ID: 1029340568

View in Genome Browser
Species Human (GRCh38)
Location 7:99940527-99940549
Sequence TAGGAAGCACAACATAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029340568_1029340570 -10 Left 1029340568 7:99940527-99940549 CCATTCTTATGTTGTGCTTCCTA No data
Right 1029340570 7:99940540-99940562 GTGCTTCCTAGGACCGCTCCTGG No data
1029340568_1029340573 6 Left 1029340568 7:99940527-99940549 CCATTCTTATGTTGTGCTTCCTA No data
Right 1029340573 7:99940556-99940578 CTCCTGGTACCCACTGTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029340568 Original CRISPR TAGGAAGCACAACATAAGAA TGG (reversed) Intergenic
No off target data available for this crispr