATATGG - Intergenic
1081025723 11:38011835-38011857 GTCTATATCTTTCAGTAAGATGG - Intergenic
1081071613 11:38616885-38616907 CTCTACGTGTTCAAGTAAAAAGG - Intergenic
1081237963 11:40668877-40668899 TTCTTTGTCTTTAAGGAAGAAGG + Intronic
1082820397 11:57541016-57541038 AGCAATGTCTTAAAGTAAGAGGG - Intergenic
1083374462 11:62208446-62208468 ATACATGGCTTTTAGTAAAATGG - Intergenic
1086347870 11:85915887-85915909 ATTTATGTATTAAAGTAAGAGGG - Intronic
1086475973 11:87174707-87174729 AACTGTGACTTTAAGTGAAATGG + Intronic
1087279327 11:96192506-96192528 ATCTATGATTCTAAGAAAAATGG + Intronic
1087827124 11:102778205-102778227 ATCTCTACTTTTAAGTAAAAAGG + Intronic
1088104267 11:106187940-106187962 ATTTTTGTCTTGAAGTAAAGTGG + Intergenic
1088345279 11:108817019-108817041 AACTTTGACTTTAAGAAAAATGG + Intronic
1088685092 11:112278477-112278499 ATCTATGTTCATTAGTAAAAGGG - Intergenic
1089897599 11:121947272-121947294 GTCTATGTCTAGACGTAAAAAGG + Intergenic
1090337041 11:125976830-125976852 AGCTATTTCCTTAACTAAAAAGG - Intronic
1090889261 11:130908395-130908417 TTCTTTCTTTTTAAGTAAAAAGG + Intronic
1091194649 11:133720522-133720544 ATTCAGGTCTTTGAGTAAAAGGG + Intergenic
1091294400 11:134463256-134463278 ATCAATGTCTATATGTGAAAGGG + Intergenic
1091717106 12:2785894-2785916 ATCTATGTCTATAAATGAAGTGG - Intergenic
1091899033 12:4128839-4128861 ATCTATGTTTGTTAGTGAAATGG + Intergenic
1094287264 12:28809731-28809753 AATTTTGTCTTAAAGTAAAATGG - Intergenic
1094694421 12:32803440-32803462 ATCTGTGTTTATAAATAAAATGG + Intronic
1095327802 12:40918512-40918534 ATCTTTGTTTTGAATTAAAATGG + Intronic
1095563712 12:43595651-43595673 ACATTTGTCTTTAAATAAAAAGG - Intergenic
1095934876 12:47667572-47667594 AACTGTGACTTTATGTAAAACGG + Intronic
1098288741 12:68934394-68934416 ATCTATATCTGTAAGAAAGAAGG - Intronic
1098615827 12:72520769-72520791 ATCTAAGTCTTAAAGTAATAAGG + Intronic
1098624083 12:72640632-72640654 ATCTAAGTCTTAAAGTAATAAGG + Intronic
1098669827 12:73212668-73212690 ATATACGTCTATAAGTGAAATGG + Intergenic
1099061758 12:77919552-77919574 ACTTATGTATTTTAGTAAAATGG - Intronic
1100341898 12:93687229-93687251 ATCCATGTTTTAAAGTGAAATGG - Intronic
1100430094 12:94524064-94524086 ATATAACTCTTTAAGTATAAAGG - Intergenic
1101271115 12:103145895-103145917 ATCCATGTTTTTAAATCAAAAGG - Intergenic
1101716090 12:107313984-107314006 ATATATGTGTTTAAACAAAAAGG + Intergenic
1102777620 12:115534321-115534343 ATCTATTTCTTTAAGAAATAAGG - Intergenic
1103105597 12:118222019-118222041 ATCTTTGTCTCTAAGTTAAAGGG - Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1104216098 12:126735431-126735453 ATCAATGTTTATAAGCAAAATGG - Intergenic
1105904891 13:24798275-24798297 AACTGTGACTTTAAGCAAAATGG - Intronic
1106926598 13:34619639-34619661 ATCTATTTACATAAGTAAAAAGG + Intergenic
1107023331 13:35774507-35774529 AGCTAGGACTTTGAGTAAAAGGG + Exonic
1108109823 13:47057055-47057077 ATCAATGGCTTTGAGTAAAGTGG + Intergenic
1108641790 13:52389511-52389533 ATATATGTCTATACGTAAAGTGG - Intronic
1108864693 13:54908916-54908938 ATCTAAGTCTGTAATTAAAGAGG + Intergenic
1108945983 13:56024469-56024491 ATGTGTTTCTTTAAGTAAATGGG + Intergenic
1108950050 13:56080756-56080778 CTGTGTGTCTTAAAGTAAAAAGG - Intergenic
1109320010 13:60799276-60799298 ATCATTGTCTTTATTTAAAAAGG - Intergenic
1109708586 13:66132969-66132991 ATCTATGACTTTGAGAAGAATGG + Intergenic
1110382498 13:74869945-74869967 CTCTAAGTTTTCAAGTAAAAGGG - Intergenic
1110959475 13:81603272-81603294 ATAAATTTATTTAAGTAAAATGG + Intergenic
1110962795 13:81651159-81651181 ATATATTTGTTTAAGTAAAGTGG + Intergenic
1113258361 13:108532305-108532327 CACTATGTGTTTAAGTCAAATGG + Intergenic
1115101712 14:29709226-29709248 ATTTATTTCCTTAAGTAAAAGGG + Intronic
1115424040 14:33234063-33234085 AAATATGTTTTTAAGTTAAAGGG + Intronic
1116093449 14:40337354-40337376 ATTTATGTCTTTAAATAAAGAGG - Intergenic
1116122242 14:40735866-40735888 ATAAATGTTTTTAAGTATAAAGG + Intergenic
1116746011 14:48819910-48819932 AGCTATGTTTTTTAGTAAAATGG + Intergenic
1117362200 14:54987106-54987128 TTTTATGACTTGAAGTAAAATGG - Intronic
1117419871 14:55533781-55533803 ATATATTTCTTTAAATAAACTGG + Intergenic
1118082204 14:62373708-62373730 ATATATGTCTTTAAGAAAAAGGG + Intergenic
1118422015 14:65616829-65616851 TTTTTTTTCTTTAAGTAAAAAGG + Intronic
1118568438 14:67168723-67168745 ATTTGCGTCTTTCAGTAAAATGG - Intronic
1119782373 14:77285215-77285237 GTCTATGTCTTTTTCTAAAATGG - Intronic
1120889010 14:89475188-89475210 ATCTATGTCTTTATATATATGGG - Intronic
1121029038 14:90642291-90642313 TTCTTTGTCTTCAAGTGAAAAGG - Intronic
1121155411 14:91679368-91679390 ATTTCTGTCCTAAAGTAAAATGG + Intronic
1121469623 14:94142073-94142095 AACCATGGCTTTAAGTGAAATGG + Intergenic
1122421996 14:101583629-101583651 GTCTGTGGCTTTGAGTAAAAGGG - Intergenic
1122668322 14:103350379-103350401 GTCTATGTCAGTAAGTAAAAGGG + Intergenic
1125734637 15:41915870-41915892 ATCTCTGTATTTAAGGAACAGGG - Intronic
1125853123 15:42923110-42923132 ATCTATATCTATAACTCAAAGGG - Intergenic
1127029167 15:54842619-54842641 TTCTTGGTCTTTATGTAAAATGG - Intergenic
1127744915 15:61958101-61958123 AACTTTTTCTTTAAGTCAAAAGG + Intronic
1128062885 15:64746481-64746503 ATCTCTGTGTTTCTGTAAAATGG - Intronic
1128615824 15:69108685-69108707 ATCCATGTCTCTAAGAAAAGTGG - Intergenic
1129948831 15:79567492-79567514 CTCTAAGTGTTCAAGTAAAAAGG + Intergenic
1131106912 15:89741204-89741226 ATCTCTTTCAATAAGTAAAAGGG + Intronic
1131654246 15:94438566-94438588 ATTGATGTCTTTAAATGAAAAGG + Intronic
1133641169 16:7718783-7718805 ATCTATGTCTGTGAGGCAAAGGG - Intergenic
1134236043 16:12467252-12467274 ATGTATGTCTCTAAGAGAAAAGG - Intronic
1135002376 16:18787656-18787678 ATCTTTATCTTTGAGTAAATGGG - Intronic
1135320932 16:21495887-21495909 AACTATGTCTTTAAAAAAAAAGG + Intergenic
1135373766 16:21927388-21927410 AACTATGTCTTTAAAAAAAAAGG + Intergenic
1135438020 16:22443329-22443351 AACTATGTCTTTAAAAAAAAAGG - Intergenic
1137341553 16:47612134-47612156 TGCCATGTCTTCAAGTAAAATGG - Intronic
1137519836 16:49183201-49183223 ATGTATGTCTTTAACTAAAAAGG + Intergenic
1137661134 16:50207490-50207512 ATCAATGTTTTTATGTTAAAAGG - Intronic
1137902032 16:52279272-52279294 ATAAATGTACTTAAGTAAAAAGG - Intergenic
1138974976 16:62194224-62194246 GTCTACGACTTTCAGTAAAATGG - Intergenic
1139007489 16:62591081-62591103 CTTCATTTCTTTAAGTAAAATGG - Intergenic
1139093091 16:63672874-63672896 ATTGATCTCTTTGAGTAAAAAGG - Intergenic
1140381806 16:74495563-74495585 TTCTAAGTCTTTAAATAGAATGG - Intronic
1140813936 16:78603967-78603989 TTCTATGTCTTGTAGTAGAAGGG - Intronic
1141023995 16:80526662-80526684 CTCTTTGTCTCTAAGTAAGAAGG - Intergenic
1142040036 16:87887420-87887442 AACTCTGTCTCAAAGTAAAAAGG - Exonic
1144312873 17:14029493-14029515 ATCTGTGTTTTTCAGTGAAACGG - Intergenic
1144331881 17:14231834-14231856 ATCTGTGTTTTTCAGTGAAACGG + Intergenic
1147549440 17:41429113-41429135 GTCTATGTCATTATGCAAAATGG - Intergenic
1148665794 17:49373747-49373769 ATCTATGTCATGAAATAAGAGGG + Intronic
1151554218 17:74838423-74838445 AGCTTTGTCTTTAAGCAAGAGGG - Exonic
1153616082 18:6935080-6935102 ATTTATGTCTTTCACTAAATTGG + Intergenic
1153801208 18:8670959-8670981 ATTTTTGTCCTAAAGTAAAATGG - Intergenic
1154223311 18:12476764-12476786 ATTGATGTTTTTAAGTATAAGGG - Intronic
1155421241 18:25658919-25658941 TTCAATGCTTTTAAGTAAAAAGG + Intergenic
1155741220 18:29290496-29290518 CTCTATGTATTCAAGTGAAAGGG + Intergenic
1155838548 18:30618830-30618852 CTCTAAGTGTTTAAGTGAAAAGG + Intergenic
1156184739 18:34648782-34648804 ATCTATTTCTTGAAGACAAAGGG - Intronic
1156189854 18:34705910-34705932 ATGTCTGTCTTTCAGTGAAAAGG + Intronic
1156838529 18:41584289-41584311 ATTTATGTATTTAAAAAAAAAGG - Intergenic
1157750228 18:50171939-50171961 ATATATGTCTTTTAGTAAATAGG - Intronic
1159535827 18:69713626-69713648 TTCTTTATATTTAAGTAAAACGG + Intronic
1159730298 18:72017984-72018006 ATCTCTGTTTTAAAGTACAATGG + Intergenic
1161670258 19:5603548-5603570 ATTTATATCTTTAATCAAAATGG - Intronic
1163997021 19:21060154-21060176 ATCTATACCTTTAAGTAAAGTGG - Intergenic
928150316 2:28821891-28821913 ATGGATGTCTGTAACTAAAAGGG + Intronic
928637755 2:33265625-33265647 ATATATGTCTTTAAAAAAACTGG - Intronic
929325508 2:40605976-40605998 ATGTTTTTGTTTAAGTAAAAAGG + Intronic
930388344 2:50727171-50727193 TTATATCTCTTTAAGTATAAGGG - Intronic
930561338 2:52963022-52963044 ATTTATGGCTTAAAGAAAAAAGG - Intergenic
930841311 2:55849204-55849226 ATTTTTGTCCTAAAGTAAAATGG - Intergenic
931681761 2:64755517-64755539 ATCTATGTTCATAAGTGAAATGG - Intergenic
932848743 2:75162317-75162339 AAATATTTCTTTAAGCAAAATGG + Intronic
933014806 2:77111788-77111810 ATTACTTTCTTTAAGTAAAAAGG + Intronic
933864799 2:86506471-86506493 AAGTATGTATTTCAGTAAAAAGG + Intronic
934835023 2:97578885-97578907 GTGTAAGTCTTTACGTAAAAAGG - Exonic
935761966 2:106329285-106329307 ATACAAGACTTTAAGTAAAAGGG + Intergenic
937644683 2:124253116-124253138 AACTGTGACTTTAAGCAAAATGG + Intronic
938023362 2:127924225-127924247 TTCTAAGTCTTTATGAAAAATGG + Intergenic
939221307 2:139304975-139304997 ATCTACGTCTTTCAGCATAAAGG - Intergenic
939510684 2:143100795-143100817 ATCTCAGTCTTTAACTTAAAAGG + Intronic
939733029 2:145808729-145808751 ATCTATGCATTTAAGAAATAAGG - Intergenic
940494421 2:154407257-154407279 ATGTATTTCTCTAAGTATAATGG + Intronic
940510780 2:154611648-154611670 AGCTTTGTTTTTAAGAAAAAAGG + Intergenic
940595922 2:155792945-155792967 ATATATGTCTAAAAGTATAAAGG + Intergenic
941161029 2:162034222-162034244 ATCTATGTGTATATTTAAAAAGG - Intronic
941776298 2:169397176-169397198 ATCTAGCTCTTTTAGTGAAATGG - Intergenic
942053057 2:172158608-172158630 GTCTAGGTCATTAAGTCAAAGGG + Intergenic
942395094 2:175538614-175538636 ATCTGTGTCTTTAAGTAATGAGG - Intergenic
943115794 2:183668383-183668405 ATCTGTTTCTTTAAGCATAAGGG - Intergenic
943355885 2:186854800-186854822 AACTATATCTTCAAATAAAAAGG + Intergenic
943465215 2:188220272-188220294 ATCTTTTTCTTTTAGAAAAAGGG - Intergenic
944082555 2:195804840-195804862 ATCTATCTATCCAAGTAAAATGG + Intronic
945287380 2:208096111-208096133 TTCTTTGTCTTTAAGGAAACAGG + Intergenic
945342676 2:208675874-208675896 ATCTATCTTTTTAAGAAATAAGG - Intronic
946524233 2:220500792-220500814 CTCTAAGTGTTCAAGTAAAAGGG + Intergenic
946624925 2:221601051-221601073 ATCTATGTCATTAAGCTAATGGG - Intergenic
946714532 2:222539383-222539405 TTCTAGGTATTTAAGCAAAATGG + Intronic
946784651 2:223230052-223230074 AACTTTCTCTATAAGTAAAATGG - Intergenic
946849917 2:223895735-223895757 AGCTGAGTCTTTAAGCAAAAAGG + Intronic
947317945 2:228882714-228882736 ATGTATGTTTTTAAGTAAATTGG - Intronic
947346770 2:229199685-229199707 ATATATGTCTTCAAGACAAATGG + Intronic
947359434 2:229332669-229332691 ATCTATGTTTTTTAGCACAAGGG - Intergenic
947937320 2:234019210-234019232 GTCTTGGTGTTTAAGTAAAAAGG - Exonic
948929352 2:241121629-241121651 ATTTATGTCTATATTTAAAATGG - Intronic
1168822979 20:788917-788939 ATCTTTGACATTAAGAAAAAAGG - Intergenic
1169985448 20:11438445-11438467 ATCTCTGTCTTTCCGTAAAATGG + Intergenic
1170104906 20:12743649-12743671 ATCTATGACCCTAAGTAAAGGGG - Intergenic
1170237374 20:14121962-14121984 ATTTATGTCTCTAAATTAAAAGG - Intronic
1170501756 20:16981952-16981974 ATGTATTTATTAAAGTAAAAAGG - Intergenic
1172395667 20:34602623-34602645 ATGTATGTATGTAAGTAGAAGGG + Intronic
1173036551 20:39417028-39417050 ATTTTTTTCTTTAAGAAAAATGG + Intergenic
1173409210 20:42794637-42794659 ATCTTGGATTTTAAGTAAAAAGG + Intronic
1173844162 20:46177623-46177645 ATGTAGGACTTTTAGTAAAAAGG - Intronic
1174081775 20:47974976-47974998 ATGTATCTCTTTATTTAAAAAGG - Intergenic
1174371487 20:50091802-50091824 ATATATCTTTTTAAGAAAAATGG - Intronic
1175412593 20:58780586-58780608 ATCAAAGCCTGTAAGTAAAATGG + Intergenic
1177622762 21:23618100-23618122 ATCTTTATCTTTCATTAAAAAGG - Intergenic
1177636432 21:23793086-23793108 ATCTCTGGCTTTAAGAGAAATGG + Intergenic
1178670532 21:34587185-34587207 ATTTAAGATTTTAAGTAAAATGG + Intronic
1179451717 21:41472801-41472823 CACTATGTGTTTAAGGAAAAGGG + Intronic
1183915279 22:41112991-41113013 ATGTATATCTTTCAGTAAAAAGG + Intronic
1184206042 22:43003977-43003999 ATCTATGTCTGTAACTAACTTGG - Intronic
951803005 3:26617643-26617665 TTGAATGACTTTAAGTAAAAAGG + Intergenic
952291977 3:32025995-32026017 ATCTATGTCTGTATATATAAAGG - Intronic
952673937 3:36003785-36003807 ATCTAAGTGCTAAAGTAAAATGG - Intergenic
956367207 3:68517329-68517351 TTCAATGACTTTATGTAAAAAGG - Intronic
957281758 3:78159721-78159743 ATTTTTGTTTTTAAATAAAAGGG - Intergenic
957382583 3:79452099-79452121 ATCTATGTCATTAAAGACAATGG - Intronic
957572918 3:81971143-81971165 ATCTCTCACTTTAAATAAAAAGG + Intergenic
957836502 3:85598896-85598918 ATATATATCTTTTAGTCAAAAGG + Intronic
957847628 3:85758657-85758679 ATATTTGTCTTTAAGTTTAATGG - Intronic
957967120 3:87336738-87336760 ATGTATGTCTTACAGTAAAGTGG + Intergenic
957993993 3:87664986-87665008 ATCGCTTTCTTTAAGTGAAAAGG - Intergenic
958735558 3:98005104-98005126 ATCTCTGTCATTAAAAAAAATGG + Intronic
958933093 3:100228570-100228592 TTCTAAGTGTTCAAGTAAAAGGG + Intergenic
960189035 3:114681126-114681148 AGTTATGTTTTTAATTAAAATGG - Intronic
960525579 3:118706010-118706032 ATCTATTACTTTCAGTGAAAGGG - Intergenic
960713230 3:120551858-120551880 ATCTGTGTTTCTAAGTAAAATGG + Intergenic
960809673 3:121615717-121615739 AACATTATCTTTAAGTAAAAAGG + Intronic
961186823 3:124922356-124922378 ATCTATGTTTTAAAACAAAATGG - Intronic
963212245 3:142706218-142706240 ATCTTTGTCTTTAAAATAAATGG - Intronic
963459898 3:145598621-145598643 ACCTATGATTTTAATTAAAAAGG + Intergenic
964128438 3:153261496-153261518 ATCTATGTTTTTAGGTATAGGGG - Intergenic
964258077 3:154801607-154801629 ATCAAGCTCTTTCAGTAAAAAGG + Intergenic
964290059 3:155168464-155168486 ATATATTTATTTAAGTAAAATGG - Intronic
964296993 3:155244643-155244665 ATCTTTATCTCTAAATAAAATGG + Intergenic
964353133 3:155822880-155822902 ATCTCTATTTTTAATTAAAAAGG - Exonic
964400976 3:156298040-156298062 CTCTCTGCCTTAAAGTAAAATGG + Intronic
964469141 3:157033224-157033246 ATCTCTCACTTTAAGTCAAAAGG + Intronic
964942182 3:162172173-162172195 ATCTTTCACTTTAAATAAAAAGG + Intergenic
965059464 3:163765641-163765663 CTCAGTGTCATTAAGTAAAATGG - Intergenic
966055505 3:175683498-175683520 ATATATGTATTTAAGGTAAATGG + Intronic
967147644 3:186619740-186619762 AACTATAACTTTAAGAAAAATGG + Intronic
967235258 3:187377796-187377818 ATCTCTGTCTTTTGGTAAATGGG + Intergenic
967734266 3:192935632-192935654 CTGTATGTCTTTAAGTGAATAGG + Intergenic
968560069 4:1274928-1274950 ATCTCTGTCTTTGATTTAAAGGG + Intergenic
969125706 4:4946306-4946328 AAATATGTAATTAAGTAAAACGG + Intergenic
970047046 4:11866218-11866240 ATCTATTTTTTTAAGTTCAAGGG - Intergenic
970206218 4:13658201-13658223 ATATATGTATTTAAGTAAAAAGG + Intergenic
970731728 4:19112867-19112889 ATCTGCATATTTAAGTAAAAGGG - Intergenic
971539792 4:27801490-27801512 ATGTAAGTATTTAACTAAAACGG - Intergenic
971600743 4:28588110-28588132 ATTGATGTCTCTATGTAAAAAGG - Intergenic
973100636 4:46264609-46264631 ATCTATATCTATAAGGAATATGG + Intronic
973147916 4:46851692-46851714 ATCTAGGTCATTAAAGAAAAGGG - Intronic
973812897 4:54589916-54589938 ATATATGTCATTGATTAAAAAGG - Intergenic
975161113 4:71124883-71124905 ATATATGTGTTTAACTAAAAGGG + Intergenic
975207125 4:71657980-71658002 ATCTATGTTTATAAGTGAAATGG + Intergenic
976113561 4:81702400-81702422 AACTATGTAATTAAGAAAAATGG + Intronic
976691573 4:87873108-87873130 ATCTATAGCTTTAGGTAAGATGG - Intergenic
976942947 4:90728666-90728688 ATATATGTTTTTAAATAATAGGG - Intronic
977126052 4:93170087-93170109 ACCTCTGTCTTAAAATAAAATGG - Intronic
977858506 4:101926474-101926496 ATCTATTTGTTAAACTAAAATGG - Intronic
977862314 4:101977773-101977795 ATTTTTGTCTTTAAGAACAATGG - Intronic
977958361 4:103056216-103056238 AGCTATGTCTTTAAGAATCATGG + Intronic
979169147 4:117577622-117577644 ATCTAGCTCTTTATTTAAAAGGG + Intergenic
979569712 4:122205894-122205916 AGCAATGTCTTTCAATAAAAGGG - Intronic
979729225 4:124003017-124003039 AACAATGTCTCTAAGTTAAACGG - Intergenic
980189654 4:129507877-129507899 ATATCTGTCTTTAGGTAGAAAGG + Intergenic
980344290 4:131592962-131592984 ATCTATGTCAGTATCTAAAATGG + Intergenic
980627337 4:135390701-135390723 AACAATTTCTTTAAGGAAAAAGG - Intergenic
981434701 4:144706828-144706850 ATATGTGTCTTTAAGAGAAATGG + Intronic
981486090 4:145287870-145287892 ACCTATGTCTTTCAGCATAATGG + Intergenic
981520354 4:145655101-145655123 TTCTATCATTTTAAGTAAAATGG + Intronic
981527515 4:145720967-145720989 ATCTAAGTCATGAAGTTAAAAGG - Intronic
981545508 4:145889021-145889043 ATCGATGTTTTAAAGAAAAATGG - Intronic
982059255 4:151586524-151586546 AACTATATCTTTAAGTAGCAAGG - Intronic
982737798 4:159024233-159024255 ATCCATGTCTTCAAGAATAATGG - Intronic
982968403 4:161946408-161946430 ATTTATGACTTTCAGTATAATGG - Intronic
982997914 4:162374715-162374737 ATCTCTCTCTGGAAGTAAAACGG + Intergenic
983408030 4:167355950-167355972 ACCTATGTCATGCAGTAAAAGGG - Intergenic
984286815 4:177740881-177740903 ATAAATGTATTTAAATAAAAAGG + Intronic
984422567 4:179543442-179543464 CTCCAACTCTTTAAGTAAAAGGG - Intergenic
984514577 4:180722069-180722091 AACTGTGATTTTAAGTAAAATGG - Intergenic
985059811 4:186066340-186066362 ATCTTTGTCTATAGGTAAAATGG + Intergenic
985847469 5:2361643-2361665 ATAGATGTCTTTGAGTAACATGG + Intergenic
985862491 5:2484153-2484175 GTCTCTGCCTTTAAGTAAAGGGG - Intergenic
987187192 5:15434908-15434930 ATCTGTGTCTTTAGATATAATGG - Intergenic
987434611 5:17879385-17879407 ATCTCTTTCTGTAAATAAAATGG - Intergenic
988147443 5:27328868-27328890 AATGATTTCTTTAAGTAAAAAGG + Intergenic
988225710 5:28409183-28409205 ATTTATGTCCTAGAGTAAAATGG - Intergenic
988345250 5:30028784-30028806 ATGTATGTGTTAAAGTAATAGGG + Intergenic
989699271 5:44242388-44242410 ATCTCTGTCTTTTGTTAAAAGGG + Intergenic
990104086 5:52234898-52234920 ATCAATGCCATTAAGTAATAAGG + Intergenic
991333210 5:65515660-65515682 AGCTATGTCTTTGACTACAAAGG - Intergenic
991562309 5:67966659-67966681 ATCTTCCTCTTTAACTAAAATGG + Intergenic
991643605 5:68778414-68778436 AGCTATGTCTGCAAGCAAAAAGG + Intergenic
991663306 5:68971915-68971937 CTCTATGTTTATAAGTAATATGG - Intergenic
992207127 5:74441803-74441825 ATCTGTGTCTTAATGTAAATTGG - Intergenic
993128790 5:83870016-83870038 ATCAAAGACTTTAAGTAAAATGG + Intergenic
993229445 5:85213637-85213659 GTATATGTCTATAAGTAATATGG - Intergenic
993828149 5:92719497-92719519 ATCTATGTCCTTGAGTAGAGGGG - Intergenic
994076061 5:95651131-95651153 ATATGTGTTTTTATGTAAAATGG + Intronic
994574497 5:101559561-101559583 TTCTATGTATTTAATCAAAATGG + Intergenic
995447210 5:112258623-112258645 ATGTGTGTCTTTGAGAAAAATGG - Intronic
996180877 5:120418863-120418885 ATATATGGATTTAATTAAAATGG - Intergenic
996743215 5:126821259-126821281 TTTTATGAATTTAAGTAAAAAGG - Intronic
996881466 5:128301503-128301525 ATCTATGTCTGTAAGCAAACAGG + Exonic
997204541 5:132037606-132037628 ATCTATGTCTTTAATTGACCTGG - Intergenic
997862952 5:137435614-137435636 ATGTATTTCTTTAAGTAAAGTGG + Intronic
998521215 5:142802441-142802463 AACTGTGGCTTTAAGTAAAATGG + Intronic
999533830 5:152494104-152494126 ATCTTTGTCTTTAATTCAAATGG + Intergenic
1000358320 5:160422325-160422347 ATCTATGTTGATAAGGAAAATGG + Exonic
1000678249 5:164150466-164150488 ATATATGTGTTTAAATAAGAAGG + Intergenic
1000958796 5:167574251-167574273 ATCTCTCTCCTTAAATAAAACGG - Intronic
1001355167 5:171014206-171014228 ATCTATGTCTTTATATAAATAGG + Intronic
1002713669 5:181210951-181210973 TTCTATGTCTTGAAATAGAAAGG - Intergenic
1003038817 6:2668763-2668785 ATTTATTTTTTTAAGTAAGAAGG + Intronic
1003680653 6:8250752-8250774 CACAATGTCTGTAAGTAAAAGGG + Intergenic
1003822675 6:9917297-9917319 ATTTCTGTATTTCAGTAAAAAGG + Intronic
1007002181 6:38324276-38324298 ATCTGTTTCCTTAAATAAAATGG - Intronic
1007139062 6:39553692-39553714 ATATATACCTTTAAGTAAATTGG - Intronic
1007758118 6:44114087-44114109 ATCCATGTCTATAAGAAGAATGG - Exonic
1008180602 6:48323356-48323378 ATCTATGTCTTGGACTAAAATGG + Intergenic
1008368959 6:50712290-50712312 AACTTAATCTTTAAGTAAAAGGG - Intergenic
1008604491 6:53127294-53127316 TTCTTTGTCTTTATGAAAAATGG + Exonic
1009329055 6:62392578-62392600 ATCTATGTCTCTAAGAAACATGG - Intergenic
1009633786 6:66236206-66236228 ATATATGTTTTTGAGAAAAATGG + Intergenic
1009670443 6:66741573-66741595 ATGTTTTTTTTTAAGTAAAAGGG + Intergenic
1009710588 6:67313120-67313142 ATCAATGTCTGTAAGAAATATGG - Intergenic
1010335440 6:74676961-74676983 ATCTTTGTCTTCCAGAAAAATGG + Intergenic
1010499792 6:76583338-76583360 ATCTATTTCTCAGAGTAAAATGG - Intergenic
1011310933 6:85978620-85978642 ATCTATCTCTGTGAGCAAAAGGG + Intergenic
1012222466 6:96665798-96665820 ATCCATTTCTTTAAATAAAGAGG + Intergenic
1013601564 6:111709982-111710004 CTGTATGTGTTTAAGGAAAATGG + Intronic
1014569785 6:122995492-122995514 ATCTATGGATTTGAGGAAAAGGG - Intergenic
1015212171 6:130710763-130710785 ATGAATGTGTTTATGTAAAAAGG + Intergenic
1016295141 6:142565742-142565764 ATCTCTTTCTTTAAGAAAAAAGG + Intergenic
1016698917 6:147031891-147031913 ATTTATGTCTTTCAGGAACATGG + Intergenic
1017113857 6:150958152-150958174 ATAGATATTTTTAAGTAAAAAGG + Intronic
1019557262 7:1638802-1638824 ATATATGTTTTTAAGAAACAGGG + Intergenic
1020427659 7:8087567-8087589 AAATATGTCTTTAGATAAAATGG - Exonic
1021008555 7:15432588-15432610 ATATATGACTTTAATAAAAATGG - Intronic
1021113253 7:16719984-16720006 ATCCATGGCTTTAAATACAATGG + Intergenic
1021866221 7:24961200-24961222 ATCTATGTCTTTAATAAAGATGG + Intronic
1021874433 7:25035383-25035405 ATATATCTATTTAAGGAAAAAGG + Intergenic
1022041427 7:26585584-26585606 TTTTATTGCTTTAAGTAAAAGGG + Intergenic
1023382807 7:39624546-39624568 ATATATGTGTTTAAGTAGACGGG + Intronic
1023758072 7:43438782-43438804 ATGTATTTCTTTAGGTAACAGGG + Intronic
1024831076 7:53458361-53458383 TTATATAACTTTAAGTAAAAAGG + Intergenic
1027990485 7:85353826-85353848 ATCTGTGCATTTAAGTAAAGAGG - Intergenic
1028343887 7:89756824-89756846 ATCTACTTCTTTAAGATAAAGGG - Intergenic
1028822165 7:95224800-95224822 ATCTATTCCTTTGAGTAAATAGG - Intronic
1028825445 7:95267696-95267718 ACTTAAGTCTTTAAATAAAAAGG - Intronic
1028946739 7:96588560-96588582 CTCTATGTATTTAAATAATAAGG + Intronic
1029336472 7:99904182-99904204 ATCTATGTCTTTAAGTAAAATGG - Intronic
1029695328 7:102209201-102209223 GTCTAAGTCATTAAGGAAAACGG - Intronic
1030191808 7:106817838-106817860 ATCTCTGTCTTTAGGTAGAAAGG - Intergenic
1030503761 7:110393468-110393490 ATTTGTGTCTTTAAATAAATTGG - Intergenic
1030802718 7:113872337-113872359 TTCTTTGTTTTTAAGTGAAATGG - Intergenic
1030821897 7:114103346-114103368 TTCTGTGTCTTTGGGTAAAAAGG + Intronic
1030972105 7:116072579-116072601 ATATGTATCTTTAAGAAAAATGG - Intronic
1032575602 7:133050598-133050620 ATCTATGTTCATAAATAAAAAGG - Intronic
1033456068 7:141505014-141505036 ATCTATTTCTGTAAGGAAATAGG - Intergenic
1034239999 7:149603023-149603045 ATTTTTGTCTTTAAGTAACAGGG - Intergenic
1034611535 7:152374995-152375017 AGGTATGTCTGTAAGCAAAATGG - Intronic
1035193771 7:157197073-157197095 ATCTAAATCAGTAAGTAAAAAGG + Intronic
1035535480 8:387621-387643 ACATTTGCCTTTAAGTAAAAAGG + Intergenic
1036742644 8:11378681-11378703 ATTCATATTTTTAAGTAAAAAGG - Intergenic
1037045814 8:14301832-14301854 ATCTATCTCTTTTAGAAAATGGG + Intronic
1037174582 8:15931675-15931697 ATCTTTTTTTTTAAGTTAAATGG - Intergenic
1037281797 8:17249627-17249649 ATATATGTCATTATTTAAAAGGG - Intronic
1037343173 8:17869754-17869776 ATCAATGACTCTGAGTAAAAAGG + Intronic
1037352360 8:17974707-17974729 ATCTTTGTCTTGAAGTTAAAAGG - Intronic
1038104394 8:24416292-24416314 AGCTTTTTCTTTGAGTAAAAGGG - Intergenic
1039296478 8:36161199-36161221 AACTATGTTTATAAGCAAAATGG + Intergenic
1039371893 8:36993308-36993330 ATATTTGTCTCTAAGTAACAGGG + Intergenic
1039784414 8:40820081-40820103 AACTATGATTTTAAGTGAAATGG - Intronic
1040779775 8:51094358-51094380 ATCTAAGTCTCTAATGAAAATGG - Intergenic
1040909649 8:52505009-52505031 ATCTTTATCTGTAAATAAAAAGG - Intergenic
1041427757 8:57741963-57741985 ATTTATGGCGTGAAGTAAAAAGG + Intergenic
1041492315 8:58448056-58448078 ATCTAAATCAGTAAGTAAAAAGG - Exonic
1041496452 8:58490800-58490822 AGTTATGTCTTTTAATAAAAAGG - Exonic
1042120550 8:65483323-65483345 ATTTTTGTCTTAAAGTCAAAAGG + Intergenic
1043099791 8:76028845-76028867 ATCTGAGATTTTAAGTAAAAAGG - Intergenic
1043838649 8:85075069-85075091 ATCTATGTTTTTATGGAAAATGG - Intergenic
1044013122 8:87019230-87019252 AACTATTGTTTTAAGTAAAAAGG - Intronic
1044454769 8:92380725-92380747 ACAAATGTCTATAAGTAAAAAGG + Intergenic
1044455735 8:92391123-92391145 ATCTATTTCTGAAAGTAAAGGGG - Intergenic
1046126320 8:109913355-109913377 ATTTCTGTCTTTAATTGAAATGG + Intergenic
1048684416 8:136887981-136888003 ATCTATGTCTTTAATGCAGAAGG - Intergenic
1049046374 8:140155210-140155232 CTCTCTGTCTTTGAGTCAAATGG - Intronic
1049958895 9:719272-719294 ATGTTTGTTTTTAAGAAAAAGGG - Intronic
1050573621 9:6968812-6968834 ATCTATGTATTAAAGTGAGATGG + Intronic
1051696888 9:19777676-19777698 ACCTATGTATTTAAATAAATAGG - Intronic
1052254700 9:26441418-26441440 CTATATGTTTTTAGGTAAAAGGG - Intergenic
1052502891 9:29315821-29315843 ATCTCTGTTTTTAGATAAAATGG + Intergenic
1054865554 9:69996866-69996888 ATTTATGTCTGTAAGGGAAAGGG + Intergenic
1057984506 9:99697936-99697958 ATCTCTCACTTTAAATAAAAAGG + Intergenic
1058528590 9:105884517-105884539 AACTATGTCTATGAGCAAAAGGG - Intergenic
1058799767 9:108534252-108534274 ATCTAAGTCTTGAAGAACAAGGG + Intergenic
1058848682 9:108988581-108988603 GACTTTGGCTTTAAGTAAAATGG - Intronic
1058998574 9:110324583-110324605 CTCAATGTCTTTAAGTAAAAAGG - Intronic
1059010627 9:110455030-110455052 ATGTATTTATTTAAGTTAAAAGG + Intronic
1059068709 9:111111931-111111953 AGAAATGTCTTTAAGTACAATGG - Intergenic
1187240733 X:17510800-17510822 ATCTATGTCTTCAGTTAAATAGG - Intronic
1188090447 X:25958015-25958037 TTTTGTGTCTTTAAGTAAGAAGG + Intergenic
1188294140 X:28425636-28425658 AGCTATTTATTTAAATAAAATGG - Intergenic
1188333684 X:28901886-28901908 ATCTAACTCTTTAAGTAATTTGG + Intronic
1188645315 X:32559327-32559349 TTCTATGACCTTAAGTAAGAAGG + Intronic
1189528708 X:41855935-41855957 GTCTATGTTTTTAAGCAAAAAGG + Intronic
1190531135 X:51377673-51377695 ATCTATGTATTGTATTAAAATGG + Intergenic
1190640508 X:52479469-52479491 ATCTATATATTCAAGTTAAATGG - Intergenic
1190647164 X:52533396-52533418 ATCTATATATTCAAGTTAAATGG + Intergenic
1191773823 X:64790689-64790711 CTCTAAGTGTTCAAGTAAAAAGG + Intergenic
1192234605 X:69287760-69287782 TTTTAAGTCTTTAAGTATAAGGG - Intergenic
1192400679 X:70831619-70831641 CTCTATCTCTTCAAATAAAAGGG + Intronic
1193652760 X:84158707-84158729 ACATATGTCTTTATTTAAAAAGG - Intronic
1194444373 X:93969566-93969588 AACTATGTTTTTTAGTGAAAGGG - Intergenic
1194854553 X:98913616-98913638 AAATATGTGATTAAGTAAAAAGG - Intergenic
1194885134 X:99305445-99305467 ATGTATGTCTCTGAATAAAATGG + Intergenic
1195088104 X:101431847-101431869 ATATATGCCTTTAAGAAACATGG - Intronic
1196327923 X:114430096-114430118 ATATATGAATTTAAGTAGAAGGG + Intergenic
1200233420 X:154457419-154457441 ATATATGTGTTTAATAAAAATGG + Intergenic
1200944485 Y:8819949-8819971 ATCTGTCTCCTTAAGCAAAATGG - Intergenic